Team:Imperial College/Protocols
From 2013.igem.org
Materials
Waste Conditioned Media (WCM)
We added 1g [http://en.wikipedia.org/wiki/Refuse-derived_fuel SRF] (Solid Recovered Fuel) /50 mL LB and then autoclaved the mixture. Once autoclaved, large waste chunks were removed through filter sterilisation (0.2uM filters) before being used in growth assays as waste conditioned media (WCM).
Protocols and Assays
PCR
We used Pfu Ultra polymerase for all reactions where we use the DNA for anything afterwards. Download the exact manual from here
We used MyTaq polymerase for colony PCR and checking plasmids. You can download the manual [http://www.bioline.com/documents/product_inserts/MyTaq%E2%84%A2%20DNA%20Polymerase.pdf#zoom=130 here].
Sequencing
We designed two primers for the prefix and suffix in order to better cover the biobrick parts, which we used together with the standard VF2 and VR primers. We also designed internal sequencing primers to verify the reads in long parts, such as phaCAB.
BBa_G1004 (=prefix) gtttcttcgaattcgcggccgcttctag Tm=63 BBa_G1005 (=revcompl sufix) gtttcttcctgcagcggccgctactagta Tm=64
Waste Growth Assay
O/N cultures of MG1655 transformed with (BBa_K639003) were diluted to OD 0.05 in either fresh LB or waste conditioned media and plated into 96 well plates (200ul/well). OD600 was read at the indicated time points and media only (LB) was taken away as background signal.
[http://biolabs.tmcc.edu/Micro%20Web/SerialDilutions.pdf Serial Dilution]
Preparation of Poly DEGA plates.
In addition to LB, place 0.5% poly DEGA in 20 mM Tris-HCl at pH 8.0 into the solution. In a 300 mL solution this translates to 1.5 mL poly DEGA. As poly DEGA is very viscous, before addition, ensure LB agar is kept at 70°C. We then used a magnetic stirrer to ensure that the poly DEGA was thoroughly mixed.