Team:Imperial College/Cloning

From 2013.igem.org

Revision as of 21:32, 25 September 2013 by Margarita K (Talk | contribs)

Contents

Cloning

During the project, we have built all the new biobricks for our various modules and we would not like to go into very much detail about the process and overwhelm you with dozens of gels since it mainly involves standard procedures and would be a boring read. You can find all about cloning in our dedicated lab book. Instead, we would like to give you a detailed account of how we constructed the improved and optimised PHB bioplastic synthesis part, [http://parts.igem.org/Part:BBa_K934001 BBa_K934001]. The initiative for improvements came from the predictions of the PHB synthesis metabolic models.

We made two new improved construct by modifying the native operon:

[http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051] The modellers in the drylab predicted that increased level of phaB enzyme will increase the amount of PHB produced and therefore we decided to change the native Ralstonia eutropha promoter and RBS to a strong constitutive E.coli promoter and RBS in front of the operon.

[http://parts.igem.org/Part:BBa_K11490?? BBa_K11490??] The second task in the wetlab came from the analysis of the metablic model: we realised that phaA enzyme is not necessary for PHB synthesis if we use 3HB as starting feedstock. Therefore we wanted to take out phaA an construct the phaCB operon for better PHB recycling.

Adding better promoter and RBS

We tested the promoter and RBS we were going to use by cloning them in front of amilCP blue chromoprotein ([http://parts.igem.org/Part:BBa_K1149020 BBa_K1149020]). It was bright blue and we had some fun playing around with it as part of our communication work "E.coli Art". PlasticityBluePlate.JPG


In order to change the promoter, we designed a forward primer that binds to the beginning of the first gene in the operon and contains a Xba restriction site: Pha_Fw (cgcttctagagatggctactgggaaaggagccg). We used pha_Fw and the suffix primer G1005 primer pain to amplify the insert out of the backbone. The new promoter and RBS were J23104 and B0034 from the biobrick [http://parts.igem.org/Part:BBa_K608002 BBa_K608002] We digested the pSB1C3 backbone with this biobrick with SpeI and PstI.

Summary diagram of construction steps:

PSB1C3_-_BBa_K934001_newCAB.png

Excluding phaA from operon

PSB1C3_-_BBa_K934001_phaBC.png

Our Sponsors

TueSponsorsEppendorf.png 125px Invitrogen.jpg Geneart.jpg CSynBI.JPG