Team:Hong Kong HKUST/Project/module4

Overview

Our artificial futile cycle is driven by the expression of two key glyoxylate cycle enzymes. Since mammalian cells lacks genes expressing glyoxylate shunt, we are working to introduce these genes form E. coli and assemble them in a constitutive construct which will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid.

Construct

The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by aceA and aceB genes, respectively. We are assembling aceA and aceB construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either aceA-containing plasmid or aceB-containing plasmid. The constitutive system will be fused with a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. aceA and aceB construct will be assembled separately in different plasmid before being combined them into one plasmid.

ACEA Construct

Backbone For ACEA construct, we decided to use a commercial plasmid called pShooter/myc/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, myc tag protein and polyadenylation site.

Constitutive Promoter In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing aceA gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell.

Assembly ACEA construct is assembled by extracting out aceA gene from E. coli BW25113 genome. The ligation product was confirmed by digestion check and sequencing.

Fig. 1 ACEA Construct Plasmid Map

ACEB Construct

Backbone pSB1C3 was used for ACEB construct.

Constitutive Promoter In consistency with the UCLA’s experiment, we will fuse aceB gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha is often useful in conditions where other promoters (such as CMV) have diminished activity or have been silenced. We cloned EF-1alpha from plasmid called iDUET101a (Addgene).

Tag protein We engineered in a FLAG protein tag in the 3’ ends of ACEB by including the sequence in aceB extraction primer
3’ primer to extract aceB with engineered FLAG tag:

GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG

[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]

Mitochondrial Leader Sequence Since pSB1C3backbone does not have any MLS and aceB needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/myc/mito (Invitrogen).

Assembly ACEB construct contain 5 parts that need to be assembled: EF-1alpha promoter, mitochondria leader sequence, aceB protein engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in Protocol page.

Fig. 2 ACEB Construct Plasmid Map

Protein Expression

The confirmed ACEA construct of CMV promoter – MLS – ACEA protein – myc epitope – polyadenylation sequence was transfected into HEK 293FT cell line and cultured for 24 hours to allow protein expression. The ACEA protein was extracted and western blot was performed with untransfected HEK293FT cells for negative control. Membrane used in blotting is PVDF. Primary antibody used is monoclonal Anti-c-Myc antibody produced in mouse by Sigma Aldrich (Catalog number: M4439) and anti-mouse-HRP antibody by…..(forgot). Blot is developed by appropriate substrate for five minutes and light film is exposed to the blot with 10 seconds exposure time. A single clear band is visible in the lane containing transfected cells’ protein in contrast to the negative control. Band size is compared to ladder and lies in between 40 kDa and 55 kDa. E. coli isocitrate lyase fused with myc-epitope size is around 49.5 kDa.

Characterization

According to UCLA‘s experiment, the expressions of aceA and aceB genes in human liver cell increase the fatty acid uptake rate. We planned to characterize aceA and aceB genes by measuring the fatty acid uptake rate and compare with the wild type cell. The initial concentration of fatty acid in the medium is quantified. The decrease in fatty acid concentration of the medium over the time span between the initial and the second quantification would be the fatty acid uptake rate of the system. The fatty acid uptake rate will be measured also in different fatty acid concentration.