Team:IIT Delhi/Biobrick
From 2013.igem.org
Revision as of 00:57, 28 September 2013 by Deepakmehta (Talk | contribs)
Biobricks Submitted BBa_K1170000 Acid Shock Response (asr) promoter is an acid-inducible promoter sequence, present in the genome of E. coli K12 bacteria. Fig 1: Position of acid shock response (asr) gene in the genome of E. coli K12. +1 site denotes the Transcriptional Start Site of the asr gene, -10 denotes the TATA box and the “Pho Box” denotes the TF site that is regulated by “Pho operon” in E. coli. When performed in LPM (Low Phosphate Minimal) media, induction due to asr promoter is almost 100 times at it’s most optimal pH, i.e. 4.8, as compared to pH 7.0 [1]. Fig 2: Northern Blot Analysis of the RNA isolated from E. coli K12 strain induction at two different pH at multiple time intervals, indicates significant production of mRNA transcribed under the P-asr promoter. We identified a minimal promoter region of 178bp, just before the ORF of the asr gene, that included the observable regulatory regions for acid induction. CGATCAAGACTACTATTATTGGTAGCTAAATTTCCCTTAAGTCACAATACGTTATTATCAACGCTGTAATTTATTCAGCGTTTGTACATAT CGTTACACGCTGAAACCAACCACTCACGGAAGTCTGCCATTCCCAGGGATATAGTTATTTCAACGGCCCCGCAGTGGGGTTAAATGA We designed the following primers for this sequence and PCR amplified the fragment from E. coli K12 genome (these are not in Standard Biobrick configuration as, initially, we used pUC19 as our vector for cloning): FP: GTCGAATTCCGATCAAGACTACTATTATTGGTAGCT (36) (EcoRI site) RP: GTAGGATCCTCATTTAACCCCACTGCGGGGCCGTTGAAATAAC (43) (BamHI site) BBa_K1170001 Following is the Super Folder Green Fluorescent Protein (SFGFP) encoding DNA sequence submitted to the registry: ATGCGTAAAGGCGAGGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTG GCGAGGGTGAAGGTGACGCAACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGT AACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGC TATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGGTAAACC GCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACAT CACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGATCACTAC CAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACG AGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAATGATGA (GenBank ID: HQ873313.1 GI: 321437460) |
Feel Free to contact us at igemiitdelhi2013 at gmail dot com if you have queries; requests; suggestions et cetera. Thanks to iGEM and IIT Delhi, we had an awesome summer! |
Our
Project was supported by and done by the students of IIT Delhi, India. |
This
project was done as a part of iGEM: iGEM Main Website |