|
|
| Line 411: |
Line 411: |
| | <div class="nine columns"><p id="1"></p> | | <div class="nine columns"><p id="1"></p> |
| | <h3>Overview</h3> | | <h3>Overview</h3> |
| - | Our artificial futile cycle is driven by the expression of two key enzymes in glyoxylate cycle. Since mammalian cells lacks genes expressing glyoxylate shunt, we are working to introduce these genes form <i>E. coli</i> and assemble them in a constitutive construct that will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid. | + | Our artificial futile cycle is driven by the expression of two key enzymes, isocitrate lyase and malate synthase, in glyoxylate cycle. These two enzymes are encoded by <i>aceA</i> and <i>aceB</i> genes, respectively. Since mammalian cells lacks genes expressing glyoxylate shunt, we introduce these genes form <i>E. coli</i> and assemble them in a constitutive construct composed of mammalian constitutive promoter, mitochondrial leader sequence, tag protein and terminator that will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid. |
| | <br> | | <br> |
| | </div> | | </div> |
| Line 417: |
Line 417: |
| | <div class="row"> | | <div class="row"> |
| | <div class="nine columns"><p id="2"></p> | | <div class="nine columns"><p id="2"></p> |
| - | <h3>Construct</h3>
| |
| - | The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by <i>aceA</i> and <i>aceB</i> genes, respectively. We are assembling <i>aceA</i> and <i>aceB</i> construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either <i>aceA</i>-containing plasmid or <i>aceB</i>-containing plasmid. The constitutive system will be fused with a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. <i>aceA</i> and <i>aceB</i> construct will be assembled separately in different plasmid before being combined into one plasmid.
| |
| - | <h5><b>ACEA Construct</b></h5>
| |
| - | <p id="construct"><b>Backbone</b> For ACEA construct, we decided to use a commercial plasmid called pShooter/myc/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, myc tag protein and polyadenylation site.
| |
| - | <br><br>
| |
| - | <b>Constitutive Promoter</b> In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing aceA gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell. <br><br>
| |
| - | <b>Assembly</b> ACEA construct is assembled by extracting out <i>aceA</i> gene from <i>E. coli</i> BW25113 genome. The ligation product was confirmed by digestion check and sequencing.
| |
| - | <br>
| |
| - | </p><br>
| |
| - | <center><img src="https://static.igem.org/mediawiki/2013/f/f2/Acea.jpg"><br><br><p> Fig. 1 ACEA Construct Plasmid Map</p></center><br>
| |
| - | <h5><b>ACEB Construct</b></h5>
| |
| - | <p id="construct"><b>Backbone</b> pSB1C3 was used for ACEB construct.
| |
| - | <br><br>
| |
| - | <b>Constitutive Promoter</b> In line with the UCLA’s experiment, we will fuse <i>aceB</i> gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha is often useful in conditions where other promoters (such as CMV) have diminished activity or have been silenced. We cloned EF-1alpha from plasmid called iDUET101a (Addgene).<br><br>
| |
| - | <b> Tag protein</b> We engineered in a FLAG protein tag in the 3’ ends of ACEB by including the sequence in <i>aceB</i> extraction primer<br>
| |
| - | 3’ primer to extract <i>aceB</i> with engineered FLAG tag:
| |
| - | <center>GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG</center><br>
| |
| - | <p id="construct"><i>[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]</i><br><br>
| |
| - | <b>Mitochondrial Leader Sequence</b> Since pSB1C3 backbone does not have any MLS and <i>aceB</i> needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/myc/mito (Invitrogen).<br><br>
| |
| - | <b>Assembly</b> ACEB construct contain 5 parts that needs to be assembled: EF-1alpha promoter, mitochondria leader sequence, <i>aceB</i> protein engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/protocol">Protocol</a> page.<br><br></p>
| |
| - | <center><img src="https://static.igem.org/mediawiki/2013/7/7b/Aceb.jpg"><br><br><p> Fig. 2 ACEB Construct Plasmid Map</p></center><br>
| |
| - | </p>
| |
| - |
| |
| - | </div>
| |
| - | </div>
| |
| - | <div class="row">
| |
| - | <div class="nine columns"><p id="3"></p>
| |
| - | <h3>Protein Expression</h3>
| |
| - | The confirmed ACEA construct of CMV promoter – MLS – ACEA protein – myc epitope – polyadenylation sequence was transfected into HEK 293FT cell line and cultured for 24 hours to allow protein expression. The ACEA protein was extracted and western blot was performed with un-transfected HEK293FT cells for negative control. Membrane used in blotting is PVDF. Primary antibody used is monoclonal Anti-c-Myc antibody produced in mouse by Sigma Aldrich (Catalog number: M4439) and anti-mouse-HRP antibody by…..(forgot). Blot is developed by appropriate substrate for five minutes and light film is exposed to the blot with 10 seconds exposure time. A single clear band is visible in the lane containing transfected cells’ protein in contrast to the negative control. Band size is compared to ladder and lies in between 40 kDa and 55 kDa. <i>E. coli</i> isocitrate lyase fused with myc-epitope size is around 49.5 kDa.<br>
| |
| - |
| |
| - | </div>
| |
| - | </div>
| |
| - | <div class="row">
| |
| - | <div class="nine columns"><p id="4"></p>
| |
| - | <h3>Characterization</h3>
| |
| - | According to UCLA‘s experiment, the expressions of <i>aceA</i> and <i>aceB</i> genes in human liver cell increase the fatty acid uptake rate. We planned to characterize <i>aceA</i> and <i>aceB</i> genes by measuring the fatty acid uptake rate and compare with the wild type cell. The initial concentration of fatty acid in the medium is quantified. The decrease in fatty acid concentration of the medium over the time span between the initial and the second quantification would be the fatty acid uptake rate of the system. The fatty acid uptake rate will be measured also in different fatty acid concentration. <br>
| |
| | | | |
| | </div> | | </div> |
"
