Team:NJU China/Modeling

From 2013.igem.org

(Difference between revisions)

Revision as of 16:43, 26 September 2013

<!DOCTYPE html> CSS-Only Responsive Layout with Smooth Transitions

Introduction Pharmacokinetic Modeling Parameters Mass balance equation of exosome Results and conclusions

Introduction

Pharmacokinetics is the quantitative study of the drug absorption, distribution and metabolism within the body. It shows the fluctuation of the drug concentration within a certain part of the body along the time. For a new drug, we need to first experimentally obtain the pharmacokinetic parameters and then make the pharmacokinetic model to predict the concentration change after drug administration. Thus pharmacokinetic model plays a vital role in new drug development. Since our targeting-exosome is a brand new drug delivery system, we need to make a pharmacokinetic model to check if it can really target the specific site we want and predict the concentration change within that site.

Pharmacokinetic modeling

After drug administration, what happened within the body is quite complex and all the tissues are involved in the drug metabolism. In order to construct a pharmacokinetic model, we need to first make a few simplification of the body to make a pharmacokinetic model feasible.

Based on the multi-compartmental model, we divide the human body into central compartment (blood circulation) and peripheral compartment (body tissues). Since the exosome is administrated by intravenous injection, we assume that the concentration of exosome within the blood circulation reached its peak soon after injection and there is no variation within different parts of the blood circulation. Inspired by the pharmacokinetic model made by iGEM Slovenia 2012, we subdivide the peripheral compartment into liver (our target organ), kidney, lung, rapidly perfused tissues (such as skin, muscle) and slowly perfused tissues (such as spleen, heart). Each peripheral compartment has blood exchange with the central blood circulation, and during this process, certain percentage of exosome flow through a compartment will be absorbed. Apart from that, some of the exosome get into the kidney will be eliminated. Based on these simplifications, our multi-compartmental model is shown in the figure 1.

<>

Targeting module

Specificity is one of the most vital goals that many different drug delivery system want to achieve, and that is also exactly what we are expecting from our biomissile.

To achieve specificity, we need to make our exosomes able to recognize distinctive sites within the body. In order to do that, the first step we took towards our exosome is outside modification. We wanted to add a target protein onto the surface of the exosomes to endow it with specificity, therefore we need to first find a protein naturally expressed on the surface of the exosomes and then fuse our target protein to the membrane protein of exosomes.

After a round of screen of the different membrane proteins on the exosomes’ surface, we chose to use lamp 2b to construct our fusion protein.

Lamp 2b (lysosomal associated membrane protein 2b) is a protein ubiquitously expressed on the surface of the exosomes. By genetically engineering a target protein to the outmembrane part of the lamp 2b, we can use the lamp 2b to bring our target protein to the surface of the exosomes. Thus we can endow the exosome with site-specificity by the addition of the fusion protein.

As the target protein in the lamp 2b is an exchangeable part, we can use different target protein to direct our exosomes to different parts of human body.

Liver，T cells and especially brain are poor targeting sites for previous drug delivery system. In order to prove that our target module does work, we choose to target these sites for testing.
To see more about Brain , Liver and T cell targeting.

Killing Module

Based on the utilization of natural exosome produced by HEK 293T cells and the modification of the surface protein, lamp-2b, now we have got a site-specific drug carrier, which can bring medicine to cells with a certain kind of receptors. In order to expand power of our system, we decide to pack the carrier with our disease-killing device, siRNA.

Recently, small interfering RNA (siRNA) is emerging as a promising therapeutic drug against a wide array of diseases. siRNA functions through the RNA interference pathway. Normal double-stranded RNA is first processed by Dicer and Argo to become short double-stranded RNA, which is about 21-25bp in length. Then it will recruit other proteins to form RISC( RNA induced silencing complex). One of the two RNA stands in the RISC will be degraded and the remaining strand can specifically recognize other mRNA by base pairing. Once the RISC bind to other complementary mRNA, it will destroy the mRNA through the RNAi pathway. By designing siRNA against certain virus genes, we can use siRNA as molecular medicine for diseases treatment. siRNAs are well tolerated and have suitable pharmacokinetic properties

This discovery encouraged us to harness siRNA as specific targeted drugs producing a therapeutic benefit in our system. Now, not only can we carry drugs into a specific site, but also the drug itself specifically turn off the disease-causing gene expression rather than destroy the whole cell or disrupt normal protein production in a healthy cell.

Design
We carried out this experiment in the HBV testing model to verify that our big idea can work in real human disease. The first step in designing a siRNA for viral gene silencing is to choose the siRNA target sites. Firstly, we should find 21 nt sequences in the target mRNA from Hepatitis b virus (HBV) genome that begin with an AA dinucleotide.
And then, choose target sites from among the ‘AA sequences’ based on guidelines like ‘Target sequence should have a GC content of around 50%’; ‘Avoid stretches of 4 or more bases such as AAAA, CCCC; ’‘Avoid regions with GC content <30% or > 60%.’
We completed the first two steps in the software, siRNA Designer.
Finally, we performed BLAST homology search to avoid off-target effects on other genes or sequences

After screening the HBV genome using the methods mentioned above, we ultimately find three candidates as our anti-HBV siRNA
siRNA 308 TATGCCTCAAGGTCGGTCGTT against HBx gene in HBV genome
siRNA 467 TCCCATAGGAATCTTGCGAAA against HBsAG gene in HBV genome
siRNA 516 ACAAATGGCACTAGTAAACTG against HBsAg gene in HBV genome
The number 308, 467 and 516 in the siRNA indicates their target sites within their target gene.

We cloned these three siRNAs into the vector pENTR/U6, which is a plasmid backbone for high yield of siRNA.
By cloning the siRNAs into eukaryotic expression vectors, large amounts of corresponding siRNAs can be produced by the cell, instead of chemically synthesizing the siRNAs.
In these vectors, we use an RNA polymerase Ⅲpromoter U6 to direct the transcription of siRNA， and an enhancer which greatly increases the gene transcription

Results
1.siRNA screen
Since we have designed three types of siRNA target to different HBV genes, we need to determine which one would be optimal for HBV treatment.

To achieve this goal, we first tested their relative expression level in cells and exosomes. Expression of them was confirmed by quantitative PCR (qPCR) analysis of transfected HEK 293t cells and exosomes collected from the culture medium. The result suggested that 467 siRNA had much higher level of expression in both cells (Fig.1) and exosomes (36h post-transfection)(Fig.2). Since we need high yield of siRNA in the exosome, we decided to choose 467 as our ‘kill device’.

Fig.1 :qPCR analysis of relative siRNA level in 293t cells. Result showed that 467 siRNA has a relatively higher level of expression than that of 308 siRNA and 516 siRNA.

Fig.2 :qPCR analysis of relative siRNA level in 293t cells. 24 hours after transfection, 516 has a relatively higher expression level in exosomes. However, after 36h’s transfection, 467 performed a significant increase in expression level, almost 100 times of that of 516 and 308. Therefore, together with the data from Fig.1, we eliminated 516 siRNA and 308 siRNA from our list.

2.Silencing effect of siRNA 4667 towards HBsAG
We investigated the silencing effectiveness of siRNA 467 towards HBsAG to guarantee that it would work as we want. By qPCR analysis of HepG2 cell co-transfected with both siRNA 467 plasmid and HBsAg plasmid, we observed the significant down-regulation of HBsAg gene (Fig.3). This demonstrated that our siRNA 467 does function to silence the target gene, yet it could not prove that 467 siRNA would also work when it was encapsulated into our exosomes.

Fig. 3 :Silencing of HBsAg by siRNA 467. All groups were transfected by Lipo 2000. Control group was transfected with empty plasmid. siRNA-free group was transfected with HBsAg overexpression plasmid, and experimental group with both HBsAg overexpression plasmid and 467 siRNA plasmid. The result suggested that 467 siRNA successfully down-regulatethe HBsAg gene.

3.Silencing effect of siRNA 467 towards HBsAg after encapsulated in exosome
After transfecting 293t cells with 467 siRNA plasmids, we collected exsomes and then co-cultured them with HepG2 cells which had been transfected with HBsAg over-expression plasmid. qPCR analysis confirmed that the down-regulation of HBsAg was significant(Fig.4), and thus proved that our 467 siRNA could work effectively in exosomes.

Fig.4: All groups were transfected by Lipo. The first group was transfected without any plasmid while other three groups were transfected with HBsAg over-expression plasmid. Second group cultured without exogenous exosomes. Third group co-cultured with empty exosomes, and fourth with exosomes containing siRNA 467. These two kinds of exosomes were collected from 293t cells transfected without and with 467 siRNA plasmid, respectively. Then every group was analyzed for their HBsAg gene expression level through qPCR. Since group 2 and group 3 showed a similar level of expression, either of which is significantly higher than group 1, the HBsAg gene did express in those cells. Yet group 4, which was co-cultured with 467 exosomes, showed a relatively lower HBsAg expression level. That may indicate that 467 contained in exosomes had down-regulated the target gene.

4.Absolute quantification of siRNA 467 encapsulated into exosome
In order to better apply our exosomes in further experiment (mice experiment, for example), we needed to absolutely quantify the siRNA productivity in each μg of exosomes (whose quantity is measured base on protein concentration). By qPCR analysis of a series of siRNA with given concentration, we drew a standard curve (Fig.5). Then using this curve, we were able to determine the siRNA quantity within exosomes. Also, we tested the quantity of siRNA from both 24h post-transfection and 48h post-transfection in each experiment. The results showed that 24 hours after the transfection, the quantity of siRNA per 1μg exosome was 8*10-2 fmol in exosomes(Fig.6). However, after 48 hours, the number nearly doubled. It was 2*10-1 fmol(siRNA)/μg(exosome) in exosomes. The results helped us determine the dose of injection for mouse and establish the mathematical model.

Fig.5 siRNA 467 Standard Curve drawn through a series siRNA with given concentration.

Fig.6 Absolute quantification of siRNA 467 in exosomes, 24h and 48h post transfection, respectively.

Achievement

Starting from March, our lab work continues for 7 months. During these 7 months, we first came up with the idea of ‘biomissile’ via brainstorming, then carefully designed every component of our biomissile. And the most difficult part was to experimentally prove that every part of the system can work properly. From the hard work of the past 7 months, we have successfully done the following:

We designed and created a new anti-HBV siRNA biobrick(BBa_K1180000), and experimentally validated that it can significantly suppress the HBV viral gene. Apart from that, after transfection of HEK 293T cells with this part, the siRNA can be successfully encapsulated into the exosmes produced by the cells.

We designed and constructed a liver-targeting fusion protein (BBa_K1180003) . After transfecting the HEK 293T cells with this plasmid, we monitored the exosomes with this fusion protein on its surface successfully get into the Hep G2 cell.

We designed and constructed a brain-targeting fusion protein(BBa_K1180002). After transfecting the HEK 293T cells with this plasmid, the exosomes produced by the HEK 293T cells can successfully bring the siRNA contained into the mouse brain.

Combining the targeting module and kill module together, firstly it can target specific sites, apart from that, the siRNA contained within the exosome can specifically destroy the disease related gene. Thus we realize the idea of boimissile by using our engineered exosome for target-destruction of disease.

@@ Line 1: / Line 1: @@
-<!-- *** What falls between these lines is the Alert Box!  You can remove it from your pages once you have read and understood the alert *** -->
+<!DOCTYPE html>
+<html lang="en">
+    <head>
+		<meta charset="UTF-8" />
+        <meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1">
+        <title>CSS-Only Responsive Layout with Smooth Transitions</title>
+        <meta name="viewport" content="width=defvice-width, initial-scale=1.0">
+        <meta name="description" content="CSS-only Responsive Layout with Smooth Transitions" />
+        <meta name="keywords" content="css3, transitions, animations, css-only, navigation, smooth scrolling, full width, full height, window width, window height" />
+        <meta name="author" content="Codrops" />
+		<link href='http://fonts.googleapis.com/css?family=Josefin+Slab:400,700' rel='stylesheet' type='text/css'>
+<style type="text/css">
+/* hiding the top section*/
+body{position:absolute; top:0px; width:100%; height:1480px;}
+#top-section{
+   height:0px;
+    border:none;
+    width:980px;
+    margin:0 auto;
+    padding:0 0 0 0;
+    background-color:transparent;
+    overflow:hide;
-<html>
+}
-<div id="box" style="width: 700px; margin-left: 137px; padding: 5px; border: 3px solid #000; background-color: #fe2b33;">
+#p-logo{display:none;}
-<div id="template" style="text-align: center; font-weight: bold; font-size: large; color: #f6f6f6; padding: 5px;">
+#search-controls{display:none;}
-This is a template page. READ THESE INSTRUCTIONS.
+#top{display:none;}
+.firstHeading{display:none;}
+/* end of hiding the top section*/
+/* global setting*/
+#globalWrapper{position:absolute; top:0px;left:0px; width:100%; padding:0 0 0 0;margin:0 0 0 0;height:100%;font-family: calibri， Arial, Helvetica, sans-serif;}
+#content{
+    background-color:transparent;
+    border:none;
+    width:1360px;
+    height:700px;
+    marign:0 auto;
+    padding:0 0 0 0;
+    top:-40px;
+    }
+#bodyContent{
+    background-color:transparent;
+    border:none;
+    }
+siteSub{
+    display:none;
+    border:none;
+    }
+contentSub{
+    display:none;
+    }
+/* end of global setting*/
+/*hiding the footer-box*/
+#footer-box{display:none;}
+#catlinks{display:none;}
+/*end of hiding the footer book*/
+/* menu (page, edit ...) */
+#menubar {
+    background-color:transparent;
+    position: relative;
+    float:left;
+    white-space: nowrap;
+    top:-6px;
+    width: 490px;
+    z-index: 5000;
+    font-family: sans-serif;
+    font-size: 55%;
+    line-height: 1em;
+    z-index:99;
+}
+/* MAIN STYLE DEFINITIONS */
+a{
+color:#870203;
+-webkit-transition-duration:0.3s;
+-moz-transition-duration:0.3s;
+-o-transition-duration:0.3s;
+}
+a:hover {
+color:#3d3f3c;
+}
+a:visited{
+color:#870203;
+}
+td
+{
+	font-family: Helvetica;
+	font-size: 10pt;
+	vertical-align: top;
+	text-align: left;
+	padding-right: 10px;
+}
+tr
+{
+	vertical-align: top;
+}
+H1 {
+    font-family: Helvetica;
+    text-transform: uppercase;
+    color: #3d3f3c;
+    text-align: left;
+    }
+H4 {
+    font-family: Helvetica;
+    text-transform: uppercase;
+    color: #3d3f3c;
+    text-align: left;
+    }
+/* CONTENT HEADING STYLES - overrides some main.css styling */
+H6 {
+	font-family:'Caviar Dreams';
+		font-size:30px;
+		font-weight:500;
+		text-align:left;
+		text-transform:uppercase;
+		color: #3d3f3c;
+	border-bottom:1px solid orangered;
+	padding-bottom:10px;
+	margin:15px 0;
+}
+H1, H3 {
+	font-family:'Source Sans Pro';
+		font-weight:600;
+		text-transform:uppercase;
+}
+H1 {
+	font-size:20px;
+	border:none;
+}
+img.headshot {
+	width: 100px;
+	height: auto;
+	vertical-align: text-top;
+}
+body {
+	background:#fff;
+	font-family: Helvetica;
+}
+content {
+	background: transparent;
+}
+#tracking_nav
+{
+	margin: 0px 0px 0px 950px;
+	position: fixed;
+	color:#bababa;
+	border: 1px solid #3d3f3c;
+	background:#3d3f3c;
+	font-size: 16pt;
+	padding: 5px;
+	line-height: 120%;
+}
+#tracking_nav a { color:#ffffff; text-transform: lowercase;font-size: 16pt;}
+#tracking_nav a:hover {background:#bababa;}
+#parts_table
+{
+	border: 1px solid #870203;
+	border-collapse: collapse;
+	width: 70%;
+	margin: auto;
+}
+#parts_table td
+{
+	text-align: center;
+	margin: 5px;
+	border: 1px solid #870203;
+}
+#parts_table th
+{
+	background-color: #bababa;
+	border: 1px solid #870203;
+	color: #ffffff;
+}
+.table_part
+{
+	vertical-align: middle;
+}
+/* HEADER STYLES: banner, navbar, etc. */
+#banner { width:300px; display:block; float:left; }
+#banner img { width:100%; }
+ul#nav {
+	width:1800px;
+	margin:47px 0 0 100px;
+	position:relative;
+}
+#nav li {
+	color: #bbb;
+	background-color:none;
+	margin: 0 85px 0 0;
+	float: left;
+	position: relative;
+	list-style: none;
+	text-transform:uppercase;
+}
+#nav li:last-child { margin:0; }
+/* main level link */
+#nav a {
+	font-family:'Source Sans Pro', sans-serif;
+		font-size:10pt;
+		font-weight:500;
+		line-height:110%;
+		color: inherit;
+		text-decoration: none;
+	display: block;
+	padding: 0 0 0 5px;
+	margin: 0;
+}
+ul#nav > li > a {
+	line-height:12px;
+	border-left:solid 2px #bbb;
+	padding:0 0 0 3px;
+}
+#nav a:hover {
+	/*background-color: #870203;
+	color: #ffffff;*/
+}
+/* main level link hover */
+#nav .current a, #nav li:hover > a {
+	color: #000;
+	border-color:orangered;
+}
+/* sub levels link hover */
+#nav ul li:hover a, #nav li:hover li a {
+	border: none;
+	/*background-color: #FA9D1C;*/
+	color:#000;
+}
+#nav ul a:hover {
+	color: orangered !important;
+	/*background: #fff url(img/gradient.png) repeat-x 0 -100px !important;
+	text-shadow: 0 1px 1px rgba(0,0,0, .1);*/
+}
+/* dropdown */
+#nav li:hover > ul {
+	/*display: block;*/
+	opacity:1;
+	margin:0;
+	background-color: none;
+	z-index:0;
+}
+/* level 2 list */
+#nav ul {
+	/*display: none;*/
+	opacity:0;
+	margin: 20px 0 0 0;
+	padding: 7px 0 0 0;
+	width: 205px;
+	position: absolute;
+	left: 0;
+	z-index:-1;
+	-webkit-transition-duration:0.5s;
+	-moz-transition-duration:0.5s;
+	-o-transition-duration:0.5s;
+}
+#nav ul li {
+	float: none;
+	margin: 0;
+	padding: 0;
+}
+#nav ul a {
+	font-weight: normal;
+	/*text-shadow: 0 1px 0 #fff;*/
+}
+/* clearfix */
+#nav:after {
+	content: ".";
+	display: block;
+	clear: both;
+	visibility: hidden;
+	line-height: 0;
+	height: 0;
+}
+#nav {
+	display: inline-block;
+}
+html[xmlns] #nav {
+	display: block;
+}
+* html #nav {
+	height: 1%;
+}
+/* pinterest like photo grid for social page*/
+/*
+body {
+	background: url(http://subtlepatterns.com/patterns/scribble_light.png) ;
+}
+*/
+#wrapper {
+	width: 90%;
+	max-width: 1100px;
+	min-width: 800px;
+	margin: 50px auto;
+}
+#columns {
+	-webkit-column-count: 3;
+	-webkit-column-gap: 10px;
+	-webkit-column-fill: auto;
+	-moz-column-count: 3;
+	-moz-column-gap: 10px;
+	-moz-column-fill: auto;
+	column-count: 3;
+	column-gap: 15px;
+	column-fill: auto;
+}
+.pin {
+	display: inline-block;
+	background: #FEFEFE;
+	border: 2px solid #FAFAFA;
+	box-shadow: 0 1px 2px rgba(34, 25, 25, 0.4);
+	margin: 0 2px 15px;
+	-webkit-column-break-inside: avoid;
+	-moz-column-break-inside: avoid;
+	column-break-inside: avoid;
+	padding: 15px;
+	padding-bottom: 5px;
+	background: -webkit-linear-gradient(45deg, #FFF, #F9F9F9);
+	opacity: 1;
+	-webkit-transition: all .2s ease;
+	-moz-transition: all .2s ease;
+	-o-transition: all .2s ease;
+	transition: all .2s ease;
+}
+.pin img {
+	width: 100%;
+	border-bottom: 1px solid #ccc;
+	padding-bottom: 15px;
+	margin-bottom: 5px;
+}
+.pin p {
+	font: 12px/18px Arial, sans-serif;
+	color: #333;
+	margin: 0;
+}
+@media (min-width: 960px) {
+	#columns {
+		-webkit-column-count: 4;
+		-moz-column-count: 4;
+		column-count: 4;
+	}
+}
+@media (min-width: 1100px) {
+	#columns {
+		-webkit-column-count: 5;
+		-moz-column-count: 5;
+		column-count: 5;
+	}
+}
+#columns:hover .pin:not(:hover) {
+	opacity: 0.4;
+}
+.left-menu, .left-menu a {
+    text-align: left;
+    color:#999999;
+    text-transform: lowercase;
+}
+.left-menu:hover {
+    color: #D00000;
+    background-color: transparent;
+}
+.right-menu{width:400px; float:right}
+.right-menu, .right-menu a {
+    right: 0px;
+    text-align: right;
+    color: #999999;
+}
+#menubar ul {
+    color: #999999;
+    list-style: none;
+}
+#menubar li {
+    display: inline;
+    position: relative;
+    cursor: pointer;
+    padding-left: 0px;
+    padding-right: 0px;
+}
+.left-menu li a {
+    padding: 0px 10px 0px 0px;
+}
+.left-menu .selected {
+#    color: #999999;
+}
+#.left-menu .selected:hover {
+#    color: #999999;
+#}
+.left-menu:hover a {
+    color: #999999;;
+}
+.left-menu li a:hover {
+    color: #D00000;
+    text-decoration: underline;
+}
+.right-menu li {
+#    background-color: transparent;
+}
+.right-menu li a {
+    padding: 0px 15px 0px 0px;
+    color: #999999;;
+    background-color: transparent;
+}
+.right-menu li a:hover {
+    color: #D00000;
+    text-decoration: underline;
+}
+/* end menu (edit, page ...) */
+/*! normalize.css 2012-03-11T12:53 UTC - http://github.com/necolas/normalize.css */
+/* =============================================================================
+   HTML5 display definitions
+   ========================================================================== */
+/*
+ * Corrects block display not defined in IE6/7/8/9 & FF3
+ */
+article,
+aside,
+details,
+figcaption,
+figure,
+footer,
+header,
+hgroup,
+nav,
+section,
+summary {
+    display: block;
+}
+/*
+ * Corrects inline-block display not defined in IE6/7/8/9 & FF3
+ */
+audio,
+canvas,
+video {
+    display: inline-block;
+    *display: inline;
+    *zoom: 1;
+}
+/*
+ * Prevents modern browsers from displaying 'audio' without controls
+ * Remove excess height in iOS5 devices
+ */
+audio:not([controls]) {
+    display: none;
+    height: 0;
+}
+/*
+ * Addresses styling for 'hidden' attribute not present in IE7/8/9, FF3, S4
+ * Known issue: no IE6 support
+ */
+[hidden] {
+    display: none;
+}
+/* =============================================================================
+   Base
+   ========================================================================== */
+/*
+ * 1. Corrects text resizing oddly in IE6/7 when body font-size is set using em units
+ *    http://clagnut.com/blog/348/#c790
+ * 2. Prevents iOS text size adjust after orientation change, without disabling user zoom
+ *    www.456bereastreet.com/archive/201012/controlling_text_size_in_safari_for_ios_without_disabling_user_zoom/
+ */
+html {
+    font-size: 100%; /* 1 */
+    -webkit-text-size-adjust: 100%; /* 2 */
+    -ms-text-size-adjust: 100%; /* 2 */
+}
+/*
+ * Addresses font-family inconsistency between 'textarea' and other form elements.
+ */
+html,
+button,
+input,
+select,
+textarea {
+    font-family: sans-serif;
+}
+/*
+ * Addresses margins handled incorrectly in IE6/7
+ */
+body {
+    margin: 0;
+}
+/* =============================================================================
+   Links
+   ========================================================================== */
+/*
+ * Addresses outline displayed oddly in Chrome
+ */
+a:focus {
+    outline: thin dotted;
+}
+/*
+ * Improves readability when focused and also mouse hovered in all browsers
+ * people.opera.com/patrickl/experiments/keyboard/test
+ */
+a:hover,
+a:active {
+    outline: 0;
+}
+/* =============================================================================
+   Typography
+   ========================================================================== */
+/*
+ * Addresses font sizes and margins set differently in IE6/7
+ * Addresses font sizes within 'section' and 'article' in FF4+, Chrome, S5
+ */
+h1 {
+    font-size: 2em;
+    margin: 0.67em 0;
+}
+h2 {
+    font-size: 1.5em;
+    margin: 0.83em 0;
+}
+h3 {
+    font-size: 1.17em;
+    margin: 1em 0;
+}
+h4 {
+    font-size: 1em;
+    margin: 1.33em 0;
+}
+h5 {
+    font-size: 0.83em;
+    margin: 1.67em 0;
+}
+h6 {
+    font-size: 0.75em;
+    margin: 2.33em 0;
+}
+/*
+ * Addresses styling not present in IE7/8/9, S5, Chrome
+ */
+abbr[title] {
+    border-bottom: 1px dotted;
+}
+/*
+ * Addresses style set to 'bolder' in FF3+, S4/5, Chrome
+*/
+b,
+strong {
+    font-weight: bold;
+}
+blockquote {
+    margin: 1em 40px;
+}
+/*
+ * Addresses styling not present in S5, Chrome
+ */
+dfn {
+    font-style: italic;
+}
+/*
+ * Addresses styling not present in IE6/7/8/9
+ */
+mark {
+    background: #ff0;
+    color: #000;
+}
+/*
+ * Addresses margins set differently in IE6/7
+ */
+p,
+pre {
+    margin: 1em 0;
+}
+/*
+ * Corrects font family set oddly in IE6, S4/5, Chrome
+ * en.wikipedia.org/wiki/User:Davidgothberg/Test59
+ */
+pre,
+code,
+kbd,
+samp {
+    font-family: monospace, serif;
+    _font-family: 'courier new', monospace;
+    font-size: 1em;
+}
+/*
+ * Improves readability of pre-formatted text in all browsers
+ */
+pre {
+    white-space: pre;
+    white-space: pre-wrap;
+    word-wrap: break-word;
+}
+/*
+ * 1. Addresses CSS quotes not supported in IE6/7
+ * 2. Addresses quote property not supported in S4
+ */
+/* 1 */
+q {
+    quotes: none;
+}
+/* 2 */
+q:before,
+q:after {
+    content: '';
+    content: none;
+}
+small {
+    font-size: 75%;
+}
+/*
+ * Prevents sub and sup affecting line-height in all browsers
+ * gist.github.com/413930
+ */
+sub,
+sup {
+    font-size: 75%;
+    line-height: 0;
+    position: relative;
+    vertical-align: baseline;
+}
+sup {
+    top: -0.5em;
+}
+sub {
+    bottom: -0.25em;
+}
+/* =============================================================================
+   Lists
+   ========================================================================== */
+/*
+ * Addresses margins set differently in IE6/7
+ */
+dl,
+menu,
+ol,
+ul {
+    margin: 1em 0;
+}
+dd {
+    margin: 0 0 0 40px;
+}
+/*
+ * Addresses paddings set differently in IE6/7
+ */
+menu,
+ol,
+ul {
+    padding: 0 0 0 40px;
+}
+/*
+ * Corrects list images handled incorrectly in IE7
+ */
+nav ul,
+nav ol {
+    list-style: none;
+    list-style-image: none;
+}
+/* =============================================================================
+   Embedded content
+   ========================================================================== */
+/*
+ * 1. Removes border when inside 'a' element in IE6/7/8/9, FF3
+ * 2. Improves image quality when scaled in IE7
+ *    code.flickr.com/blog/2008/11/12/on-ui-quality-the-little-things-client-side-image-resizing/
+ */
+img {
+    border: 0; /* 1 */
+    -ms-interpolation-mode: bicubic; /* 2 */
+}
+/*
+ * Corrects overflow displayed oddly in IE9
+ */
+svg:not(:root) {
+    overflow: hidden;
+}
+/* =============================================================================
+   Figures
+   ========================================================================== */
+/*
+ * Addresses margin not present in IE6/7/8/9, S5, O11
+ */
+figure {
+    margin: 0;
+}
+/* =============================================================================
+   Forms
+   ========================================================================== */
+/*
+ * Corrects margin displayed oddly in IE6/7
+ */
+form {
+    margin: 0;
+}
+/*
+ * Define consistent border, margin, and padding
+ */
+fieldset {
+    border: 1px solid #c0c0c0;
+    margin: 0 2px;
+    padding: 0.35em 0.625em 0.75em;
+}
+/*
+ * 1. Corrects color not being inherited in IE6/7/8/9
+ * 2. Corrects text not wrapping in FF3
+ * 3. Corrects alignment displayed oddly in IE6/7
+ */
+legend {
+    border: 0; /* 1 */
+    padding: 0;
+    white-space: normal; /* 2 */
+    *margin-left: -7px; /* 3 */
+}
+/*
+ * 1. Corrects font size not being inherited in all browsers
+ * 2. Addresses margins set differently in IE6/7, FF3+, S5, Chrome
+ * 3. Improves appearance and consistency in all browsers
+ */
+button,
+input,
+select,
+textarea {
+    font-size: 100%; /* 1 */
+    margin: 0; /* 2 */
+    vertical-align: baseline; /* 3 */
+    *vertical-align: middle; /* 3 */
+}
+/*
+ * Addresses FF3/4 setting line-height on 'input' using !important in the UA stylesheet
+ */
+button,
+input {
+    line-height: normal; /* 1 */
+}
+/*
+ * 1. Improves usability and consistency of cursor style between image-type 'input' and others
+ * 2. Corrects inability to style clickable 'input' types in iOS
+ * 3. Removes inner spacing in IE7 without affecting normal text inputs
+ *    Known issue: inner spacing remains in IE6
+ */
+button,
+input[type="button"],
+input[type="reset"],
+input[type="submit"] {
+    cursor: pointer; /* 1 */
+    -webkit-appearance: button; /* 2 */
+    *overflow: visible;  /* 3 */
+}
+/*
+ * Re-set default cursor for disabled elements
+ */
+button[disabled],
+input[disabled] {
+    cursor: default;
+}
+/*
+ * 1. Addresses box sizing set to content-box in IE8/9
+ * 2. Removes excess padding in IE8/9
+ * 3. Removes excess padding in IE7
+      Known issue: excess padding remains in IE6
+ */
+input[type="checkbox"],
+input[type="radio"] {
+    box-sizing: border-box; /* 1 */
+    padding: 0; /* 2 */
+    *height: 13px; /* 3 */
+    *width: 13px; /* 3 */
+}
+/*
+ * 1. Addresses appearance set to searchfield in S5, Chrome
+ * 2. Addresses box-sizing set to border-box in S5, Chrome (include -moz to future-proof)
+ */
+input[type="search"] {
+    -webkit-appearance: textfield; /* 1 */
+    -moz-box-sizing: content-box;
+    -webkit-box-sizing: content-box; /* 2 */
+    box-sizing: content-box;
+}
+/*
+ * Removes inner padding and search cancel button in S5, Chrome on OS X
+ */
+input[type="search"]::-webkit-search-decoration,
+input[type="search"]::-webkit-search-cancel-button {
+    -webkit-appearance: none;
+}
+/*
+ * Removes inner padding and border in FF3+
+ * www.sitepen.com/blog/2008/05/14/the-devils-in-the-details-fixing-dojos-toolbar-buttons/
+ */
+button::-moz-focus-inner,
+input::-moz-focus-inner {
+    border: 0;
+    padding: 0;
+}
+/*
+ * 1. Removes default vertical scrollbar in IE6/7/8/9
+ * 2. Improves readability and alignment in all browsers
+ */
+textarea {
+    overflow: auto; /* 1 */
+    vertical-align: top; /* 2 */
+}
+/* =============================================================================
+   Tables
+   ========================================================================== */
+/*
+ * Remove most spacing between table cells
+ */
+table {
+    border-collapse: collapse;
+    border-spacing: 0;
+}
+/* Addition */
+/* apply a natural box layout model to all elements */
+/* By Paul Irish: http://paulirish.com/2012/box-sizing-border-box-ftw/ */
+ * { -moz-box-sizing: border-box; -webkit-box-sizing: border-box; box-sizing: border-box; }
+@font-face {
+	font-family:'RaphaelIcons';
+    font-weight: normal;
+    font-style: normal;
+}
+/* General Demo Style */
+body{
+	font-family: Georgia, serif;
+	background: #ddd;
+	font-weight: 400;
+	font-size: 15px;
+	color: #333;
+	overflow: hidden;
+	-webkit-font-smoothing: antialiased;
+}
+a{
+	color: #555;
+	text-decoration: none;
+}
+.clr{
+	clear: both;
+	padding: 0;
+	height: 0;
+	margin: 0;
+}
+/* Header Style */
+.codrops-top{
+	line-height: 24px;
+	font-size: 9px;
+	text-transform: uppercase;
+	z-index: 9999;
+	position: relative;
+	font-family: Cambria, Georgia, serif;
+}
+.codrops-top a{
+	padding: 0px 10px;
+	letter-spacing: 1px;
+	color: #888;
+	display: inline-block;
+	text-shadow: 0 1px 1px rgba(255,255,255,0.4);
+}
+.codrops-top span.right{
+	float: right;
+}
+.codrops-top span.right a{
+	float: left;
+	display: block;
+}
+@media screen and (max-width: 520px) {
+	.codrops-top { display: none; }
+}
+</style>
+<style type="text/css">
+.st-container {
+	position: absolute;
+	width: 100%;
+	height: 100%;
+	top: 0;
+	left: 0;
+	font-family: 'Josefin Slab', 'Myriad Pro', Arial, sans-serif;
+}
+.st-container > input,
+.st-container > a {
+	position: fixed;
+	bottom: 0px;
+	width: 20%;
+	cursor: pointer;
+	font-size: 16px;
+	height: 34px;
+	line-height: 34px;
+}
+.st-container > input {
+	opacity: 0;
+	z-index: 1000;
+}
+.st-container > a {
+	z-index: 10;
+	font-weight: 700;
+	background: #46e23a;
+	color: #fff;
+	text-align: center;
+	text-shadow: 1px 1px 1px rgba(151,24,64,0.2);
+}
+/* "Fix" for percentage rounding: add a background bar pseudo element with the same color like the labels */
+.st-container:before {
+	content: '';
+	position: fixed;
+	width: 100%;
+	height: 34px;
+	background: #46e23a;
+	z-index: 9;
+	bottom: 0;
+}
+#st-control-1, #st-control-1 + a {
+	left: 0;
+}
+#st-control-2, #st-control-2 + a {
+	left: 20%;
+}
+#st-control-3, #st-control-3 + a {
+	left: 40%;
+}
+#st-control-4, #st-control-4 + a {
+	left: 60%;
+}
+#st-control-5, #st-control-5 + a {
+	left: 80%;
+}
+.st-container > input:checked + a,
+.st-container > input:checked:hover + a{
+	background: #1c8211;
+}
+.st-container > input:checked + a:after,
+.st-container > input:checked:hover + a:after{
+	bottom: 100%;
+	border: solid transparent;
+	content: '';
+	height: 0;
+	width: 0;
+	position: absolute;
+	pointer-events: none;
+	border-bottom-color: #1c8211;
+	border-width: 20px;
+	left: 50%;
+	margin-left: -20px;
+}
+.st-container > input:hover + a{
+	background: #24ad3b;
+}
+.st-container > input:hover + a:after {
+	border-bottom-color: #24ad3b;
+}
+.st-scroll,
+.st-panel {
+	position: relative;
+	width: 100%;
+	height: 100%;
+}
+.st-scroll {
+	top: 0;
+	left: 0;
+	-webkit-transition: all 0.6s ease-in-out;
+	-moz-transition: all 0.6s ease-in-out;
+	-o-transition: all 0.6s ease-in-out;
+	-ms-transition: all 0.6s ease-in-out;
+	transition: all 0.6s ease-in-out;
+	/* Let's enforce some hardware acceleration */
+	-webkit-transform: translate3d(0, 0, 0);
+	-webkit-backface-visibility: hidden;
+}
+.st-panel{
+	background: #fff;
+	overflow: hidden;
+}
+#st-control-1:checked ~ .st-scroll {
+	-webkit-transform: translateY(0%);
+	-moz-transform: translateY(0%);
+	-o-transform: translateY(0%);
+	-ms-transform: translateY(0%);
+	transform: translateY(0%);
+}
+#st-control-2:checked ~ .st-scroll {
+	-webkit-transform: translateY(-100%);
+	-moz-transform: translateY(-100%);
+	-o-transform: translateY(-100%);
+	-ms-transform: translateY(-100%);
+	transform: translateY(-100%);
+}
+#st-control-3:checked ~ .st-scroll {
+	-webkit-transform: translateY(-200%);
+	-moz-transform: translateY(-200%);
+	-o-transform: translateY(-200%);
+	-ms-transform: translateY(-200%);
+	transform: translateY(-200%);
+}
+#st-control-4:checked ~ .st-scroll {
+	-webkit-transform: translateY(-300%);
+	-moz-transform: translateY(-300%);
+	-o-transform: translateY(-300%);
+	-ms-transform: translateY(-300%);
+	transform: translateY(-300%);
+}
+#st-control-5:checked ~ .st-scroll {
+	-webkit-transform: translateY(-400%);
+	-moz-transform: translateY(-400%);
+	-o-transform: translateY(-400%);
+	-ms-transform: translateY(-400%);
+	transform: translateY(-400%);
+}
+/* Content elements */
+.st-deco{
+	width: 200px;
+	height: 200px;
+	position: absolute;
+	top: 0px;
+	left: 50%;
+	margin-left: -100px;
+	background: #96faa9;
+	-webkit-transform: translateY(-50%) rotate(45deg);
+	-moz-transform: translateY(-50%) rotate(45deg);
+	-o-transform: translateY(-50%) rotate(45deg);
+	-ms-transform: translateY(-50%) rotate(45deg);
+	transform: translateY(-50%) rotate(45deg);
+}
+[data-icon]:after {
+    content: attr(data-icon);
+    font-family: 'RaphaelIcons';
+    color: #fff;
+	text-shadow: 1px 1px 1px rgba(0,0,0,0.2);
+	position: absolute;
+	width: 200px;
+	height: 200px;
+	line-height: 200px;
+	text-align: center;
+	font-size: 60px;
+	top: 50%;
+	left: 50%;
+	margin: -100px 0 0 -100px;
+	-webkit-transform: rotate(-45deg) translateY(25%);
+	-moz-transform: rotate(-45deg) translateY(25%);
+	-o-transform: rotate(-45deg) translateY(25%);
+	-ms-transform: rotate(-45deg) translateY(25%);
+	transform: rotate(-45deg) translateY(25%);
+}
+.st-panel h2 {
+	color: #3ae24a;
+	text-shadow: 2px 2px 2px rgba(0,0,0,0.5);
+	position: absolute;
+	font-size: 54px;
+	font-weight: 900;
+	width: 80%;
+	left: 10%;
+	text-align: center;
+	line-height: 50px;
+	margin: -70px 0 0 0;
+	padding: 0;
+	top: 23%;
+	-webkit-backface-visibility: hidden;
+}
+#st-control-1:checked ~ .st-scroll #st-panel-1 h2,
+#st-control-2:checked ~ .st-scroll #st-panel-2 h2,
+#st-control-3:checked ~ .st-scroll #st-panel-3 h2,
+#st-control-4:checked ~ .st-scroll #st-panel-4 h2,
+#st-control-5:checked ~ .st-scroll #st-panel-5 h2{
+	-webkit-animation: moveDown 0.6s ease-in-out 0.2s backwards;
+	-moz-animation: moveDown 0.6s ease-in-out 0.2s backwards;
+	-o-animation: moveDown 0.6s ease-in-out 0.2s backwards;
+	-ms-animation: moveDown 0.6s ease-in-out 0.2s backwards;
+	animation: moveDown 0.6s ease-in-out 0.2s backwards;
+}
+@-webkit-keyframes moveDown{
+% {
+		-webkit-transform: translateY(-40px);
+		opacity: 0;
+	}
+% {
+		-webkit-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-moz-keyframes moveDown{
+% {
+		-moz-transform: translateY(-40px);
+		opacity: 0;
+	}
+% {
+		-moz-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-o-keyframes moveDown{
+% {
+		-o-transform: translateY(-40px);
+		opacity: 0;
+	}
+% {
+		-o-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-ms-keyframes moveDown{
+% {
+		-ms-transform: translateY(-40px);
+		opacity: 0;
+	}
+% {
+		-ms-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@keyframes moveDown{
+% {
+		transform: translateY(-40px);
+		opacity: 0;
+	}
+% {
+		transform: translateY(0px);
+		opacity: 1;
+	}
+}
+.pra{
+	/*position: absolute;*/
+	text-align: left;
+	font-size: 16px;
+	line-height: 18px;
+	color: #8b8b8b;
+	/*z-index: 2;*/
+	padding: 0;
+	width: 80%;
+        height:70%;
+	margin-left: 10%;
+	margin-top: 11%;
+        font-weight: bold;
+	/*margin: 10px 0 0 0;*/
+	-webkit-backface-visibility: hidden;
+}
+#st-control-1:checked ~ .st-scroll #st-panel-1 p,
+#st-control-2:checked ~ .st-scroll #st-panel-2 p,
+#st-control-3:checked ~ .st-scroll #st-panel-3 p,
+#st-control-4:checked ~ .st-scroll #st-panel-4 p,
+#st-control-5:checked ~ .st-scroll #st-panel-5 p{
+	-webkit-animation: moveUp 0.6s ease-in-out 0.2s backwards;
+	-moz-animation: moveUp 0.6s ease-in-out 0.2s backwards;
+	-o-animation: moveUp 0.6s ease-in-out 0.2s backwards;
+	-ms-animation: moveUp 0.6s ease-in-out 0.2s backwards;
+	animation: moveUp 0.6s ease-in-out 0.2s backwards;
+}
+@-webkit-keyframes moveUp{
+% {
+		-webkit-transform: translateY(40px);
+		opacity: 0;
+	}
+% {
+		-webkit-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-moz-keyframes moveUp{
+% {
+		-moz-transform: translateY(40px);
+		opacity: 0;
+	}
+% {
+		-moz-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-o-keyframes moveUp{
+% {
+		-o-transform: translateY(40px);
+		opacity: 0;
+	}
+% {
+		-o-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@-ms-keyframes moveUp{
+% {
+		-ms-transform: translateY(40px);
+		opacity: 0;
+	}
+% {
+		-ms-transform: translateY(0px);
+		opacity: 1;
+	}
+}
+@keyframes moveUp{
+% {
+		transform: translateY(40px);
+		opacity: 0;
+	}
+% {
+		transform: translateY(0px);
+		opacity: 1;
+	}
+}
+/* Colored sections */
+.st-color,
+.st-deco{
+	background: #96faa9;
+}
+.st-color [data-icon]:after {
+	color: #96faa9;
+}
+.st-color .st-deco {
+	background: #fff;
+}
+.st-color h2 {
+	color: #fff;
+	text-shadow: 2px 2px 2px rgba(0,0,0,0.5);
+}
+.st-color p {
+	color: #fff;
+	color: rgba(255,255,255,0.8);
+}
+@media screen and (max-width: 520px) {
+	.st-panel h2 {
+		font-size: 42px;
+	}
+	.st-panel p {
+		width: 90%;
+		left: 5%;
+		margin-top: 0;
+	}
+	.st-container > a {
+		font-size: 13px;
+	}
+}
+@media screen and (max-width: 360px) {
+	.st-container > a {
+		font-size: 10px;
+	}
+	.st-deco{
+		width: 120px;
+		height: 120px;
+		margin-left: -60px;
+	}
+	[data-icon]:after {
+		font-size: 60px;
+		-webkit-transform: rotate(-45deg) translateY(15%);
+		-moz-transform: rotate(-45deg) translateY(15%);
+		-o-transform: rotate(-45deg) translateY(15%);
+		-ms-transform: rotate(-45deg) translateY(15%);
+		transform: rotate(-45deg) translateY(15%);
+	}
+}
+</style>
+<script language="Javascript">
+/* Modernizr 2.5.3 (Custom Build) | MIT & BSD
+ * Build: http://www.modernizr.com/download/#-cssanimations-csstransforms-csstransforms3d-csstransitions-shiv-cssclasses-teststyles-testprop-testallprops-prefixes-domprefixes
+ */
+;window.Modernizr=function(a,b,c){function z(a){j.cssText=a}function A(a,b){return z(m.join(a+";")+(b||""))}function B(a,b){return typeof a===b}function C(a,b){return!!~(""+a).indexOf(b)}function D(a,b){for(var d in a)if(j[a[d]]!==c)return b=="pfx"?a[d]:!0;return!1}function E(a,b,d){for(var e in a){var f=b[a[e]];if(f!==c)return d===!1?a[e]:B(f,"function")?f.bind(d||b):f}return!1}function F(a,b,c){var d=a.charAt(0).toUpperCase()+a.substr(1),e=(a+" "+o.join(d+" ")+d).split(" ");return B(b,"string")||B(b,"undefined")?D(e,b):(e=(a+" "+p.join(d+" ")+d).split(" "),E(e,b,c))}var d="2.5.3",e={},f=!0,g=b.documentElement,h="modernizr",i=b.createElement(h),j=i.style,k,l={}.toString,m=" -webkit- -moz- -o- -ms- ".split(" "),n="Webkit Moz O ms",o=n.split(" "),p=n.toLowerCase().split(" "),q={},r={},s={},t=[],u=t.slice,v,w=function(a,c,d,e){var f,i,j,k=b.createElement("div"),l=b.body,m=l?l:b.createElement("body");if(parseInt(d,10))while(d--)j=b.createElement("div"),j.id=e?e[d]:h+(d+1),k.appendChild(j);return f=["&#173;","<style>",a,"</style>"].join(""),k.id=h,(l?k:m).innerHTML+=f,m.appendChild(k),l||(m.style.background="",g.appendChild(m)),i=c(k,a),l?k.parentNode.removeChild(k):m.parentNode.removeChild(m),!!i},x={}.hasOwnProperty,y;!B(x,"undefined")&&!B(x.call,"undefined")?y=function(a,b){return x.call(a,b)}:y=function(a,b){return b in a&&B(a.constructor.prototype[b],"undefined")},Function.prototype.bind||(Function.prototype.bind=function(b){var c=this;if(typeof c!="function")throw new TypeError;var d=u.call(arguments,1),e=function(){if(this instanceof e){var a=function(){};a.prototype=c.prototype;var f=new a,g=c.apply(f,d.concat(u.call(arguments)));return Object(g)===g?g:f}return c.apply(b,d.concat(u.call(arguments)))};return e});var G=function(a,c){var d=a.join(""),f=c.length;w(d,function(a,c){var d=b.styleSheets[b.styleSheets.length-1],g=d?d.cssRules&&d.cssRules[0]?d.cssRules[0].cssText:d.cssText||"":"",h=a.childNodes,i={};while(f--)i[h[f].id]=h[f];e.csstransforms3d=(i.csstransforms3d&&i.csstransforms3d.offsetLeft)===9&&i.csstransforms3d.offsetHeight===3},f,c)}([,["@media (",m.join("transform-3d),("),h,")","{#csstransforms3d{left:9px;position:absolute;height:3px;}}"].join("")],[,"csstransforms3d"]);q.cssanimations=function(){return F("animationName")},q.csstransforms=function(){return!!F("transform")},q.csstransforms3d=function(){var a=!!F("perspective");return a&&"webkitPerspective"in g.style&&(a=e.csstransforms3d),a},q.csstransitions=function(){return F("transition")};for(var H in q)y(q,H)&&(v=H.toLowerCase(),e[v]=q[H](),t.push((e[v]?"":"no-")+v));return z(""),i=k=null,function(a,b){function g(a,b){var c=a.createElement("p"),d=a.getElementsByTagName("head")[0]||a.documentElement;return c.innerHTML="x<style>"+b+"</style>",d.insertBefore(c.lastChild,d.firstChild)}function h(){var a=k.elements;return typeof a=="string"?a.split(" "):a}function i(a){var b={},c=a.createElement,e=a.createDocumentFragment,f=e();a.createElement=function(a){var e=(b[a]||(b[a]=c(a))).cloneNode();return k.shivMethods&&e.canHaveChildren&&!d.test(a)?f.appendChild(e):e},a.createDocumentFragment=Function("h,f","return function(){var n=f.cloneNode(),c=n.createElement;h.shivMethods&&("+h().join().replace(/\w+/g,function(a){return b[a]=c(a),f.createElement(a),'c("'+a+'")'})+");return n}")(k,f)}function j(a){var b;return a.documentShived?a:(k.shivCSS&&!e&&(b=!!g(a,"article,aside,details,figcaption,figure,footer,header,hgroup,nav,section{display:block}audio{display:none}canvas,video{display:inline-block;*display:inline;*zoom:1}[hidden]{display:none}audio[controls]{display:inline-block;*display:inline;*zoom:1}mark{background:#FF0;color:#000}")),f||(b=!i(a)),b&&(a.documentShived=b),a)}var c=a.html5||{},d=/^<|^(?:button|form|map|select|textarea)$/i,e,f;(function(){var a=b.createElement("a");a.innerHTML="<xyz></xyz>",e="hidden"in a,f=a.childNodes.length==1||function(){try{b.createElement("a")}catch(a){return!0}var c=b.createDocumentFragment();return typeof c.cloneNode=="undefined"||typeof c.createDocumentFragment=="undefined"||typeof c.createElement=="undefined"}()})();var k={elements:c.elements||"abbr article aside audio bdi canvas data datalist details figcaption figure footer header hgroup mark meter nav output progress section summary time video",shivCSS:c.shivCSS!==!1,shivMethods:c.shivMethods!==!1,type:"default",shivDocument:j};a.html5=k,j(b)}(this,b),e._version=d,e._prefixes=m,e._domPrefixes=p,e._cssomPrefixes=o,e.testProp=function(a){return D([a])},e.testAllProps=F,e.testStyles=w,g.className=g.className.replace(/(^|\s)no-js(\s|$)/,"$1$2")+(f?" js "+t.join(" "):""),e}(this,this.document);
+</script>
+		<!--[if lte IE 8]>
+			 <link rel="stylesheet" type="text/css" href="css/simple.css" />
+		<![endif]-->
+    </head>
+    <body>
+        <div class="container">
+			<div class="st-container">
+				<input type="radio" name="radio-set" checked="checked" id="st-control-1"/>
+				<a href="#st-panel-1">Introduction</a>
+				<input type="radio" name="radio-set" id="st-control-2"/>
+				<a href="#st-panel-2">Pharmacokinetic Modeling</a>
+				<input type="radio" name="radio-set" id="st-control-3"/>
+				<a href="#st-panel-3">Parameters</a>
+				<input type="radio" name="radio-set" id="st-control-4"/>
+				<a href="#st-panel-4">Mass balance equation of exosome</a>
+				<input type="radio" name="radio-set" id="st-control-5"/>
+				<a href="#st-panel-5">Results and conclusions</a>
+				<div class="st-scroll">
+					<section class="st-panel" id="st-panel-1">
+						<div class="st-deco" data-icon="1"></div>
+						<h2>Introduction</h2>
+<div class="pra">
+Pharmacokinetics is the quantitative study of the drug absorption, distribution and metabolism within the body. It shows the fluctuation of the drug concentration within a certain part of the body along the time. For a new drug, we need to first experimentally obtain the pharmacokinetic parameters and then make the pharmacokinetic model to predict the concentration change after drug administration. Thus pharmacokinetic model plays a vital role in new drug development. Since our targeting-exosome is a brand new drug delivery system, we need to make a pharmacokinetic model to check if it can really target the specific site we want and predict the concentration change within that site.
 </div>
-<div id="instructions" style="text-align: center; font-weight: normal; font-size: small; color: #f6f6f6; padding: 5px;">
+					</section>
-You are provided with this team page template with which to start the iGEM season.  You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki.  You can find some examples <a href="https://2008.igem.org/Help:Template/Examples">HERE</a>.
+					<section class="st-panel st-color" id="st-panel-2">
+						<div class="st-deco" data-icon="2"></div>
+						<h2>Pharmacokinetic modeling</h2>
+<div class="pra">
+<!-- <img width="500px"; height="400px"; src="https://static.igem.org/mediawiki/2013/5/5d/293t_mv.jpg" style="margin-right:10px; float:left;"/> -->
+After drug administration, what happened within the body is quite complex and all the tissues are involved in the drug metabolism. In order to construct a pharmacokinetic model, we need to first make a few simplification of the body to make a pharmacokinetic model feasible.</br></br>
+Based on the multi-compartmental model, we divide the human body into central compartment (blood circulation) and peripheral compartment (body tissues). Since the exosome is administrated by intravenous injection, we assume that the concentration of exosome within the blood circulation reached its peak soon after injection and there is no variation within different parts of the blood circulation. Inspired by the pharmacokinetic model made by iGEM Slovenia 2012, we subdivide the peripheral compartment into liver (our target organ), kidney, lung, rapidly perfused tissues (such as skin, muscle) and slowly perfused tissues (such as spleen, heart). Each peripheral compartment has blood exchange with the central blood circulation, and during this process, certain percentage of exosome flow through a compartment will be absorbed. Apart from that, some of the exosome get into the kidney will be eliminated. Based on these simplifications, our multi-compartmental model is shown in the figure 1.</br>
+<img width="500px"; height="500px"; src="https://static.igem.org/mediawiki/2013/5/54/NJU-Moduling-2-1.png" style="margin-right:10px; float:left;"/>
 </div>
-<div id="warning" style="text-align: center; font-weight: bold; font-size: small; color: #f6f6f6; padding: 5px;">
+<>
-You <strong>MUST</strong>  have all of the pages listed in the menu below with the names specified.  PLEASE keep all of your pages within your teams namespace.
+					</section>
+					<section class="st-panel" id="st-panel-3">
+						<div class="st-deco" data-icon="3"></div>
+						<h2>Targeting module</h2>
+<div class="pra" ><!--style="overflow-y:scroll;"-->
+<img width="500px"; height="500px"; src="https://static.igem.org/mediawiki/2013/e/e7/Tra.png" style="margin-right:10px; float:right;"/ usemap="liver">
+<map name="liver">
+Specificity is one of the most vital goals that many different drug delivery system want to achieve, and that is also exactly what we are expecting from our biomissile.
+</br> </br>
+To achieve specificity, we need to make our exosomes able to recognize distinctive sites within the body. In order to do that, the first step we took towards our exosome is outside modification. We wanted to add a target protein onto the surface of the exosomes to endow it with specificity, therefore we need to first find a protein naturally expressed on the surface of the exosomes and then fuse our target protein to the membrane protein of exosomes.
+</br> </br>
+After a round of screen of the different membrane proteins on the exosomes’ surface, we chose to use lamp 2b to construct our fusion protein.
+</br> </br>
+Lamp 2b (lysosomal associated membrane protein 2b) is a protein ubiquitously expressed on the surface of the exosomes. By genetically engineering a target protein to the outmembrane part of the lamp 2b, we can use the lamp 2b to bring our target protein to the surface of the exosomes. Thus we can endow the exosome with site-specificity by the addition of the fusion protein.
+  </br> </br>
+As the target protein in the lamp 2b is an exchangeable part, we can use different target protein to direct our exosomes to different parts of human body.
+  </br> </br>
+Liver，T cells and especially brain are poor targeting sites for previous drug delivery system. In order to prove that our target module does work, we choose to target these sites for testing.
+</br>
+To see more about
+<a href="https://2013.igem.org/Team:NJU_China/Project/Brain" style="color:blue;" >Brain</a>
+,
+<a href="https://2013.igem.org/Team:NJU_China/Project/Liver" style="color:blue;">Liver</a>
+and
+<a href="https://2013.igem.org/Team:NJU_China/Project/T cell" style="color:blue;">T cell</a>
+targeting.
 </div>
+				</section>
+					<section class="st-panel st-color" id="st-panel-4">
+						<div class="st-deco" data-icon="4"></div>
+						<h2>Killing Module</h2>
+<div class="pra" style="overflow-y:scroll;" >
+Based on the utilization of natural exosome produced by HEK 293T cells and the modification of the surface protein, lamp-2b, now we have got a site-specific drug carrier, which can bring medicine to cells with a certain kind of receptors. In order to expand power of our system, we decide to pack the carrier with our disease-killing device, siRNA.</br></br>
+Recently, small interfering RNA (siRNA) is emerging as a promising therapeutic drug against a wide array of diseases. siRNA functions through the RNA interference pathway. Normal double-stranded RNA is first processed by Dicer and Argo to become short double-stranded RNA, which is about 21-25bp in length. Then it will recruit other proteins to form RISC( RNA induced silencing complex). One of the two RNA stands in the RISC will be degraded and the remaining strand can specifically recognize other mRNA by base pairing. Once the RISC bind to other complementary mRNA, it will destroy the mRNA through the RNAi pathway. By designing siRNA against certain virus genes, we can use siRNA as molecular medicine for diseases treatment. siRNAs are well tolerated and have suitable pharmacokinetic properties
+</br></br>
+This discovery encouraged us to harness siRNA as specific targeted drugs producing a therapeutic benefit in our system. Now, not only can we carry drugs into a specific site, but also the drug itself specifically turn off the disease-causing gene expression rather than destroy the whole cell or disrupt normal protein production in a healthy cell. </br></br>
+Design  </br>
+We carried out this experiment in the HBV testing model to verify that our big idea can work in real human disease.
+The first step in designing a siRNA for viral gene silencing is to choose the siRNA target sites.
+Firstly, we should find 21 nt sequences in the target mRNA from Hepatitis b virus (HBV) genome that begin with an AA dinucleotide. </br>
+And then, choose target sites from among the ‘AA sequences’ based on guidelines like ‘Target sequence should have a GC content of around 50%’; ‘Avoid stretches of 4 or more bases such as AAAA, CCCC; ’‘Avoid regions with GC content <30% or > 60%.’</br>
+We completed the first two steps in the software, siRNA Designer.</br>
+Finally, we performed BLAST homology search to avoid off-target effects on other genes or sequences</br></br>
+After screening the HBV genome using the methods mentioned above, we ultimately find three candidates as our anti-HBV siRNA</br>
+siRNA 308 TATGCCTCAAGGTCGGTCGTT   against HBx gene in HBV genome</br>
+siRNA 467 TCCCATAGGAATCTTGCGAAA   against HBsAG gene in HBV genome</br>
+siRNA 516 ACAAATGGCACTAGTAAACTG   against HBsAg gene in HBV genome</br>
+The number 308, 467 and 516 in the siRNA indicates their target sites within their target gene.</br></br>
+We cloned these three siRNAs into the vector pENTR/U6, which is a plasmid backbone for high yield of siRNA.</br>
+By cloning the siRNAs into eukaryotic expression vectors, large amounts of corresponding siRNAs can be produced by the cell, instead of chemically synthesizing the siRNAs.</br>
+In these vectors, we use an RNA polymerase Ⅲpromoter U6 to direct the transcription of siRNA， and an enhancer which greatly increases the gene transcription </br></br>
+Results</br>
+.siRNA screen</br>
+Since we have designed three types of siRNA target to different HBV genes, we need to determine which one would be optimal for HBV treatment. </br></br>
+To achieve this goal, we first tested their relative expression level in cells and exosomes. Expression of them was confirmed by quantitative PCR (qPCR) analysis of transfected HEK 293t cells and exosomes collected from the culture medium. The result suggested that 467 siRNA had much higher level of expression in both cells (Fig.1) and exosomes (36h post-transfection)(Fig.2). Since we need high yield of siRNA in the exosome, we decided to choose 467 as our ‘kill device’.</br></br>
+<img src="https://static.igem.org/mediawiki/2013/c/ca/Nju_Project-4-1.png"></br>
+Fig.1 :qPCR analysis of relative siRNA level in 293t cells. Result showed that 467 siRNA has a relatively higher level of expression than that of 308 siRNA and 516 siRNA. </br></br>
+<img src="https://static.igem.org/mediawiki/2013/0/0e/Priject-4-2.png"></br>
+Fig.2 :qPCR analysis of relative siRNA level in 293t cells. 24 hours after transfection, 516 has a relatively higher expression level in exosomes. However, after 36h’s transfection, 467 performed a significant increase in expression level, almost 100 times of that of 516 and 308. Therefore, together with the data from Fig.1, we eliminated 516 siRNA and 308 siRNA from our list.</br></br>
+.Silencing effect of siRNA 4667 towards HBsAG</br>
+We investigated the silencing effectiveness of siRNA 467 towards HBsAG to guarantee that it would work as we want. By qPCR analysis of HepG2 cell co-transfected with both siRNA 467 plasmid and HBsAg plasmid, we observed the significant down-regulation of HBsAg gene (Fig.3). This demonstrated that our siRNA 467 does function to silence the target gene, yet it could not prove that 467 siRNA would also work when it was encapsulated into our exosomes.</br></br>
+<img src="https://static.igem.org/mediawiki/2013/e/e0/NjuProject-4-3.png"></br>
+Fig. 3 :Silencing of HBsAg by siRNA 467. All groups were transfected by Lipo 2000. Control group was transfected with empty plasmid. siRNA-free group was transfected with HBsAg overexpression plasmid, and experimental group with both HBsAg overexpression plasmid and 467 siRNA plasmid. The result suggested that 467 siRNA successfully down-regulatethe HBsAg gene.</br></br>
+.Silencing effect of siRNA 467 towards HBsAg after encapsulated in exosome</br>
+After transfecting 293t cells with 467 siRNA plasmids, we collected exsomes and then co-cultured them with HepG2 cells which had been transfected with HBsAg over-expression plasmid. qPCR analysis confirmed that the down-regulation of HBsAg was significant(Fig.4), and thus proved that our 467 siRNA could work effectively in exosomes.</br></br>
+<img src="https://static.igem.org/mediawiki/2013/1/1d/NjuProject-4-4.png"></br>
+Fig.4:
+All groups were transfected by Lipo. The first group was transfected without any plasmid while other three groups were transfected with HBsAg over-expression plasmid. Second group cultured without exogenous exosomes. Third group co-cultured with empty exosomes, and fourth with exosomes containing siRNA 467. These two kinds of exosomes were collected from 293t cells transfected without and with 467 siRNA plasmid, respectively. Then every group was analyzed for their HBsAg gene expression level through qPCR. Since group 2 and group 3 showed a similar level of expression, either of which is significantly higher than group 1, the HBsAg gene did express in those cells. Yet group 4, which was co-cultured with 467 exosomes, showed a relatively lower HBsAg expression level. That may indicate that 467 contained in exosomes had down-regulated the target gene.</br></br>
+.Absolute quantification of siRNA 467 encapsulated into exosome</br>
+In order to better apply our exosomes in further experiment (mice experiment, for example), we needed to absolutely quantify the siRNA productivity in each μg of exosomes (whose quantity is measured base on protein concentration). By qPCR analysis of a series of siRNA with given concentration, we drew a standard curve (Fig.5). Then using this curve, we were able to determine the siRNA quantity within exosomes. Also, we tested the quantity of siRNA from both 24h post-transfection and 48h post-transfection in each experiment. The results showed that 24 hours after the transfection, the quantity of siRNA per 1μg exosome was 8*10-2 fmol in exosomes(Fig.6). However, after 48 hours, the number nearly doubled. It was 2*10-1 fmol(siRNA)/μg(exosome) in exosomes. The results helped us determine the dose of injection for mouse and establish the mathematical model.</br></br>
+<img width="554px" height="299px" src="https://static.igem.org/mediawiki/2013/6/6a/M3-Project-killing-_Fig5.png"></br>
+Fig.5 siRNA 467 Standard Curve drawn through a series siRNA with given concentration.</br></br>
+<img width="554px" height="299px" src="https://static.igem.org/mediawiki/2013/8/8e/M3-Project-killing-_Fig6.png"></br>
+Fig.6 Absolute quantification of siRNA 467 in exosomes, 24h and 48h post transfection, respectively.</br></br>
 </div>
-</html>
+					</section>
+					<section class="st-panel" id="st-panel-5">
+						<div class="st-deco" data-icon="5"></div>
+						<h2>Achievement</h2>
+<div class="pra" >Starting from March, our lab work continues for 7 months. During these 7 months, we first came up with the idea of ‘biomissile’ via brainstorming, then carefully designed every component of our biomissile. And the most difficult part was to experimentally prove that every part of the system can work properly. From the hard work of the past 7 months, we have successfully done the following:</br></br>
+We designed and created a new anti-HBV siRNA biobrick(BBa_K1180000), and experimentally validated that it can significantly suppress the HBV viral gene. Apart from that, after transfection of HEK 293T cells with this part, the siRNA can be successfully encapsulated into the exosmes produced by the cells.</br></br>
+We designed and constructed a liver-targeting fusion protein (BBa_K1180003) . After transfecting the HEK 293T cells with this plasmid, we monitored the exosomes with this fusion protein on its surface successfully get into the Hep G2 cell. </br></br>
+We designed and constructed a brain-targeting fusion protein(BBa_K1180002). After transfecting the HEK 293T cells with this plasmid, the exosomes produced by the HEK 293T cells can successfully bring the siRNA contained into the mouse brain.</br></br>
+Combining the targeting module and kill module together, firstly it can target specific sites, apart from that, the siRNA contained within the exosome can specifically destroy the disease related gene. Thus we realize the idea of boimissile by using our engineered exosome for target-destruction of disease. </div>
+					</section>
-<!-- *** End of the alert box *** -->
+				</div><!-- // st-scroll -->
+			</div><!-- // st-container -->
+        </div>
+<link href='http://fonts.googleapis.com/css?family=Source+Sans+Pro:400,600' rel='stylesheet' type='text/css'>
+<!--Start NavBar-->
+<ul id="nav">
+    <li><a href="https://2013.igem.org/Team:NJU_China">Home</a></li>
+    <li><a href="https://2013.igem.org/Team:NJU_China/Team">Team</a></li>
-{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+    <li><a href="https://2013.igem.org/Team:NJU_China/Project">Project</a></li>
-!align="center"|[[Team:NJU_China|Home]]
-!align="center"|[[Team:NJU_China/Team|Team]]
+    <li><a href="https://2013.igem.org/Team:NJU_China/Parts">Parts</a></li>
-!align="center"|[https://igem.org/Team.cgi?year=2013&team_name=NJU_China Official Team Profile]
-!align="center"|[[Team:NJU_China/Project|Project]]
-!align="center"|[[Team:NJU_China/Parts|Parts Submitted to the Registry]]
-!align="center"|[[Team:NJU_China/Modeling|Modeling]]
-!align="center"|[[Team:NJU_China/Notebook|Notebook]]
-!align="center"|[[Team:NJU_China/Safety|Safety]]
-!align="center"|[[Team:NJU_China/Attributions|Attributions]]
-|}
+    <li><a href="https://2013.igem.org/Team:NJU_China/Modeling">Modeling</a></li>
+    <li><a href="https://2013.igem.org/Team:NJU_China/Notebook">Notebook</a></li>
-If you choose to include a '''Modeling''' page, please write about your modeling adventures here.  This is not necessary but it may be a nice list to include.
+    <li><a href="https://2013.igem.org/Team:NJU_China/Safety">Safety</a></li>
+    <li><a href="https://2013.igem.org/Team:NJU_China/Attributions">Attributions</a></li>
+</ul>
+<!--End NavBar-->
+	</body>
+</html>