Revision as of 06:14, 25 September 2013

The Problem

CardBio: The Project

Death by heart diseases is very common worldwide, being Acute Coronary Syndrome (ACS) its main cause. This fact is deeply related to late diagnosis, which is usually made after the cardiac event had already occurred. We, from UFMG team, decided to explore this problem building a system capable of providing a precocious diagnosis for ACS based in 3 biomarkers: Brain Natriuretic Peptide (BNP), Trimethylamine-N-Oxide (TMAO) and Ischemia Modified Albumin (IMA). The main goal is to detect each of these biomarkers using our engineered E. coli by integrating the signals CFP, YFP and RFP produced when BNP, IMA and TMAO, respectively, are present in a sample of patient serum. This diagnosis is based on color intensity of the fluorescent proteins. So, we can establish the presence or absence and severity of ACS disease and predict earlier a myocardial event, thus providing information for fast treatment.

Our Design

After an extensive research on the biomarkers used for prognosis of Acute Coronary Syndrome (ACS), we elected three that we could work on to somehow make our bacteria detect: TMAO, IMA and BNP. Our bacteria was to work as a traffic light: it should make GFP constitutively (meaning “all green, no problem detected”), until something was detected. To do that, we decided to use the 454CI-regulated promoter (BBa_R0052) with the GFP translation unit (BBa_E0840). IMA, which means Ischemia Modified Albumin, was a tricky one. Our studies indicated that, although a good marker for ischemia, IMA could be better used for ACS prognostic as a negative predictor than a positive one. Because of that, we assigned YFP to its detection: its presence doesn’t really say much, it’s a warning, but its absence does means that everything is still green. We found out that a clinical test for IMA was available, based on the detection of cobalt added to a patient’s blood serum (the reason being that IMA binds less cobalt than normal human serum albumin); so, we decided to incorporate this method by using a cobalt-inducible promoter, Rcna (BBa_K540001) associated to the 454CI repressor translation unit (BBa_S0104) and the YFP translation unit (BBa_E0430). With this construction, if cobalt is added to a medium containing our chassis and a patient’s blood, and it remains unbinded due to the presence of IMA, it will activate the promoter, which will both repress the synthesis of GFP (through the 454CI protein) and lead to the production of YFP. TMAO is a biomarker that was recently linked to heart diseases, and one that our literature research showed that could activate an inducible bacterial promoter, part of the TorCAD operon. Since this promoter was not deposited in the Parts Registry, we ordered it to be synthesized, with modifications to its structure to enhance its activity [1]. The sequence of the promoter we ordered was:

5’ –

CGAACGAATTCGCGGCCGCTTCTAGAGATTCTGTTCATATCTGTTCATATTCCGTTCATCCT

GACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCATACTAGTAGCGGCCGCTGC

AG – 3’

We decided to assign RFP to this biomarker, and thus our construction for this became the TorCAD promoter we had synthesized, the 454CI repressor translation unit and the RFP translation unit (BBa_J06702). Our last target is BNP (Brain Natriuretic Peptide), a major prognostic biomarker for ACS. To detect it, we tried to synthesize a biobrick containing the coding region of NPRA, a receptor capable of detecting BNP and respond unleashing an intracellular cGMP cascade. And to detect the cGMP produced by the receptor, we also ordered the synthesis of another promoter, belonging to PDE5 (phosphodiesterase 5), which is positively regulated by this molecule. Putting it all together, the plan was to create a plasmid containing two constructions: 1) a constitutive promoter associated with the translation unit of NPRA, to make our bacteria detect BNP and respond producing cGMP, and 2) PDE5 promoter associated with the 454CI repressor and another fluorescent protein, like CFP, to make our bacteria produce a signal when the biomarker was detected. However, we were unable to proceed with the detection of BNP, due to the high content of CG pairs on both the NPRA receptor and PDE5 promoter, which rendered their synthesis impossible. Thus, with all of this constructions, we’d be able to create our traffic light, heart vigilant bacteria. References 1 - Ansaldi M, Simon G, Lepelletier M, Mejean V (2000). "The TorR high-affinity binding site plays a key role in both torR autoregulation and torCAD operon expression in Escherichia coli." J Bacteriol 2000;182(4);961-6. PMID: 10648521

Our Sponsors

@@ Line 6: / Line 6: @@
 =Our Design=
-After forming <ref name="Ref06">Reference text</ref> the Brazil_UFMG team, we were ready to think what would be our starting point. We were all interested in implementing a way to solve a relevant problem that was part of our daily life. Having this in mind, we had worked around many ideas, but all of them were related to how to diagnose diseases precociously. After several discussions, our target was chosen: we decided to create a mechanism that allows for a prognostic of Acute Coronary Syndrome (ACS), a set of symptoms attributed to the coronary arteries obstruction, a [[File:Ufmg_background.png|frame|Esse é o bacground]]cardiovascular disease directly associated to a large heart attack incidence that affects millions of people around the world every year (Searle et al., 2010). The ACS is characterized by the formation of atheroma in coronary artery. Pathologically, an atheroma is a swelling and an accumulation on the artery wall composed mainly by macrophages, organic residues derived from dead cells, lipids such as cholesterol and fat acids, calcium and variable quantity of fibrous conjunctive tissues, also known as coronary plaque (CP). The overflow of this structure in the artery lumen provoke its occlusion, causing a myocardium blood flow obstruction and, posteriorly, causing tissue falence (Danne et al., 2010). In USA, in 2004, approximately 200.000 people died by heart attack, and in 2009, about 1.190.000 patients were diagnosed with ACS (Heart Disease and Stroke Statistics--2012 Update : A Report From the American Heart Association). In Brazil, data is no less worrying. The number of hospitalization in 2010 arisen from Acute Myocardium Infarction (AMI) was near 80.000 and more than 90% of this cases evolved to death (Teich et al., 2011). It is observed in ACS that plaque formation and its development release several substances in the patient blood. Some of them have a big potential to be explored as possible biomarkers to ACS, which can be used in order to develop new mechanisms to perform a disease prognostic. The current methods have used troponin, a very abundant protein in the cardiac muscle tissue, correlating its concentration increase in blood and the patient clinical history - symptoms as angina and chest pain - to diagnose an AMI in patients, consequently the diagnose indicate ACS as well. Despite working as a very efficient biomarker to diagnose ACS, troponin’s concentration just increase considerably in a stage where CP overflow has already occurred. For this reason, affirming that “a biomarker that detect the CP instability and/or myocardium ischemia in patients with ACS, before the increasing of the troponin in the blood, have the potential to amplify considerably the clinical tools available” (Danne et al., 2010) is indubiously relevant. Given these information, Brazil_UFMG team chose to develop a Genetically Modified Organism (GMO) able to measure blood serum concentrations of specific molecules with potential to be ACS biomarkers, to be used as an efficient method of prognostic test. References: Danne, O. and M. Mockel (2010). "Choline in acute coronary syndrome: an emerging biomarker with implications for the integrated assessment of plaque vulnerability." Expert Rev Mol Diagn 10(2): 159-171. Heart Disease and Stroke Statistics--2012 Update : A Report From the American Heart Association. Searle, J., O. Danne, C. Muller and M. Mockel (2010). "Biomarkers in acute coronary syndrome and percutaneous coronary intervention." Minerva Cardioangiol. Vanessa Teich, Denizar Vianna Araujo. “Custo da Síndrome Coronariana Aguda.” Rev Bras Cardiol. 2011;24(2):85-94[[File:Ufmg_background.png|frameless|Esse é o bacground]]
+After an extensive research on the biomarkers used for prognosis of Acute Coronary Syndrome (ACS), we elected three that we could work on to somehow make our bacteria detect: TMAO, IMA and BNP. Our bacteria was to work as a traffic light: it should make GFP constitutively (meaning “all green, no problem detected”), until something was detected. To do that, we decided to use the 454CI-regulated promoter (BBa_R0052) with the GFP translation unit (BBa_E0840). IMA, which means Ischemia Modified Albumin, was a tricky one. Our studies indicated that, although a good marker for ischemia, IMA could be better used for ACS prognostic as a negative predictor than a positive one. Because of that, we assigned YFP to its detection: its presence doesn’t really say much, it’s a warning, but its absence does means that everything is still green. We found out that a clinical test for IMA was available, based on the detection of cobalt added to a patient’s blood serum (the reason being that IMA binds less cobalt than normal human serum albumin); so, we decided to incorporate this method by using a cobalt-inducible promoter, Rcna (BBa_K540001) associated to the 454CI repressor translation unit (BBa_S0104) and the YFP translation unit (BBa_E0430). With this construction, if cobalt is added to a medium containing our chassis and a patient’s blood, and it remains unbinded due to the presence of IMA, it will activate the promoter, which will both repress the synthesis of GFP (through the 454CI protein) and lead to the production of YFP. TMAO is a biomarker that was recently linked to heart diseases, and one that our literature research showed that could activate an inducible bacterial promoter, part of the TorCAD operon. Since this promoter was not deposited in the Parts Registry, we ordered it to be synthesized, with modifications to its structure to enhance its activity [1]. The sequence of the promoter we ordered was:
-This is page content.<ref>LibreOffice For Starters, First Edition, Flexible Minds, Manchester, 2002, p. 18</ref>
-{{reflist}}
-==Sindorme==
-<ref name="name">text of the citation</ref>
-==References==
+’ –
-<references/>
+CGAACGAATTCGCGGCCGCTTCTAGAGATTCTGTTCATATCTGTTCATATTCCGTTCATCCT
+GACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCATACTAGTAGCGGCCGCTGC
+AG – 3’
+We decided to assign RFP to this biomarker, and thus our construction for this became the TorCAD promoter we had synthesized, the 454CI repressor translation unit and the RFP translation unit (BBa_J06702). Our last target is BNP (Brain Natriuretic Peptide), a major prognostic biomarker for ACS. To detect it, we tried to synthesize a biobrick containing the coding region of NPRA, a receptor capable of detecting BNP and respond unleashing an intracellular cGMP cascade. And to detect the cGMP produced by the receptor, we also ordered the synthesis of another promoter, belonging to PDE5 (phosphodiesterase 5), which is positively regulated by this molecule. Putting it all together, the plan was to create a plasmid containing two constructions: 1) a constitutive promoter associated with the translation unit of NPRA, to make our bacteria detect BNP and respond producing cGMP, and 2) PDE5 promoter associated with the 454CI repressor and another fluorescent protein, like CFP, to make our bacteria produce a signal when the biomarker was detected. However, we were unable to proceed with the detection of BNP, due to the high content of CG pairs on both the NPRA receptor and PDE5 promoter, which rendered their synthesis impossible. Thus, with all of this constructions, we’d be able to create our traffic light, heart vigilant bacteria.
+References 1 - Ansaldi M, Simon G, Lepelletier M, Mejean V (2000). "The TorR high-affinity binding site plays a key role in both torR autoregulation and torCAD operon expression in Escherichia coli." J Bacteriol 2000;182(4);961-6. PMID: 10648521
 {{Team:UFMG Brazil/sponsor}}

Team:UFMG Brazil/Cardbio

From 2013.igem.org

Revision as of 06:14, 25 September 2013

The Problem

CardBio: The Project

Our Design