Team:Freiburg/Project/toolkit
From 2013.igem.org
(Difference between revisions)
Lisaschmunk (Talk | contribs) |
|||
(26 intermediate revisions not shown) | |||
Line 158: | Line 158: | ||
#answer_third_checkboxes { | #answer_third_checkboxes { | ||
- | + | color:black; !important; | |
- | color:black; | + | font-color:black; !important; |
} | } | ||
#main_contant { | #main_contant { | ||
- | color: black; | + | margin-top:-100px; |
+ | color: black; !important; | ||
+ | font-color:black; !important; | ||
} | } | ||
Line 170: | Line 172: | ||
} | } | ||
+ | html {color: #black !important;} | ||
} | } | ||
Line 621: | Line 624: | ||
<p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/1"> Abstract & Intro </a></p> | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/1"> Abstract & Intro </a></p> | ||
+ | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/crrna"> Targeting </a></p> | ||
<p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/effector"> Effectors </a></p> | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/effector"> Effectors </a></p> | ||
<p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/induction"> Effector Control </a> </p> | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/induction"> Effector Control </a> </p> | ||
- | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/ | + | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/modeling"> Modeling </a></p> |
+ | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/truncation"> Truncation </a></p> | ||
<p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/method"> uniBAss </a></p> | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/method"> uniBAss </a></p> | ||
+ | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/unibox"> uniBOX </a></p> | ||
<p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/toolkit" class="active"> Manual </a></p> | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/toolkit" class="active"> Manual </a></p> | ||
- | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/ | + | <p class="first_order"><a href="https://2013.igem.org/Team:Freiburg/Project/application" > Application </a></p> |
</div> | </div> | ||
Line 654: | Line 660: | ||
</ul> | </ul> | ||
- | By the end of the routine you will get a personal manual. All you need to | + | By the end of the routine you will get a personal manual. All you need to do is using the uniCAS toolkit and follow the instructions. Best of all: The uniCAS toolkit is all open source and in iGEM standard! |
+ | <br> | ||
- | + | <!-- | |
+ | <p><b>Finally ... does everybody know what time it is? It's tooltime!</b></p> | ||
+ | Also have a look at Sigma Aldrich to order your oligos coding for the crRNAs: <br> | ||
+ | <br> | ||
+ | <a href="http://www.sigmaaldrich.com/germany.html"> <img src="https://static.igem.org/mediawiki/2013/0/01/SA_Logo_freiburg.jpg" width="300px"> </a> | ||
+ | --> | ||
</div> | </div> | ||
Line 671: | Line 683: | ||
<div id="check-1" class="toHide" style="display:none"> | <div id="check-1" class="toHide" style="display:none"> | ||
<img src="https://static.igem.org/mediawiki/2013/6/6e/Activation.png"> | <img src="https://static.igem.org/mediawiki/2013/6/6e/Activation.png"> | ||
- | <p> Choose an effector to activate your genes. Click <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/effector#activation"> here </a> to see the functional tests of the different activation effectors. </p> | + | <p> Choose an effector to activate your genes. Click <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/effector#activation"> here</a> to see the functional tests of the different activation effectors. </p> |
<label><input id="rdb4" type="radio" name="toggler_two" value="3" onClick="pageScroll()"/>VP16 (recommended) </label> | <label><input id="rdb4" type="radio" name="toggler_two" value="3" onClick="pageScroll()"/>VP16 (recommended) </label> | ||
<!-- <label><input id="rdb5" type="radio" name="toggler_two" value="4" onClick="pageScroll()"/> ?????? </label> --> | <!-- <label><input id="rdb5" type="radio" name="toggler_two" value="4" onClick="pageScroll()"/> ?????? </label> --> | ||
Line 678: | Line 690: | ||
<div id="check-2" class="toHide" style="display:none"> | <div id="check-2" class="toHide" style="display:none"> | ||
<img src="https://static.igem.org/mediawiki/2013/d/da/Repression.png"> | <img src="https://static.igem.org/mediawiki/2013/d/da/Repression.png"> | ||
- | <p> Effectively repress your genes using KRAB or | + | <p> Effectively repress your genes using KRAB or G9a as functional effector. <br> Click <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/effector#repression"> here</a> to see the functional tests of the different activation effectors. </p> |
<div> | <div> | ||
<label><input id="rdb4" type="radio" name="toggler_two" value="5" onClick="pageScroll()"/>KRAB </label> | <label><input id="rdb4" type="radio" name="toggler_two" value="5" onClick="pageScroll()"/>KRAB </label> | ||
- | <label><input id="rdb5" type="radio" name="toggler_two" value="6" onClick="pageScroll()"/> | + | <label><input id="rdb5" type="radio" name="toggler_two" value="6" onClick="pageScroll()"/> G9a </label> |
</div> | </div> | ||
</div> | </div> | ||
Line 756: | Line 768: | ||
<p id="h1"> | <p id="h1"> | ||
- | Non inducible uniCAS Activator ( | + | Non inducible uniCAS Activator (dCas9-VP16 device) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to activate a gene using a non inducible | + | You have chosen to activate a gene using a non inducible dCas9-VP16 device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 774: | Line 786: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150017 </td> | <td> BBa_K1150017 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 781: | Line 793: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150020 </td> | <td> BBa_K1150020 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-VP16-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 788: | Line 800: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid) </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 799: | Line 811: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T. |
</p> | </p> | ||
Line 821: | Line 833: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH<sub>2</sub>O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH<sub>2</sub>O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH<sub>2</sub>O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH<sub>2</sub>O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 841: | Line 853: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 855: | Line 867: | ||
<ol> | <ol> | ||
<li> <b>Transfect</b> BBa_K1150020 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150020 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
- | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid | + | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid together with BBa_K1150017 that has no effector.</li> |
<li> <b>Off target control:</b> Transfect BBa_K1150020 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150020 without any crRNA plasmid.</li> | ||
Line 861: | Line 873: | ||
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/7/7c/1_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 889: | Line 901: | ||
<p id="h1"> | <p id="h1"> | ||
- | Red light inducible uniCAS Activator ( | + | Red light inducible uniCAS Activator (dCas9-PIF6 & PhyB-VP16 devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to activate a gene using a red light inducible | + | You have chosen to activate a gene using a red light inducible dCas9-PIF6 & PhyB-VP16 device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 907: | Line 919: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150025 </td> | <td> BBa_K1150025 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-PIF6-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 914: | Line 926: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150026 </td> | <td> BBa_K1150026 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-PhyB-L3-VP16-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150026"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150026"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 921: | Line 933: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150020 </td> | <td> BBa_K1150020 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-VP16-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 928: | Line 940: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 940: | Line 952: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 963: | Line 975: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 983: | Line 995: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,002: | Line 1,014: | ||
<li> <b>Transfect</b> BBa_K1150025, BBa_K1150026 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150025, BBa_K1150026 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
<li> <b>Off target control:</b> Transfect BBa_K1150025, BBa_K1150026 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150025, BBa_K1150026 without any crRNA plasmid.</li> | ||
- | <li> <b>Target efficiency control:</b> Transfect BBa_K1150020 with the same crRNA | + | <li> <b>Target efficiency control:</b> Transfect BBa_K1150020 with the same crRNA plasmids as in the first transfection.</li> |
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/2/2b/2_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,046: | Line 1,058: | ||
<p id="h1"> | <p id="h1"> | ||
- | UVB light inducible uniCAS Activator ( | + | UVB light inducible uniCAS Activator (dCas9-UVR8 & COP1-VP16 devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to activate a gene using a UVB light inducible | + | You have chosen to activate a gene using a UVB light inducible dCas9-UVR8 & COP1-VP16 device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 1,064: | Line 1,076: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150029 </td> | <td> BBa_K1150029 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-UVR8-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,071: | Line 1,083: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150030 </td> | <td> BBa_K1150030 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-COP1-L3-VP16-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150030"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150030"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,078: | Line 1,090: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150020 </td> | <td> BBa_K1150020 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-VP16-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150020"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,085: | Line 1,097: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,097: | Line 1,109: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 1,120: | Line 1,132: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 1,140: | Line 1,152: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,153: | Line 1,165: | ||
<p> | <p> | ||
- | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. | + | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm at 5 µE for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. |
</p> | </p> | ||
Line 1,159: | Line 1,171: | ||
<li> <b>Transfect</b> BBa_K1150029, BBa_K1150030 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150029, BBa_K1150030 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
<li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150030 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150030 without any crRNA plasmid.</li> | ||
- | <li> <b>Target efficiency control:</b> Transfect BBa_K1150020 with the same crRNA | + | <li> <b>Target efficiency control:</b> Transfect BBa_K1150020 with the same crRNA plasmids as in the first transfection.</li> |
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/d/dd/3_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,210: | Line 1,222: | ||
<p id="h1"> | <p id="h1"> | ||
- | Non inducible uniCAS Repressor ( | + | Non inducible uniCAS Repressor (dCas9-KRAB device) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a non inducible | + | You have chosen to repress a gene using a non inducible dCas9-KRAB device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 1,228: | Line 1,240: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150017 </td> | <td> BBa_K1150017 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,235: | Line 1,247: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150022 </td> | <td> BBa_K1150022 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-KRAB-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,242: | Line 1,254: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,253: | Line 1,265: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 1,276: | Line 1,288: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 1,296: | Line 1,308: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,310: | Line 1,322: | ||
<ol> | <ol> | ||
<li> <b>Transfect</b> BBa_K1150022 (4 fold excess) with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150022 (4 fold excess) with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
- | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid | + | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid together with BBa_K1150017 that has no effector.</li> |
<li> <b>Off target control:</b> Transfect BBa_K1150022 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150022 without any crRNA plasmid.</li> | ||
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/d/dc/4_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,342: | Line 1,354: | ||
<p id="h1"> | <p id="h1"> | ||
- | Red light inducible uniCAS Repressor ( | + | Red light inducible uniCAS Repressor (dCas9-PIF6 & PhyB-KRAB devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a non inducible | + | You have chosen to repress a gene using a non inducible dCas9-KRAB device. Therefore you have to order the |
- | following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry </a>. After receiving our | + | following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our |
plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). | plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). | ||
Line 1,364: | Line 1,376: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150025 </td> | <td> BBa_K1150025 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-PIF6-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> | ||
Line 1,373: | Line 1,385: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150027 </td> | <td> BBa_K1150027 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-PhyB-L3-KRAB-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150027"> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150027"> | ||
Line 1,382: | Line 1,394: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150022 </td> | <td> BBa_K1150022 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-KRAB-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> | ||
Line 1,391: | Line 1,403: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> | ||
Line 1,407: | Line 1,419: | ||
All plasmids are optimized for expression in mammalian systems. The devices are also available containing | All plasmids are optimized for expression in mammalian systems. The devices are also available containing | ||
- | a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> | + | a SV40 instead of a CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> |
side). This system was tested mainly in CHO-K1 and HEK-293T cells. | side). This system was tested mainly in CHO-K1 and HEK-293T cells. | ||
Line 1,436: | Line 1,448: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore |
mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. | mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. | ||
Line 1,445: | Line 1,457: | ||
stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with | stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with | ||
- | ddH2O. Digest for | + | ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use |
DNA for the next step.</li> | DNA for the next step.</li> | ||
Line 1,452: | Line 1,464: | ||
into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x | into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x | ||
- | length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length |
of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of | of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of | ||
- | Backbone and the appropriate amount of Insert with 1 µl of T4 | + | Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with |
- | ddH2O. This mix should | + | ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the | ||
Line 1,484: | Line 1,496: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes |
cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it | cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it | ||
- | is possible to assemble multiple crRNA sequences | + | is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl |
- | + | enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. | |
</li> | </li> | ||
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" |
href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see | href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see | ||
above).</li> | above).</li> | ||
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify |
the gel slice and use DNA for the next step.</li> | the gel slice and use DNA for the next step.</li> | ||
Line 1,540: | Line 1,552: | ||
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/0/08/5_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,575: | Line 1,587: | ||
<p id="h1"> | <p id="h1"> | ||
- | UVB light inducible uniCAS Repressor ( | + | UVB light inducible uniCAS Repressor (dCas9-UVR8 & COP1-KRAB devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a UVB light inducible | + | You have chosen to repress a gene using a UVB light inducible dCas9-UVR8 & COP1-KRAB device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 1,593: | Line 1,605: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150029 </td> | <td> BBa_K1150029 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-UVR8-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,600: | Line 1,612: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150031 </td> | <td> BBa_K1150031 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-COP1-L3-KRAB-NLS:BGH </td> |
- | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part= | + | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150031"> order </a> </td> |
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
</tr> | </tr> | ||
Line 1,607: | Line 1,619: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150022 </td> | <td> BBa_K1150022 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-KRAB-NLS:BGH </td> |
- | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part= | + | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> order </a> </td> |
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
</tr> | </tr> | ||
Line 1,614: | Line 1,626: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,626: | Line 1,638: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 1,649: | Line 1,661: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 1,669: | Line 1,681: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,682: | Line 1,694: | ||
<p> | <p> | ||
- | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. | + | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm at 5 µE for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. |
</p> | </p> | ||
Line 1,688: | Line 1,700: | ||
<li> <b>Transfect</b> BBa_K1150029, BBa_K1150031 (4 fold excess) with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150029, BBa_K1150031 (4 fold excess) with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
<li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150031 (4 fold excess)without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150031 (4 fold excess)without any crRNA plasmid.</li> | ||
- | <li> <b>Target efficiency control:</b> Transfect BBa_K1150022 (4 fold excess) with the same crRNA | + | <li> <b>Target efficiency control:</b> Transfect BBa_K1150022 (4 fold excess) with the same crRNA plasmids as in the first transfection.</li> |
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/6/6d/6_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,717: | Line 1,729: | ||
<p id="h1"> | <p id="h1"> | ||
- | Non inducible uniCAS Histone | + | Non inducible uniCAS Histone modifier for Repression (dCas9-G9a device) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a non inducible | + | You have chosen to repress a gene using a non inducible dCas9-G9a device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 1,735: | Line 1,747: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150017 </td> | <td> BBa_K1150017 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150017"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,742: | Line 1,754: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150024 </td> | <td> BBa_K1150024 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-G9a-NLS:BGH </td> |
- | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part= | + | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150024"> order </a> </td> |
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
</tr> | </tr> | ||
Line 1,749: | Line 1,761: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,760: | Line 1,772: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 1,783: | Line 1,795: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 1,803: | Line 1,815: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,817: | Line 1,829: | ||
<ol> | <ol> | ||
<li> <b>Transfect</b> BBa_K1150024 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150024 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
- | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid | + | <li> <b>Non-effector control:</b> Transfect the appropriate crRNA - plasmid together with BBa_K1150017 that has no effector.</li> |
<li> <b>Off target control:</b> Transfect BBa_K1150024 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150024 without any crRNA plasmid.</li> | ||
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/1/1a/7_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,848: | Line 1,860: | ||
<p id="h1"> | <p id="h1"> | ||
- | Red light inducible uniCAS Histone | + | Red light inducible uniCAS Histone modifier for Repression (dCas9-PIF6 & PhyB-G9a devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a non inducible | + | You have chosen to repress a gene using a non inducible dCas9-KRAB device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry</a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 1,866: | Line 1,878: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150025 </td> | <td> BBa_K1150025 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-PIF6-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150025"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,873: | Line 1,885: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150028 </td> | <td> BBa_K1150028 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-PhyB-L3-G9a-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150028"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150028"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,880: | Line 1,892: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150024 </td> | <td> BBa_K1150024 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-G9a-NLS:BGH </td> |
- | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part= | + | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150024"> order </a> </td> |
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
</tr> | </tr> | ||
Line 1,887: | Line 1,899: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 1,899: | Line 1,911: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 1,922: | Line 1,934: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 1,942: | Line 1,954: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands out (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> | + | <li> Load digests on a gel and cut out the DNA bands out (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 1,961: | Line 1,973: | ||
<li> <b>Transfect</b> BBa_K1150025, BBa_K1150028 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150025, BBa_K1150028 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
<li> <b>Off target control:</b> Transfect BBa_K1150025, BBa_K1150028 without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150025, BBa_K1150028 without any crRNA plasmid.</li> | ||
- | <li> <b>Target efficiency control:</b> Transfect BBa_K1150024 with the same crRNA | + | <li> <b>Target efficiency control:</b> Transfect BBa_K1150024 with the same crRNA plasmids as in the first transfection.</li> |
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/3/3f/8_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> | ||
Line 1,994: | Line 2,006: | ||
<p id="h1"> | <p id="h1"> | ||
- | UVB light inducible uniCAS Histone | + | UVB light inducible uniCAS Histone modifier for Repression (dCas9-UVR8 & COP1-G9a devices) |
</p> | </p> | ||
<p> | <p> | ||
- | You have chosen to repress a gene using a UVB light inducible | + | You have chosen to repress a gene using a UVB light inducible dCas9-UVR8 & COP1-G9a device. Therefore you have to order the following plasmids from the <a id="link" href="http://parts.igem.org/Main_Page"> iGEM parts registry </a>. After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below). |
</p> | </p> | ||
Line 2,012: | Line 2,024: | ||
<td> 1 </td> | <td> 1 </td> | ||
<td> BBa_K1150029 </td> | <td> BBa_K1150029 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-UVR8-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150029"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td> | <!--<td> <a id="link" href=""> genebank </a> </td> | ||
Line 2,019: | Line 2,031: | ||
<td> 2 </td> | <td> 2 </td> | ||
<td> BBa_K1150031 </td> | <td> BBa_K1150031 </td> | ||
- | <td> CMV | + | <td> CMV:NLS-COP1-L3-G9a-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150031"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150031"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 2,026: | Line 2,038: | ||
<td> 3 </td> | <td> 3 </td> | ||
<td> BBa_K1150022 </td> | <td> BBa_K1150022 </td> | ||
- | <td> CMV | + | <td> CMV:HA-NLS-dCas9-L3-G9a-NLS:BGH </td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150022"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 2,033: | Line 2,045: | ||
<td> 4 </td> | <td> 4 </td> | ||
<td> BBa_K1150034 </td> | <td> BBa_K1150034 </td> | ||
- | <td> crRNA - plasmid </td> | + | <td> RNAimer - plasmid (crRNA - plasmid)</td> |
<td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | <td> <a id="link" href="http://parts.igem.org/partsdb/get_part.cgi?part=BBa_K1150034"> order </a> </td> | ||
<!--<td> <a id="link" href=""> genebank </a> </td>--> | <!--<td> <a id="link" href=""> genebank </a> </td>--> | ||
Line 2,045: | Line 2,057: | ||
<p> | <p> | ||
Note: <br> | Note: <br> | ||
- | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts </a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. | + | All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our <a id="link" href="https://2013.igem.org/Team:Freiburg/parts"> parts</a> side). This system was tested mainly in CHO-K1 and HEK-293T cells. |
</p> | </p> | ||
Line 2,068: | Line 2,080: | ||
<ol> | <ol> | ||
- | <li> <b>Oligo annealing:</b> Anneal forward and reverse | + | <li> <b>Oligo annealing:</b> Anneal forward and reverse oligos to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.</li> |
- | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for | + | <li> <b>Digest plasmid BBa_K1150034 with Bbs1:</b> The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exactly 3 hours at 37° C. Load the digest on a gel and cut out the DNA band (2900 bp). Purify the gel slice and use DNA for the next step.</li> |
- | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng | + | <li> <b>Ligate crRNAs (step 1) into Bbs1 cut backbone:</b> The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng of backbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should be incubated for 30 minutes at room temperature.</li> |
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
</ol> | </ol> | ||
Line 2,088: | Line 2,100: | ||
<ol> | <ol> | ||
- | <li> <b> | + | <li> <b>First of all digest crRNA plasmid</b> with PstI and SpeI in order to linearize it. Both enzymes cut in the suffix. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, it is possible to assemble multiple crRNA sequences into one plasmid. Therefore mix about 500 ng Backbone with 1 µl enzyme 1 and 1 µl enzyme 2, add an appropriate amount of compatible buffer and fill up to 30-50 µl. Incubate mix at 37° C for 2 hours. </li> |
- | <li> <b> | + | <li> <b>Secondly digest crRNA plasmid</b> with PstI and XbaI. Using the <a id="link" href="http://parts.igem.org/Help:Assembly/3A_Assembly">BioBrick Assembly method</a>, this is your insert (procedure see above).</li> |
- | <li> Load digests on a gel and cut the DNA bands | + | <li> Load digests on a gel and cut out the DNA bands (Backbone 2900 bp, Insert 870 bp). Purify the gel slice and use DNA for the next step.</li> |
<li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | <li> <b>Ligate</b> the insert in 3 molar excess into the backbone (formular see paragraph above).</li> | ||
<li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | <li> <b>Transform</b> 3-5 µl of the mix following <a id="link" href="https://2013.igem.org/Team:Freiburg/protocols#Transformation">standard protocol</a>. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).</li> | ||
Line 2,101: | Line 2,113: | ||
<p> | <p> | ||
- | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. | + | For UVB light experiments transfect the following plasmid combinations on two different well plates. One plate will be illuminated with 311 nm at 5 µE for 24 hours. This is the UVB light induced plate. The other plate will be wrapped in aluminum foil. This is the no-induction control. See our <a id="link" href="https://2013.igem.org/Team:Freiburg/Project/induction#light">light induction project page</a>. |
</p> | </p> | ||
Line 2,107: | Line 2,119: | ||
<li> <b>Transfect</b> BBa_K1150029, BBa_K1150032 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | <li> <b>Transfect</b> BBa_K1150029, BBa_K1150032 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid) </li> | ||
<li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150032 (4 fold excess)without any crRNA plasmid.</li> | <li> <b>Off target control:</b> Transfect BBa_K1150029, BBa_K1150032 (4 fold excess)without any crRNA plasmid.</li> | ||
- | <li> <b>Target efficiency control:</b> Transfect BBa_K1150024 with the same crRNA | + | <li> <b>Target efficiency control:</b> Transfect BBa_K1150024 with the same crRNA plasmids as in the first transfection.</li> |
</ol> | </ol> | ||
- | + | <a href="https://static.igem.org/mediawiki/2013/3/32/9_manual_pdf_freiburg.pdf"> <img src="https://static.igem.org/mediawiki/2013/9/9d/Printknopf_freiburg_13.png" width="100px" border="0" style="margin-left:350px; margin-top: 50px;" alt=""> </a> | |
</div> | </div> |
Latest revision as of 00:59, 29 October 2013
The uniCAS toolkit - Customize your experiments!
You want to have a maximum of activation or repression of your genes by a minimal effort? Then you
have to use the uniCAS toolkit provided by the iGEM team Freiburg 2013. All you have to do is:
- Click yourself through the routine below
- Order the appropriate plasmids and oligos
- Conduct a minimal of cloning
- Start your personalized experiment