Team:INSA Toulouse/contenu/lab practice/parts/other parts

From 2013.igem.org

(Difference between revisions)
Line 63: Line 63:
     .tablecontent td{padding:0 25px 0 20px;}  
     .tablecontent td{padding:0 25px 0 20px;}  
-
.h2.faq {
+
  .h2.faq {
display:list-item;  
display:list-item;  
         list-style-image : url(https://static.igem.org/mediawiki/2013/8/84/Insa-toulouse2013-listpuce1.png);
         list-style-image : url(https://static.igem.org/mediawiki/2013/8/84/Insa-toulouse2013-listpuce1.png);
width:auto;
width:auto;
-
height:27px;
 
line-height:24px;
line-height:24px;
background: no-repeat;
background: no-repeat;
Line 79: Line 78:
}
}
-
.infos {width:680px; margin:0 15px 50px 0; font-family:'Open Sans'; font-size:14px;}
+
    .infos {width:680px; margin:0 15px 50px 0; color:#5a6060; font-family:'Open Sans'; font-size:14px; line-height:24px; }

Revision as of 19:33, 3 October 2013

logo


Parts

Other Parts not Submitted

For two of our recombinases, we asked Piro Siuti (for PhiC31) and Jérome Bonnet (for Tp901.1) to send us their samples. Information on the parts they sent is available here.

PhiC31

PhiC31 is preceded by a riboregulator whose detailed function is described here.

Description

Isolated from the bacteriophage PhiC31, the PhiC31 integrase (frequently also written as: ΦC31 integrase) encodes a serine-type recombinase that mediates the sequence-specific recombination between two different attachment sites, called attB and attP, which share a 3 bp central region, where the crossover occurs (Thorpe et al., 2000). Because the two sites recognized by the PhiC31 integrase differ and the recombination event leads to two different sites (attR and attL), PhiC31 based switch is unidirectional and definitive, except if the required excisionase factor is present. Recombination occurs irrespective of whether the substrate is supercoiled or linear, and does not require anything more than the integrase and attB, attP sites . (HELENA M. THORPE AND MARGARET C. M. SMITH, In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvaseyinvertase family, 1998).

The recombination sites can be designed differently (position – orientation) in order to obtain a DNA 180° inversion or an integration of the desired DNA sequence. The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.

Open reading frame : 1842 bp

atgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacgaccgtcagtcgcg cgagcgcgagaattcgagcgcagcaagcccagcgacacagcgtagcgccaacgaagacaa ggcggccgaccttcagcgcgaagtcgagcgcgacgggggccggttcaggttcgtcgggcatt tcagcgaagcgccgggcacgtcggcgttcgggacggcggagcgcccggagttcgaacgcat cctgaacgaatgccgcgccgggcggctcaacatgatcattgtctatgacgtgtcgcgcttctcgc gcctgaaggtcatggacgcgattccgattgtctcggaattgctcgccctgggcgtgacgattgttt ccactcaggaaggcgtcttccggcagggaaacgtcatggacctgattcacctgattatgcggct cgacgcgtcgcacaaagaatcttcgctgaagtcggcgaagattctcgacacgaagaaccttcag cgcgaattgggcgggtacgtcggcgggaaggcgccttacggcttcgagcttgtttcggagacg aaggagatcacgcgcaacggccgaatggtcaatgtcgtcatcaacaagcttgcgcactcgacca ctccccttaccggacccttcgagttcgagcccgacgtaatccggtggtggtggcgtgagatcaag acgcacaaacaccttcccttcaagccgggcagtcaagccgccattcacccgggcagcatcacggg gctttgtaagcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagac cgcttcaagcgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggc ttcgccgctgaggtgatctacaagaagaagccggacggcacgccgaccacgaagattgagggtt accgcattcagcgcgacccgatcacgctccggccggtcgagcttgattgcggaccgatcatcgagc ccgctgagtggtatgagcttcaggcgtggttggacggcagggggcgcggcaaggggctttccc gggggcaagccattctgtccgccatggacaagctgtactgcgagtgtggcgccgtcatgacttcg aagcgcggggaagaatcgatcaaggactcttaccgctgccgtcgccggaaggtggtcgacccgt ccgcacctgggcagcacgaaggcacgtgcaacgtcagcatggcggcactcgacaagttcgttgc ggaacgcatcttcaacaagatcaggcacgccgaaggcgacgaagagacgttggcgcttctgtgg gaagccgcccgacgcttcggcaagctcactgaggcgcctgagaagagcggcgaacgggcgaa ccttgttgcggagcgcgccgacgccctgaacgcccttgaagagctgtacgaagaccgcgcggca ggcgcgtacgacggacccgttggcaggaagcacttccggaagcaacaggcagcgctgacgctcc ggcagcaaggggcggaagagcggcttgccgaacttgaagccgccgaagccccgaagcttcccct tgaccaatggttccccgaagacgccgacgctgacccgaccggccctaagtcgtggtgggggcgc gcgtcagtagacgacaagcgcgtgttcgtcgggctcttcgtagacaagatcgttgtcacgaagtcg actacgggcagggggcagggaacgcccatcgagaagcgcgcttcgatcacgtgggcgaagccg ccgaccgacgacgacgaagacgacgcccaggacggcacggaagacgtagcggcgtag

Tp901.1

The construction containing Tp901.1 is available on GenBank there , accession number KC529324.

Description

The site-specific recombination system of temperate lactococcal bacteriophage TP901-1 integrase mediates site-specific recombination system. Originally from temperate lactoccocal bacteriophage TP901-1, this is a serine-type integrase able to invert, integrate or excise a DNA fragment according to the position and orientation of its specific recognition sites, attB and attP. This process is directional and definitive because of the transformation of attB and attP into attL and attR during recombination.

The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.

Open Reading Frame : 1527 bp

atgaaac atcatcacca tcaccaccag gccggcacta agaaagtagc aatctataca cgagtatcca ctactaacca agcagaggaa ggcttctcaa ttgatgagca aattgaccgt ttaacaaaat atgctgaagc aatggggtgg caagtatctg atacttatac tgatgctggt ttttcagggg ccaaacttga acgcccagca atgcaaagat taatcaacga tatcgagaat aaagcttttg atacagttct tgtatataag ctagaccgcc tttcacgtag tgtaagagat actctttatc ttgttaagga tgtgttcaca aaaaataaaa tagactttat ctcgcttaat gaaagtattg atacttcttc tgctatgggt agcttgtttc tcactattct ttctgcaatt aatgagtttg aaagagagaa tataaaagaa cgcatgacta tgggtaaact agggcgagcg aaatctggta agtctatgat gtggactaag acagcttttg ggtattacca caacagaaag acaggtatat tagaaattgt tcctttacaa gctacaatag ttgaacaaat attcactgat tatttatcag gaatatcact tacaaaatta agagataaac tcaatgaatc tggacacatc ggtaaagata taccgtggtc ttatcgtacc ctaagacaaa cacttgataa tccagtttac tgtggttata tcaaatttaa ggacagccta tttgaaggta tgcacaaacc aattatccct tatgagactt atttaaaagt tcaaaaagag ctagaagaaa gacaacagca gacttatgaa agaaataaca accctagacc tttccaagct aaatatatgc tgtcagggat ggcaaggtgc ggttactgtg gagcaccttt aaaaattgtt cttggccaca aaagaaaaga tggaagccgc actatgaaat atcactgtgc aaatagattt cctcgaaaaa caaaaggaat tacagtatat aatgacaata aaaagtgtga ttcaggaact tatgatttaa gtaatttaga aaatactgtt attgacaacc tgattggatt tcaagaaaat aatgactcct tattgaaaat tatcaatggc aacaaccaac ctattcttga tacttcgtca tttaaaaagc aaatttcaca gatcgataaa aaaatacaaa agaactctga tttgtaccta aatgatttta tcactatgga tgagttgaaa gatcgtactg attcccttca ggctgagaaa aagctgctta aagctaagat tagcgaaaat aaatttaatg actctactga tgtttttgag ttagttaaaa ctcagttggg ctcaattccg attaatgaac tatcatatga taataaaaag aaaatcgtca acaaccttgt atcaaaggtt gatgttactg ctgataatgt agatatcata tttaaattcc aactcgctac cggtgctgct aaggacgaaa actacgctct ggctgcttaa