Team:Paris Bettencourt/Notebook

From 2013.igem.org

(Difference between revisions)
(Trojan Horse)
(Trojan Horse)
Line 686: Line 686:
<b> Add here your twit </b>
<b> Add here your twit </b>
<p>
<p>
-
Add here the documentation of your day
+
Glycerols of the overnight cultures of the transformation.
 +
<ul>
 +
<li>sT002 : MG1655 pCOLADuet-1
 +
<li>sT003 : MG1655 pACYCDuet-1
 +
<ul>
</p>
</p>
</html>
</html>
 +
==== TB-ception ====
==== TB-ception ====
<html>
<html>

Revision as of 14:43, 23 July 2013

<body>
Notebook
June 2013
Mo Tu We Th Fr Sa Su
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
July 2013
Mo Tu We Th Fr Sa Su
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31
August 2013
Mo Tu We Th Fr Sa Su
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31
September 2013
Mo Tu We Th Fr Sa Su
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29

October 2013
Mo Tu We Th Fr Sa Su
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31 1 2 3

Contents

Week 01: 3th - 9th June

Monday 3th June

Tuesday 4th June

Wednesday 5th June

Thursday 6th June

Friday 7th June

Week 02: 10th - 16th June

Monday 10th June

Tuesday 11th June

Wednesday 12th June

Thursday 13th June

Friday 14th June

Week 03: 17th - 23th June

Monday 17th June

Tuesday 18th June

Wednesday 19th June

Thursday 20th June

Friday 21th June

Week 04: 24th - 30th June

Monday 24th June

Trojan Horse

Add here your twit

Starting bacterial culture of MG1655-6300 (Chantal’s glycerol).
Streaking 2 Agar plate with it.

Tuesday 25th June

Trojan Horse

Add here your twit

Choosing a nice colony and launching overnight culture 37° in LB.

Wednesday 26th June

Thursday 27th June

Trojan Horse

Add here your twit

Making MG1655-6300 competent (edit 28/06: failure).

Friday 28th June

Trojan Horse

Add here your twit

sRNA design

PICTURE OF THE DESIGN

Red sequences:

pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT
pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT

We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.

Week 05: 1st - 7th July

Monday 01st July

Drug Screening

Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.

4 strains were received from Jake:

  • E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
  • E. coli: NEBTurbo zmSIR Chloramphenicol
  • E. coli: NEBTurbo zmFNR Spectinomycin
  • E. coli: NEBTurbo soFD, zmSIR Chloramphenicol
Media and Glycerol stock were prepared:

Media Preparation
3 500ml bottles of LB broth and LB agar were prepared by standard methods.
12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.

Glycerol Stocks
Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.

Phage Sensor

Add here your twit

Add here the documentation of your day

Trojan Horse

Add here your twit

Add here the documentation of your day

TB-ception

Add here your twit

Add here the documentation of your day

Human Practices

Add here your twit

Add here the documentation of your day

Modeling

Add here your twit

Add here the documentation of your day

Tuesday 02st July

Drug Screening

Plasmids were extracted from strains sD002, sD003, sD004

Plasmid Extraction
Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in the protocol (available on google drive).
Lacking Resuspention solution we used some from a different mini prep upstairs.
Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. Plasmids were included in catalog.

Phage Sensor

Add here your twit

Add here the documentation of your day

Trojan Horse

Glycerol stock was made and cells were transformed.

Glycerol stock
From overnight culture of MG1655-6300 O/N : T001
Centrifuge 4000rpm, 10 minutes,
Take out liquid
Resuspend cells in 1mL glycerol, 2mL LB
Separate in two cryotubes, one for the -80°C, one for the -20°C

Electroporation
Making MG1655-6300 competent using Electroporation protocol
Test of the competent cells (negative
Transforming with pCOLADuet-1
Transforming with pACYCDuet-1
Plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)

TB-ception

Add here your twit

Add here the documentation of your day

Human Practices

Add here your twit

Add here the documentation of your day

Modeling

Add here your twit

Add here the documentation of your day

Wednesday 03st July

Drug Screening

Add here your twit

Competent Cells : BL21 (DE3) dCysI dFpr dydbk

  • We grew 5ml of sD001 cells overnight from a single colony.
  • This 5ml was used to innoculate 500ml of LB broth.
  • Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
  • Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
  • Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
  • Cells were centrifuged again for 20 minutes at 4000xg.
  • Supernatant was removed and cells were resuspended in 12ml Buffer 2.
  • Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
Buffer 1: 50mM CaCl2
Buffer 2: 0.53ml 2M CaCl2 2.8ml 60% Glycerol 8.67ml sterile H2O

Phage Sensor

Add here your twit

Add here the documentation of your day

Trojan Horse

Add here your twit

Transformation results
Negative controls are negative.
Transformed cells grew on plates.
In the evening launch of 5mL Lb cultures from clones on the plates.

Igem Buffer for chemical competent cells.
Igem protocol for chemical competent cells.

Launch overnight culture of NEB turbo.
5mL LB inoculated with a clone from plate of drug team.

TB-ception

Add here your twit

Add here the documentation of your day

Human Practices

Add here your twit

Add here the documentation of your day

Modeling

Add here your twit

Add here the documentation of your day

Thursday 04st July

Drug Screening

Add here your twit

Add here the documentation of your day

Phage Sensor

Add here your twit

Add here the documentation of your day

Trojan Horse

Add here your twit

Glycerols of the overnight cultures of the transformation.

  • sT002 : MG1655 pCOLADuet-1
  • sT003 : MG1655 pACYCDuet-1

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Friday 04st July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Week 06: 8th - 14th July

      Monday 8th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Tuesday 9th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Wednesday 10th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Thursday 11th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Friday 12th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Week 07: 15th - 21th July

      Monday 15th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Tuesday 16th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Wednesday 17th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Thursday 18th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Friday 19th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Week 08: 22th - 28th July

      Monday 22th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Tuesday 23th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Wednesday 24th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Thursday 25th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Friday 26th July

      Drug Screening

      Add here your twit

      Add here the documentation of your day

      Phage Sensor

      Add here your twit

      Add here the documentation of your day

      Trojan Horse

      Add here your twit

      Add here the documentation of your day

      TB-ception

      Add here your twit

      Add here the documentation of your day

      Human Practices

      Add here your twit

      Add here the documentation of your day

      Modeling

      Add here your twit

      Add here the documentation of your day

      Week 09: 29th July - 4th August

      Week 10: 5th - 11th August

      Week 11: 12th - 18th August

      Week 12: 19th - 25th August

      Week 13: 26th August - 1st September

      Week 14: 2nd - 8th September

      Week 15: 9th - 15th September

      Week 16: 16th - 22th September

      Week 17: 23th - 29th September

      Week 18: 30th September - 6th October

      Week 19: 7th - 13th October

      Week 20: 14th - 20th October

      Week 21: 21th - 27th October

      Week 22: 28th October - 3th November

      Centre for Research and Interdisciplinarity (CRI)
      Faculty of Medicine Cochin Port-Royal, South wing, 2nd floor
      Paris Descartes University
      24, rue du Faubourg Saint Jacques
      75014 Paris, France
      +33 1 44 41 25 22/25
      team2013@igem-paris.org
      Hit Counter by Digits
      Copyright (c) 2013 igem.org. All rights reserved.