Protocols

Golden Gate TALE Assembly Protocol

DAY1

1. Enter the RVD sequence of your TALE on the Golden Gate TALE Assembly form, remember to enter the Last Repeat RVD in the separate box and the desires pTAL backbone (1, 2, 3 or 4). Print the form.
2. Mix the 1st Cycle Reactions accordingly to the form. Label each tube with the TALE number/name and the reaction letter (e.g. 35A, 35B, 35C) and date
3. Run cycle: 10x(37˚C/5min + 16˚C/10min) + 50˚C/5min + 80˚C/5min
4. Plasmid-Safe nuclease treatment: To each of your 1st cycle reactions add:
   • 1ul 25mM ATP
   • 1ul Plasmid-Safe nuclease
   • Incubate at 37˚C/1h
5. Transform DH5alpha chemically competent cells with 5ul of the reactions.
6. Plate on LB+Sp50+X-Gal+IPTG

DAY2

1. Inoculate 1-3 white colonies from each reaction into 5ml LB+Sp50

DAY3

1. Miniprep and nanodrop the plasmids
2. Diagnostic restriction digestion with AflII + XbaI to check clones:
3. Send clones to sequence with the following primers
   • pCR8-F1 ttgatgcctggcagttccct
   • pCR8-R1 cgaaccgaacaggcttatgt
4. Mix 2nd Cycle Reactions accordingly to the form
5. Run cycle: 10x(37˚C/5min + 16˚C/10min) + 37˚C/15min + 80˚C/5min
6. Transform DH5alpha chemically competent cells with 5ul of the reactions.
7. Plate on LB+Ap100+X-Gal+IPTG

DAY4

1. Inoculate 1-3 white colonies from each reaction into 5ml LB+Ap100

DAY5

1. Miniprep the pTAL vectors containing your final full-length TALE.
2. Diagnostic restriction digestion with AatII + StuI to check clones:
3. Send clones to sequence with the following primers
   • TAL-F1 ttggcgtcggcaaacagtgg
   • TAL-R2 ggcgacgaggtggtcgttgg

Agarose Gel Electrophoresis

• 2µL ladder
• Each well: 1 µL loading dye, 3 µL DNA
• Run 20 min at 100 µL

Making new Agarose gels

• 1.2 g agarose/150mL TAE buffer = 0.8% gel (standard)
• 0.48 g agarose/60mL TAE buffer = 0.8% gel (single ligation plate)
• Heat until clear
• Cool under water until warm
• add 1.5-2 µL ethidium bromide (1 µL for single ligation plate)
• Let congeal at room temperature

Analytical Restriction Digest

• 1µL buffer
• 1µL bsa
• 1µL DNA
• 0.5µL max enzyme
• water to 10 µL
• 2+hrs in 37ºC bath

Sequencing reaction

• 200-300ng DNA
• 1 µL BigDye enzyme
• 2 µL BigDye buffer
• 0.5 µL 5mM oligo (primer)
• water to 10 µL
• Run BigDye protocol in thermal cycler

PCR

• 0.25µL 100mM forward primer
• 0.25µL 100mM reverse primer
• 10µL 5xHF buffer
• 1µL dNTPs
• 0.5µL phusion HF DNA polymerase
• x µL template (vary, 0-1 µL)
• water to 50 µL
• Run protocol in thermal cycler: 95ºC/5min + 34x(95ºC/30sec + anneal/20sec + 72ºC/extension) + 72ºC/10min + 4ºC
• Anneal at 3C above lower melting point of two primers, extend for 15-30sec per kb

Spectrophotometer

• blank with EB, use 1 µL drops

Golden Gate reaction

• 100ng each DNA fragment
• 1 µL T4 DNA ligase
• 1 µL BsmB1 enzyme
• 2 µL T4 DNA ligase buffer
• water to 20 µL
• Run protocol TAL2 in thermal cycler: 10x(37ºC/5min + 16ºC/10min) + 37ºC/15min + 80ºC/5min + 4ºC

Growing chemically competent cells

1. Inoculate one colony from LB plate into 2 ml LB liquid medium. Shake at 37 °C overnight.
2. Inoculate 1-ml overnight cell culture into 100 mL LB medium (in a 500 ml flask).
3. Shake vigorously at 37°C about 1.5-2 hrs.
4. Blank with LB and Measure OD600 ~ 0.25-0.3 (0.4-0.5 better). If too low, shake longer.
5. Transfer to 2 50-mL tubes, and chill the culture on ice for 15 min. Chill the 0.1M CaCl2 solution and 0.1M CaCl2 plus 15% glycerol also.
6. Centrifuge the cells for 10 min at 3300 g.
7. Discard the medium and resuspend the cell pellet in 30-40 ml cold 0.1M CaCl2.
8. Keep the cells on ice for 30 min, then Centrifuge the cells as above.
9. Remove the supernatant, add 6 ml 0.1 M CaCl2 solution plus 15% glycerol, and vortex to resuspend the cell pellet. Do this in the cold room and be time-efficient!
10. While in cold room, pipet 0.4-0.5 ml of the cell suspension into sterile 1.5 ml microcentrifuge tubes. Transfer to -80ºC freezer.

Transformation

1. Thaw competent cells on wet ice. Place plasmid tubes on ice
2. Aliquot 50 µL into chilled plasmid tubes
3. Incubate cells on ice for 30 minutes--prepare SOC medium
4. Heat shock cells for 45 seconds in a 42ºC water bath; do not shake
5. Place on ice for 2 minutes
6. Add shocked cells to 0.9 mL of room-temperature SOC medium in a culture tube, and shake at 37ºC for 1 hour.
7. Centrifuge at 3500 for 3 min, then discard most of medium
8. Vortex to resuspend in residual medium
9. Spread onto LB+Amp (+X-gal) plates with ethanol-sterilized instrument or glass beads
10. Incubate at 37ºC overnight

PCR cleanup

Same as steps 7 through 10 of Qiagen miniprep protocol

1. Add 5x volume PB buffer, mix thoroughly and transfer max 850 µL to collection tube
2. Centrifuge for 30 seconds, Rewash with flow-through, centrifuge again, discard flow-through. Add any remaining mix to tube and repeat step 2
3. Add 0.75mL buffer PE, centrifuge for 30 sec
4. Discard flow-through, centrifuge again, discard flow-through
5. Transfer column to clean microcentrifuge tube, elute with 30-50 µL EB buffer or water, let stand for 1 min, centrifuge for 1 min. Discard column.

Colony PCR

• 5 µL Taq buffer (Taliquots Box)
• 1 µL dNTPs (PCR Box)
• 1 µL forward primer (Top Shelf, iGEM Box)
• 1 µL reverse primer
• 0.25 µL Taq polymerase (Labelled red TAQ, also inTaliquots Box)
• 8water to 50 µL
• Inoculate single colony into reaction mixture, inoculate same colony into matching tube with 50 µL SOC medium
• Run TAL colony PCR protocol in thermal cycler

Restriction Digest for Ligation

• 20 µL DNA
• 5 µL NEBuffer
• 5 µL 1 mg/mL BSA
• 2.5 µL total enzyme
• water to 50 µL
• incubate at 37C for 3 hrs
• separate fragments on gel
• cut out desired band, transfer to tubes
• Zymoclean prep kit:
  1. add 3x gel mass(ng) of ADB volume (µL)
  2. incubate at 37C for 5-10 min until dissolved
  3. if DNA >8kb, add 1x gel volume of water
  4. transfer to spin column, centrifuge 30-60 sec, discard flow-through
  5. add 200 µL wash buffer, centrifuge 30 sec, discard flow-through, repeat
  6. transfer column to labeled tube, elute with 6+ µL Elution buffer, centrifuge 30-60 sec
• Let sit for 60 min at room temp, place in heat block of cold room if leaving overnight
• Nanodrop for concentrations

Ligation

• 3:1 ratio of insert:backbone--use ligation calculator to determine volumes
• x µL backbone
• y µL insert
• 1 µL T4 ligase buffer
• 1 µL T4 ligase
• water to 10 µL
• Let sit at room temperature for 60 minutes and transform
• OR incubate in 16ºC heat block (in cold room) overnight and transform

Growing Transformed Cells

• Add 5mL of LB+antibiotic used on plate into a culture tube
• inoculate single colony into medium
• Shake overnight

Annealing complementary DNA

• Heat beaker of DI water until it starts to boil
• Place tube with equimolar ratios of two complementary oligos in beaker
• Let cool slowly to room temperature

SLIC cloning: Linearized vector with overlapping oligo inserts

• Make 2 tubes, vector tube and oligo tube
  1. Vector: ~100 ng
  2. BSA: 1 µL
  3. Buffer 2: 1 µL
  4. Water to 9.5 µL
• Chill oligo tube on ice with 0.5 µL each oligo (100µM)
• Add 0.5 µL T4 polymerase to vector tube, incubate at room temperature for 2.5 minutes
• Immediately add vector mixture to oligo tube, incubate on ice for 10 minutes
• Transform as normal

SLIC cloning: Linearized vector with double-stranded insert

• Vector: ~100 ng
• Insert: 2-3 times molar excess
• BSA: 1 µL
• Buffer 2: 1 µL
• Water to 9.5 µL
• Add 0.5 µL T4 polymerase, incubate at room temperature for 2.5 min
• OR add T4 to all except insert, add insert after ~2 min, then transfer to ice after 0.5 min
• Transfer to ice and incubate 10 min, then transform as normal

Gibson assembly

• Linearized vector: ~100 ng
• Insert (ds): 2-3 times molar excess
• Gibson Master Assembly: 10 µL
• Water to 20 µL
• Assemble on ice, then incubate at 50ºC for 60 min

Yeast transformation

• Night before: inoculate yeast colony into 45 mL YEPD, shake overnight
• Linearize 23uL total volume of insert by restriction digest or PCR, run 3 uL on gel to confirm
  1. Restriction digest:
  2. 11.5 uL DNA
  3. 2.3 uL NEbuffer
  4. 1.15 uL total enzyme
  5. 8.05 uL water
• Heat Carrier DNA at 95C for 5 min
• Dilute 10 mL 5x LiOAc/TE to 50 mL (1x)
• Spin down 45mL yeast for 5 min at 2000rpm, pour off supernatant
• Resuspend in 15mL 1x LiOAc/TE and vortex, then spin down again and pour off supernatant
• Resuspend in 1 mL 1x LiOAc/TE and vortex
• Add the following, in order, to a 1.5mL eppie:
  1. 30 uL Carrier DNA
  2. 20 uL linearized plasmid DNA
  3. 100 uL yeast suspension
  4. 800 uL 50% PEG
  5. 200 uL 5x LiOAc/TE
• Incubate at 30C for 30 min
• Heat shock in 42C bath for 25 min---longer with DBY12397 strain--40min?
• Transfer to 4 mL YEPD in culture tube and incubate in roller drum for >4hrs
• Pellet, remove supernatant, and plate on selective plates

Making YEPD

• Add 1/10 final volume of 20% glucose (final concentration 2%) to graduated cylinder
• Fill to final volume with YEP medium
• Filter with vacuum into new bottle to sterilize

Making SCD

• Add 1/100 final volume of each nutrient (6 nutrients: Met, His, Trp, Ade, Leu, Uracil) graduated cylinder
• Add 1/10 final volume of 20% glucose
• Fill to final volume with SCD
• Filter with vacuum into new bottle to sterilize

Flow Cytometry Prep

• Pick a small bit of yeast from colony with toothpick, mix into 3mL YSCD in culture tube
• Grow >6 hours (overnight for evening flow) in roller drum
• Take OD660, calculate number of cells needed to reach OD of 0.1 to 0.4 at flow start
  • Doubling time ~90 minutes
• Dilute into 3mL YSCD in culture tube, grow >6 hours in roller drum (overnight for morning flow)
  
  
• If using 96-well plate: Fill all wells (including unused and outer ring wells) with 100 uL YSCD
  1. mix colony into 100 uL YSCD in numbered well--do not put yeast in outer ring of wells
  2. Place plate on shaking table in incubator, grow as normal
  3. Dilute 1/200 (15 uL into 3 mL) into culture tube
  4. Grow in roller drum as normal
• If growing to full induction: Grow as normal for first step
  • Dilute into two separate tubes--one with YSCD+DMSO (non-inducing) and one with YSCD+BEDinDMSO (inducing)
  • Use 1/1000 dilution for 1 uM BED
    
    
• If running time course: Aim for OD 0.1 to 0.4 in morning--grow in YSCD only
  1. At start of time course, take OD and calculate dilution to OD 0.01 (final volume 7mL)
  2. Take proper volume, pellet and resuspend in 7mL each non-inducing/inducing medium
  3. Take 200uL, place on ice as first sample and place remaining in roller drum
  4. Take 200uL samples every 30 minutes and place on ice

Flow Cytometry

• Turn on sonicator, let cool to 4C before using
• Turn on machine: tap screen to start, login, click Main instrument control (top right) to warm up
• Run clean program (right click water droplet, bottom right)
  • Use tube of 1% bleach on rack by machine
• Run flush program (right click water droplet, bottom right)
• Calibrate using a droplet of beads (lower fridge door)
• Settings:
  1. Chill 5 rack--select columns 1,2,5,6 only
  2. Check events--10000 or 20000 (50000?)
  3. FSC: log3, 200V
  4. SSC: log3, 250V
  5. Y2 for mcherry: log5, 650V
  6. B1 for YFP: log5, 650V--may need adjusting
  7. Trigger: 4.00 (make sure FSC is selected)
  8. Advanced: check height and width boxes
  9. Uptake volume: 50-100uL
  10. Sample volume: lower than actual volume, higher than uptake volume
• Sonicate samples for 15 secs on medium strength
• Run a sample of control to check that settings work, adjust if necessary
• Run samples !
• Copy data to flash drive