"
Team:UniSalento Lecce/Overview
From 2013.igem.org
| Line 212: | Line 212: | ||
The risks for human health made necessary, as for many heavy metals, to remove this metal from the environment. Nowadays nickel can be chemically removed from fluids using a chelating agent, known as H2DMG (dimethylglyoxime),which helps the precipitation of the nickel metal ions for its dosing and removal. | The risks for human health made necessary, as for many heavy metals, to remove this metal from the environment. Nowadays nickel can be chemically removed from fluids using a chelating agent, known as H2DMG (dimethylglyoxime),which helps the precipitation of the nickel metal ions for its dosing and removal. | ||
| - | We thought of a living platform carrying a nickel sensing device, coupled via Quorum Sensing to a second system (i.e. another bacterial population) which will remove the nickel from the environment. Our two-population system could be implemented in a water purification plant, allowing a regulated heavy metal removal without the need for chemicals (see the <a href="https://2013.igem.org/Team:UniSalento_Lecce/Applications"> | + | We thought of a living platform carrying a nickel sensing device, coupled via <i>Quorum Sensing</i> to a second system (i.e. another bacterial population) which will remove the nickel from the environment. Our two-population system could be implemented in a water purification plant, allowing a regulated heavy metal removal without the need for chemicals (see the <a href="https://2013.igem.org/Team:UniSalento_Lecce/Applications">Applications</a> page). |
</p> | </p> | ||
</section> | </section> | ||
| Line 218: | Line 218: | ||
<h3 style="text-align:center">Nickel sensing</h3> | <h3 style="text-align:center">Nickel sensing</h3> | ||
<p> | <p> | ||
| - | The sensing device is based on a set of genetic parts from the pathogen Helicobacter pylori. This microorganism, which colonizes the stomach, requires a large amount of nickel to mantain its homeostasis in such a hard environment. Particularly, Ni++ ions are essential for Urease activity, the key enzyme for H.pylori survival in the acidic environment of the stomach, as well as for a respiratory hydrogenase. Urease makes up to 10% of the total cell protein synthesis, so that nickel homeostasis becomes an essential step for the survival of the pathogen. | + | The sensing device is based on a set of genetic parts from the pathogen <i>Helicobacter pylori</i>. This microorganism, which colonizes the stomach, requires a large amount of nickel to mantain its homeostasis in such a hard environment. Particularly, Ni++ ions are essential for Urease activity, the key enzyme for <i>H.pylori</i> survival in the acidic environment of the stomach, as well as for a respiratory hydrogenase. Urease makes up to 10% of the total cell protein synthesis, so that nickel homeostasis becomes an essential step for the survival of the pathogen. |
</p> | </p> | ||
</section> | </section> | ||
| Line 252: | Line 252: | ||
<h3 style="text-align:center">Negative promoters</h3> | <h3 style="text-align:center">Negative promoters</h3> | ||
<p> | <p> | ||
| - | As shown above, nickel-bound NikR can downregulate the expression of various target. We obtained a genomic region from <i>H.pylori</i> G27 containing a divergent operon with two NikR-regulated promoters. The plasmid was sent us again by prof. Alberto Danielli as pNKTB. The promoters control the expression of the exbBD operon (for siderophore uptake, called Pexb) and for nikR expression itself (PnikR). According to functional segmentation of the divergent operon (as in Delany et al., see bibliography), we tried to separate the promoters, using the following primers: </p> | + | As shown above, nickel-bound NikR can downregulate the expression of various target. We obtained a genomic region from <i>H.pylori</i> G27 containing a divergent operon with two NikR-regulated promoters. The plasmid was sent us again by prof. Alberto Danielli as pNKTB. The promoters control the expression of the exbBD operon (for siderophore uptake, called Pexb) and for nikR expression itself (PnikR). According to functional segmentation of the divergent operon (as in Delany et al., see bibliography), we tried to separate the promoters, using the following primers(including Biobrick Prefix and Suffix, lowercase): </p> |
<p style="text-align:center">IntergenicaFor: gtttcttcgaattcgcggccgcttctagag<b>TGAGAAAAATCCTTTTTTG</b></p> | <p style="text-align:center">IntergenicaFor: gtttcttcgaattcgcggccgcttctagag<b>TGAGAAAAATCCTTTTTTG</b></p> | ||
| Line 278: | Line 278: | ||
<h3 style="text-align:center">Storage system</h3> | <h3 style="text-align:center">Storage system</h3> | ||
<p> | <p> | ||
| - | + | The second part of our project aimed to develop a bacterial population able to store nickel, basing its activity on the Hpn protein from <i>H. pylori</i> and a <i>Quorum Sensing</i> signalling: this last natural process is the basis of interaction between the two bacterial communities. The storage system of our design allows to accumulate the metal by bioconcentration: once accumulation occurred, it is necessary to dispose of the bacterial biomass containing the metal. See the <a href="https://2013.igem.org/Team:UniSalento_Lecce/Applications">Applications</a> page for a design of purification plant implementation. | |
</p> | </p> | ||
</section> | </section> | ||
Revision as of 15:13, 1 October 2013
Background
Nickel is a very widespread heavy metal and its levels in waters and other environmental matrixes are highly dependant on human activities. A lot of industrial applications lead to an increase of nickel amounts in the environment, and the growing nickel contamination led to an increase in Nickel related allergies (more than the 15% of the population suffers on nickel allergy) and other pathologies concerning the reproductive, cardiac and respiratory systems. Furthermore, Nickel compounds have been classified as cancerogenic by the International Agency for Research on Cancer (IARC, see http://monographs.iarc.fr/ENG/Monographs/vol100C/mono100C-10.pdf). The risks for human health made necessary, as for many heavy metals, to remove this metal from the environment. Nowadays nickel can be chemically removed from fluids using a chelating agent, known as H2DMG (dimethylglyoxime),which helps the precipitation of the nickel metal ions for its dosing and removal. We thought of a living platform carrying a nickel sensing device, coupled via Quorum Sensing to a second system (i.e. another bacterial population) which will remove the nickel from the environment. Our two-population system could be implemented in a water purification plant, allowing a regulated heavy metal removal without the need for chemicals (see the Applications page).
Nickel sensing
The sensing device is based on a set of genetic parts from the pathogen Helicobacter pylori. This microorganism, which colonizes the stomach, requires a large amount of nickel to mantain its homeostasis in such a hard environment. Particularly, Ni++ ions are essential for Urease activity, the key enzyme for H.pylori survival in the acidic environment of the stomach, as well as for a respiratory hydrogenase. Urease makes up to 10% of the total cell protein synthesis, so that nickel homeostasis becomes an essential step for the survival of the pathogen.
HpNikR: a pleiotropic regulator
Helicobacter controls this homeostasis through a nickel regulator, HpNikR, an homologue of NikRs from different bacterial species (including E.coli). However, in H.pylori NikR acts as a pleiotropic regulator, being a rare case of master switch regulator in bacteria. Its strong reliance on nickel concentrations and its multiple responsive elements, both positively or negatively controlled, make us think of developing a synthetic regulon for nickel sensing.
We cloned HpNikR from H.pylori strain G27 from the plasmid pET-NikR, sent us by prof. Alberto Danielli (University of Bologna), the gene was cloned using the following primers (including Biobrick Prefix and Suffix, lowercase):
nikrFor: gtttcttcgaattcgcggccgcttctagATGGATACACCCAATAAAGACG
nikrRev: gtttcttcctgcagcggccgctactagtattattaCTATTCATTGTGTTCAAAG
(Here the PCR electrophoretic profile). Thus we obtained BBa_K1151000, and its derivative coding device, pLac-regulated BBa_K1151006.HpNikR-controlled promoters
HpNikR, as said above, has multiple target promoters, some of them being upregulated, some being downregulated, responding to nickel concentration in the environment.
Negative promoters
As shown above, nickel-bound NikR can downregulate the expression of various target. We obtained a genomic region from H.pylori G27 containing a divergent operon with two NikR-regulated promoters. The plasmid was sent us again by prof. Alberto Danielli as pNKTB. The promoters control the expression of the exbBD operon (for siderophore uptake, called Pexb) and for nikR expression itself (PnikR). According to functional segmentation of the divergent operon (as in Delany et al., see bibliography), we tried to separate the promoters, using the following primers(including Biobrick Prefix and Suffix, lowercase):
IntergenicaFor: gtttcttcgaattcgcggccgcttctagagTGAGAAAAATCCTTTTTTG
pnikfor: gtttcttcctgcagcggccgctactagtaTGAGAAAAATCCTTTTTTG
pnikrev: gtttcttcgaattcgcggccgcttctagagAATTCAAACGCTCTTATG
pexbfor: gtttcttcgaattcgcggccgcttctagagACTGGATTTAAATGGTTG
pexbBrev:gtttcttcctgcagcggccgctactagtaGCACCCTATAAGAAGGCATC
(Here the link to PCR Results)So we obtained the whole divergent operon and Pexb and Pnikr. These promoters were cloned upstream of BBa_E0240, becoming parts BBa_K1151009,BBa_K1151010, BBa_K1151011. Here you can see (link to experimental data) characterization data for BBa_K1151036 and BBa_K1151038: constructs made up by the promoters cloned upstream of GFP cds together with BBa_K1151006, HpNikR coding device.
Positive promoter
We also tried a positively-regulated promoter, from UreABCDE operon (PureA). We got it synthetized from IDT, obtaining a href:"http://parts.igem.org/Part:BBa_K1151005>BBa_K1151005 We weren't able to characterize BBa_K1151005 activity.
Storage system
The second part of our project aimed to develop a bacterial population able to store nickel, basing its activity on the Hpn protein from H. pylori and a Quorum Sensing signalling: this last natural process is the basis of interaction between the two bacterial communities. The storage system of our design allows to accumulate the metal by bioconcentration: once accumulation occurred, it is necessary to dispose of the bacterial biomass containing the metal. See the Applications page for a design of purification plant implementation.
Hpn protein
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
Nickel-dependent Quorum Sensing Network
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
Bibliography
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
