Team:UniSalento Lecce/Data

From 2013.igem.org

(Difference between revisions)
 
(41 intermediate revisions not shown)
Line 1: Line 1:
<html>
<html>
<head>
<head>
-
 
+
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
-
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
+
<link rel="stylesheet" href="https://2013.igem.org/Team:UniSalento_Lecce/css/common.css?action=raw&ctype=text/css" type="text/css" />
-
        <link rel="stylesheet" href="https://2013.igem.org/Team:UniSalento_Lecce/css/common.css?action=raw&ctype=text/css" type="text/css" />
+
<link rel="stylesheet" href="https://2013.igem.org/Team:UniSalento_Lecce/css/fixed-sidebar.css?action=raw&ctype=text/css" type="text/css" />
-
        <link rel="stylesheet" href="https://2013.igem.org/Team:UniSalento_Lecce/css/fixed-sidebar.css?action=raw&ctype=text/css" type="text/css" />
+
<script src="https://2013.igem.org/Team:UniSalento_Lecce/js/go-to-top.js?action=raw&ctype=text/javascript"></script>
-
<script src="https://2013.igem.org/Team:UniSalento_Lecce/js/go-to-top.js?action=raw&ctype=text/javascript"></script>
+
<script src="https://2013.igem.org/Team:UniSalento_Lecce/js/fixed-navbar.js?action=raw&ctype=text/javascript"></script>
-
<script src="https://2013.igem.org/Team:UniSalento_Lecce/js/fixed-navbar.js?action=raw&ctype=text/javascript"></script>
+
<script src="https://2013.igem.org/Team:UniSalento_Lecce/js/fixed-sidebar.js?action=raw&ctype=text/javascript"></script>
-
        <script src="https://2013.igem.org/Team:UniSalento_Lecce/js/fixed-sidebar.js?action=raw&ctype=text/javascript"></script>
+
<script type="text/javascript">
<script type="text/javascript">
-
    $(document).ready(function() {
+
$(document).ready(function() {
-
        $("p").filter( function() {
+
$("p").filter( function() {
-
            return $.trim($(this).html()) == '';
+
return $.trim($(this).html()) == '';
-
        }).remove()
+
}).remove()
-
    });
+
});
</script>
</script>
-
 
</head>
</head>
<body>
<body>
<!-- ****************** Start Header *********************** -->
<!-- ****************** Start Header *********************** -->
<header>
<header>
-
        <img src="https://static.igem.org/mediawiki/2013/0/0b/Unisalento_logo_team.png" height="110px" style="position: absolute; left:37px; top:105px">
+
<img src="https://static.igem.org/mediawiki/2013/0/0b/Unisalento_logo_team.png" height="110px" style="position: absolute; left:37px; top:105px">
-
<img src="https://static.igem.org/mediawiki/igem.org/f/f7/New1.png" height="220px">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce" style="background: none">
-
<a href="https://www.unisalento.it" style="background: none"><img src="https://static.igem.org/mediawiki/2013/c/c7/Unisalento_logo_university.png" height="85px" style="position: absolute; right:40px; top:125px"></a>
+
<img src="https://static.igem.org/mediawiki/2013/a/a5/Unisalento_logo_project.png" width="450px" style="margin-top:0px;margin-left:0px">
 +
</a>
 +
<a href="http://www.igem.org" style="background: none">
 +
<img src="https://static.igem.org/mediawiki/2013/b/b0/Unisalento_Igem_official.png" height="75px" style="position: absolute; right:40px; top:15px">
 +
</a>
 +
<a href="https://www.unisalento.it" style="background: none">
 +
<img src="https://static.igem.org/mediawiki/2013/c/c7/Unisalento_logo_university.png" height="85px" style="position: absolute; right:40px; top:125px">
 +
</a>
</header>
</header>
<!-- ****************** End Header ************************* -->
<!-- ****************** End Header ************************* -->
<!-- ****************** Start Navigation Bar ************************* -->
<!-- ****************** Start Navigation Bar ************************* -->
<nav>
<nav>
-
<ul id="css3menu1" class="topmenu">
+
<ul id="css3menu1" class="topmenu">
-
<li class="topmenu">
+
<li class="topmenu">
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce" title="Home" style="height:24px;line-height:24px;">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce" title="Home" style="height:24px;line-height:24px;">
-
<img src="https://static.igem.org/mediawiki/2013/b/bc/Unisalento_home.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/b/bc/Unisalento_home.png" alt="">
-
Home
+
Home
-
</a>
+
</a>
-
</li>
+
</li>
-
<li class="toproot">
+
<li class="toproot">
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Team" title="Team" style="height:24px;line-height:24px;">
+
<a href="#" title="Team" style="height:24px;line-height:24px;">
-
<img src="https://static.igem.org/mediawiki/2013/5/50/Unisalento_users.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/5/50/Unisalento_users.png" alt="">
-
Team
+
Team
-
</a>
+
</a>
-
<div class="submenu" style="width:230px">
+
<div class="submenu" style="width:230px">
-
<div class="column" style="width:100%">
+
<div class="column" style="width:100%">
-
<ul>
+
<ul>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Team" title="Team">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Team" title="Team">
-
<img src="https://static.igem.org/mediawiki/2013/1/12/Unisalento_user1.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/1/12/Unisalento_user1.png" alt="">
-
Team
+
Team
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/University" title="University/Department">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/University" title="University/Department">
-
<img src="https://static.igem.org/mediawiki/2013/c/c3/Unisalento_university.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/c/c3/Unisalento_university.png" alt="">
-
University/Department
+
University/Department
-
</a>
+
</a>
-
</li>
+
</li>
-
</ul>
+
</ul>
-
</div>
+
</div>
-
</div>
+
</div>
-
</li>
+
</li>
-
<li class="toproot">
+
<li class="toproot">
-
<a href="#" title="Project" style="height:24px;line-height:24px;">
+
<a href="#" title="Project" style="height:24px;line-height:24px;">
-
<span>
+
<span>
-
<img src="https://static.igem.org/mediawiki/2013/f/f2/Unisalento_project.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/f/f2/Unisalento_project.png" alt="">
-
Project
+
Project
-
</span>
+
</span>
-
</a>
+
</a>
-
<div class="submenu" style="width:250px">
+
<div class="submenu" style="width:250px">
-
<div class="column" style="width:100%">
+
<div class="column" style="width:100%">
-
<ul>
+
<ul>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Overview" title="Why? ... An overview">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Overview" title="Why NickBusters?">
-
<img src="https://static.igem.org/mediawiki/2013/7/79/Unisalento_question.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/7/79/Unisalento_question.png" alt="">
-
Why? ... An overview
+
Why NickBusters?
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="#" title="Experimentals data and results">
+
<a href="#" title="Experimental data and results">
-
<img src="https://static.igem.org/mediawiki/2013/c/c9/Unisalento_chart.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/c/c9/Unisalento_chart.png" alt="">
-
Experimental data and results
+
Experimental data and results
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Parts" title="Biobricks and parts">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Parts" title="Biobricks and parts">
-
<img src="https://static.igem.org/mediawiki/2013/3/36/Unisalento_lego.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/3/36/Unisalento_lego.png" alt="">
-
Biobricks and parts
+
Biobricks and parts
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Applications" title="Biobricks and parts">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Applications" title="Applications">
-
<img src="https://static.igem.org/mediawiki/2013/6/6e/Unisalento_applications.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/6/6e/Unisalento_applications.png" alt="">
-
Applications
+
Applications
-
</a>
+
</a>
-
</li>
+
</li>
-
</ul>
+
</ul>
-
</div>
+
</div>
-
</div>
+
</div>
-
</li>
+
</li>
-
<li class="topmenu">
+
<li class="topmenu">
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Modeling" title="Model" style="height:24px;line-height:24px;">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Human_Practices" title="Human practices" style="height:24px;line-height:24px;">
-
<span>
+
<span>
-
<img src="https://static.igem.org/mediawiki/2013/9/9d/Unisalento_model.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/6/6b/Unisalento_world.png" alt="">
-
Model
+
Human practices
-
</span>
+
</span>
-
</a>
+
</a>
-
</li>
+
</li>
-
<li class="toproot">
+
<li class="toproot">
-
<a href="#" title="Nootebook" style="height:24px;line-height:24px;">
+
<a href="#" title="Nootebook" style="height:24px;line-height:24px;">
-
<span>
+
<span>
-
<img src="https://static.igem.org/mediawiki/2013/2/2d/Unisalento_notes.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/2/2d/Unisalento_notes.png" alt="">
-
Notebook
+
Notebook
-
</span>
+
</span>
-
</a>
+
</a>
-
<div class="submenu" style="width:200px;">
+
<div class="submenu" style="width:200px;">
-
<div class="column" style="width:100%">
+
<div class="column" style="width:100%">
-
<ul>
+
<ul>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Notebook" title="Weekly Journal">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Notebook" title="Weekly Journal">
-
<img src="https://static.igem.org/mediawiki/2013/3/34/Unisalento_date.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/3/34/Unisalento_date.png" alt="">
-
Weekly Journal
+
Weekly Journal
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Protocols" title="Protocols">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Protocols" title="Protocols">
-
<img src="https://static.igem.org/mediawiki/2013/c/c5/Unisalento_db.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/c/c5/Unisalento_db.png" alt="">
-
Protocols
+
Protocols
-
</a>
+
</a>
-
</li>
+
</li>
-
</ul>
+
</ul>
-
</div>
+
</div>
-
</div>
+
</div>
-
</li>
+
</li>
-
<li class="topmenu">
+
<li class="topmenu">
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Safety" title="Safety" style="height:24px;line-height:24px;">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Safety" title="Safety" style="height:24px;line-height:24px;">
-
<span>
+
<span>
-
<img src="https://static.igem.org/mediawiki/2013/5/5e/Unisalento_safety.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/5/5e/Unisalento_safety.png" alt="">
-
Safety
+
Safety
-
</span>
+
</span>
-
</a>
+
</a>
-
</li>
+
</li>
-
<li class="toproot">
+
<li class="toproot">
-
<a href="#" title="Extra" style="height:24px;line-height:24px;">
+
<a href="#" title="Extra" style="height:24px;line-height:24px;">
-
<img src="https://static.igem.org/mediawiki/2013/3/32/Unisalento_star.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/3/32/Unisalento_star.png" alt="">
-
Extra
+
Extra
-
</a>
+
</a>
-
<div class="submenu" style="width:220px;">
+
<div class="submenu" style="width:220px;">
-
<div class="column" style="width:100%">
+
<div class="column" style="width:100%">
-
<ul>
+
<ul>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Human_Practices" title="Human practices">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Modeling" title="Model">
-
<img src="https://static.igem.org/mediawiki/2013/6/6b/Unisalento_world.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/9/9d/Unisalento_model.png" alt="">
-
Human practices
+
Model
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Sponsors" title="Sposors">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Sponsors" title="Sposors">
-
<img src="https://static.igem.org/mediawiki/2013/f/f7/Unisalento_flag.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/f/f7/Unisalento_flag.png" alt="">
-
Sponsors
+
Sponsors
-
</a>
+
</a>
-
</li>
+
</li>
-
<li>
+
<li>
-
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Attributions" title="Acknowledgments">
+
<a href="https://2013.igem.org/Team:UniSalento_Lecce/Attributions" title="Acknowledgments">
-
<img src="https://static.igem.org/mediawiki/2013/e/e9/Unisalento_search.png" alt="">
+
<img src="https://static.igem.org/mediawiki/2013/e/e9/Unisalento_search.png" alt="">
-
Acknowledgments
+
Acknowledgments
-
</a>
+
</a>
-
</li>
+
</li>
-
</ul>
+
</ul>
-
</div>
+
</div>
-
</div>
+
</div>
-
</li>
+
</li>
-
</ul>
+
</ul>
-
<!-- ****************** Start Social Links ************************ -->
+
<!-- ****************** Start Social Links ************************ -->
-
<div id="social_facebook"><a href="https://www.facebook.com/IgemUnisalento2013" style="background: none"><img src="https://static.igem.org/mediawiki/2013/f/f3/Unisalento_facebook.png" alt="" height="50px"></a></div>
+
<div id="social_facebook"><a href="https://www.facebook.com/IgemUnisalento2013" style="background: none"><img src="https://static.igem.org/mediawiki/2013/f/f3/Unisalento_facebook.png" alt="" height="50px"></a></div>
-
<div id="social_twitter"><a href="https://www.twitter.com/iGEM_UniSalento" style="background: none"><img src="https://static.igem.org/mediawiki/2013/7/7d/Unisalento_twitter.png" alt="" height="50px"></a></div>
+
<div id="social_twitter"><a href="https://www.twitter.com/iGEM_UniSalento" style="background: none"><img src="https://static.igem.org/mediawiki/2013/7/7d/Unisalento_twitter.png" alt="" height="50px"></a></div>
-
<div id="social_gmail"><a href="http://www.google.com"><img src="https://static.igem.org/mediawiki/2013/d/d3/Unisalento_gmail.png" alt="" height="50px"></a></div>
+
<div id="social_gmail"><a href="https://plus.google.com/u/0/108724165022727316894" style="background: none"><img src="https://static.igem.org/mediawiki/2013/d/d3/Unisalento_gmail.png" alt="" height="50px"></a></div>
-
<div class="clear"></div>
+
<div class="clear"></div>
-
<!-- ******************* End Social Links ************************* -->
+
<!-- ******************* End Social Links ************************* -->
</nav>
</nav>
<!-- ****************** End Navigation Bar ************************* -->
<!-- ****************** End Navigation Bar ************************* -->
<!-- ********************************************** Start Main **************************************************** -->
<!-- ********************************************** Start Main **************************************************** -->
<div id="main">
<div id="main">
-
<div id="main_wrap">
+
<div id="main_wrap">
-
<div id="container">
+
<div id="container">
-
<div class="fixsidebar">
+
<div class="fixsidebar">
-
    <ul class="nav nav-list bs-docs-sidenav" style="list-style:none">
+
<ul class="nav nav-list bs-docs-sidenav" style="list-style:none">
-
      <li><a href="#o1" style="text-decoration: none"><i class="icon-chevron-right"></i>1. Submitted parts agarose gel analysis</a></li>
+
<li><a href="#o1" style="text-decoration: none"><i class="icon-chevron-right"></i>1. Submitted parts agarose gel analysis</a></li>
-
      <li>
+
<li>
-
      <a href="#o2" style="text-decoration: none"><i class="icon-chevron-right"></i>2. Nickel sensing </a>
+
<a href="#o2" style="text-decoration: none"><i class="icon-chevron-right"></i>2. HpNikR characterization data </a>
-
      <div class="sub-nav-wrapper" style="">
+
<div class="sub-nav-wrapper" style="">
-
          <ul>
+
<ul>
-
      <li class="caption"><a href="#o2_1" style="text-decoration: none; color: #777777;">1. HpNikR: a pleiotropic regulator</a></li>
+
<li class="caption" style="font-size: 13px"><a href="#o2_1" style="text-decoration: none; color: #777777;">1. HpNikR PCR</a></li>
-
      <li class="caption"><a href="#o2_2" style="text-decoration: none; color: #777777;">2. HpNikR-controlled promoters</a></li>
+
<li class="caption" style="font-size: 13px"><a href="#o2_2" style="text-decoration: none; color: #777777;">2. HpNikR expression in BL21(DE3) cells</a></li>
-
          </ul>
+
<li class="caption" style="font-size: 13px"><a href="#o2_3" style="text-decoration: none; color: #777777;">3. Cytosol/membrane separation by Zerial method</a></li>
-
      </div>
+
<li class="caption" style="font-size: 13px"><a href="#o2_4" style="text-decoration: none; color: #777777;">4. HpNikR purification by Ni-NTA resin</a></li>
-
      </li>
+
<li class="caption" style="font-size: 13px"><a href="#o2_5" style="text-decoration: none; color: #777777;">5. ICP-AES assay</a></li>
-
      <li><a href="#o3" style="text-decoration: none"><i class="icon-chevron-right"></i>3. Storage system (link dallo slider STORE IT)</a>
+
<li class="caption" style="font-size: 13px"><a href="#o2_6" style="text-decoration: none; color: #777777;">6. ATR-FTIR spectroscopy assay</a></li>
-
      <div class="sub-nav-wrapper" style="">
+
<li class="caption" style="font-size: 13px"><a href="#o2_7" style="text-decoration: none; color: #777777;">7. Raman spectroscopy assay</a></li>
-
          <ul>
+
<li class="caption" style="font-size: 13px"><a href="#o2_8" style="text-decoration: none; color: #777777;">8. CryoTEM microscopy of purified HpNikR</a></li>
-
      <li class="caption"><a href="#o3_1" style="text-decoration: none; color: #777777;">1. Hpn: a storage protein in H. pylori</a></li>
+
</ul>
-
          </ul>
+
</div>
-
      </div>
+
</li>
-
      </li>
+
<li><a href="#o3" style="text-decoration: none"><i class="icon-chevron-right"></i>3. Nickel responsive promoters characterization data</a>
-
      <li><a href="#o4" style="text-decoration: none"><i class="icon-chevron-right"></i>4. Nickel-dependant Quorum Sensing Network</a></li>
+
<div class="sub-nav-wrapper" style="">
-
      <li><a href="#o5" style="text-decoration: none"><i class="icon-chevron-right"></i>5. General cloning and working schemes</a></li>
+
<ul>
-
      <li><a href="#o6" style="text-decoration: none"><i class="icon-chevron-right"></i>6. Bibliography</a></li>
+
<li class="caption" style="font-size: 13px"><a href="#o3_1" style="text-decoration: none; color: #777777;">1. PCR amplification of the promoters</a></li>
-
</ul>
+
<li class="caption" style="font-size: 13px"><a href="#o3_2" style="text-decoration: none; color: #777777;">2. pnikr</a></li>
-
  </div>
+
<li class="caption" style="font-size: 13px"><a href="#o3_3" style="text-decoration: none; color: #777777;">3. Double divergent promoter (pnikR-pexbB)</a></li>
-
  <div class="split2_3r">
+
</ul>
-
  <a name="o1"></a><br>
+
</div>
-
  <h2 style="text-align:center">Experimental data and results</h2>
+
</li>
 +
</ul>
 +
</div>
 +
<div class="split2_3r">
 +
<a name="o1"></a><br>
 +
<h2 style="text-align:center">Experimental data and results</h2>
 +
<a name="o1">
<br>
<br>
<br>
<br>
-
<section id="intro">
+
<section id="intro">
-
<h3>1 - Submitted parts agarose gel analysis</h3>
+
<h3>1 - Submitted parts agarose gel analysis</h3>
<br>
<br>
-
<p>
+
<p>
-
 
+
Here you can find a PCR and/or a restriction analysis of these parts: <a href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a>, <a href="http://parts.igem.org/Part:BBa_K1151005">BBa_K1151005</a>, <a href="http://parts.igem.org/Part:BBa_K1151009">BBa_K1151009</a>, <a href="http://parts.igem.org/Part:BBa_K1151010">BBa_K1151010</a>, <a href="http://parts.igem.org/Part:BBa_K1151011">BBa_K1151011</a>, <a href="http://parts.igem.org/Part:BBa_K1151036">BBa_K1151036</a>, <a href="http://parts.igem.org/Part:BBa_K1151038">BBa_K1151038</a>, made to evaluate their identity.<br>The molecular weight of these parts has been evaluated with the <a href="http://www.bio.davidson.edu/molecular/Protocols/gels2002/1kbladder.pdf">Invitrogen 1kb DNA Ladder (15615-016)</a><br><br>
-
Here you can find a PCR and/or a restriction analysis of these parts: <a href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a>, <a href="http://parts.igem.org/Part:BBa_K1151005">BBa_K1151005</a>, <a href="http://parts.igem.org/Part:BBa_K1151009">BBa_K1151009</a>, <a href="http://parts.igem.org/Part:BBa_K1151010">BBa_K1151010</a>, <a href="http://parts.igem.org/Part:BBa_K1151011">BBa_K1151011</a>, <a href="http://parts.igem.org/Part:BBa_K1151036">BBa_K1151036</a>, <a href="http://parts.igem.org/Part:BBa_K1151038">BBa_K1151038</a>, made to evaluate their identity.
+
</p>
-
The molecular weight of these parts has been evaluated with the <a href="http://www.bio.davidson.edu/molecular/Protocols/gels2002/1kbladder.pdf">Invitrogen 1kb DNA Ladder (15615-016)</a></p><br>
+
<h4 style="text-align:center">
-
 
+
<b><a href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a></b><br><br>
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a></b></p><br>
+
</h4>
-
<p>foto</p><br><p>The K1151001 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
<p>foto</p><br><p>The K1151001 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151005">BBa_K1151005</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151005 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
<p>foto</p><br><p>The K1151005 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151009">BBa_K1151009</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151009 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
<p>foto</p><br><p>The K1151009 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151010">BBa_K1151010</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151010 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
<p>foto</p><br><p>The K1151010 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151011">BBa_K1151011</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151011 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
<p>foto</p><br><p>The K1151011 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151036">BBa_K1151036</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151036 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
 
+
-
<p><b><a href="http://parts.igem.org/Part:BBa_K1151038">BBa_K1151038</a></b></p><br>
+
-
<p>foto</p><br><p>The K1151038 digestion with EcoRI displays a profile confirming its molecular weight.<p>foto</p><br><p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>2 - HpNikR characterization data</h3>
+
-
<p>
+
-
We received this part by Dr. Alberto Danielli, a researcher in molecular biology at the Department of Pharmacology and Biotechnology at the University of Bologna. He sent us the gene encoding HpNikR (from the genome of <i>H. pylori</i> G27) inserted into a pET-15b plasmid.
+
-
For studying HpNikR, submitted as <a href="http://parts.igem.org/Part:BBa_K1151000">BBa_K1151000</a>, we proceeded with the following workflow. Go to the <a href="https://2013.igem.org/Team:UniSalento_Lecce/Protocols">Protocols page</a></p><br>.
+
-
 
+
-
<h4><b>2.1 - HpNikR PCR</b></h4><br>
+
<p style="margin:16px,0,16px,0">
<p style="margin:16px,0,16px,0">
-
    <img src="https://static.igem.org/mediawiki/parts/4/44/NikRPCR.jpg" height="250px" alt="" align="right" style="margin-left:15px;margin-top:0px"/>
+
<img src="https://static.igem.org/mediawiki/parts/9/9f/BoilingUnisalento.jpg" height="120px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
-
    This part was amplified by PCR from the plasmid received by us.<br>Primers used (including Biobrick Prefix and Suffix, lowercase):<br>nikRFor:<br>gtttcttcgaattcgcggccgcttctagATGGATACACCCAATAAAGACG<br>nikRRev:<br>gtttcttcctgcagcggccgctactagtattattaCTATTCATTGTGTTCAAAG<br><br><br><br><br><br><br>
+
The K1151001 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<br><br><br><br><br><br>
-
</p><br>
+
<img src="https://static.igem.org/mediawiki/parts/a/ac/PCRVF21Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
-
 
+
The K1151001 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br>
-
<h4><b>2.2 - NikR expression using BL21(DE3) cells</b></h4><br>  
+
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151005">BBa_K1151005</a></b><br><br>
 +
</h4>
<p style="margin:16px,0,16px,0">
<p style="margin:16px,0,16px,0">
-
<img src="https://static.igem.org/mediawiki/parts/5/58/Rit.jpg" height="380px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
+
<img src="https://static.igem.org/mediawiki/parts/4/49/Boiling1Unisalento.jpg" height="120px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
-
First we made ​​competent BL21 cells and we transformed it with the plasmid containing NikR. We then proceeded with the normal protocol of induction with IPTG for a time of 1, 2 and 4 hours.<br><br><br><br><br><br><br><br><br><br><br><br><br>
+
The K1151005 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<br><br><br><br><br><br><br>
-
</p><br>
+
<img src="https://static.igem.org/mediawiki/parts/8/89/VF22Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
-
 
+
The K1151005 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br><br>
-
<h4><b>2.3 - Cytosol/membrane separation by Zerial method</b></h4><br>
+
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151009">BBa_K1151009</a></b><br><br>
 +
</h4>
<p style="margin:16px,0,16px,0">
<p style="margin:16px,0,16px,0">
-
<img src="https://static.igem.org/mediawiki/parts/c/cf/42.jpg" height="380px" alt="" align="right" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
+
<img src="https://static.igem.org/mediawiki/parts/7/75/EPUnisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
-
To confirm that NikR is a cytosolic protein (not expressed in multivesicular bodies, and then in membrane) we performed a separation membrane-cytosol (Zerial method) (sample: 2-hours induced cells).
+
The K1151009 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br><br><br>
 +
<img src="https://static.igem.org/mediawiki/parts/8/82/VF23Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151009 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151010">BBa_K1151010</a></b><br><br>
 +
</h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/a/a3/EPEP1Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151010 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br><br><br>
 +
<img src="https://static.igem.org/mediawiki/parts/6/6a/PCR34Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151010 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151011">BBa_K1151011</a></b><br><br>
 +
</h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/4/4c/EPEP3Unisalento.jpg" height="140px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151011 digestion with EcoRI and PstI displays a profile confirming its molecular weight.<br><br><br><br><br><br><br>
 +
<img src="https://static.igem.org/mediawiki/parts/4/49/PCR77Unisalento.jpg" height="120px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151011 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br>
 +
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151036">BBa_K1151036</a></b><br><br>
 +
</h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/9/9a/PCR881Unisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151036 PCR with VF2 (<a href="http://parts.igem.org/Part:BBa_G00100">BBa_BBa_G00100</a>) and VR (<a href="http://parts.igem.org/Part:BBa_G00101">BBa_BBa_G00101</a>) displays a profile confirming its molecular weight.<br><br><br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4 style="text-align:center">
 +
<b><a href="http://parts.igem.org/Part:BBa_K1151038">BBa_K1151038</a></b><br><br>
 +
</h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/e/e6/ECOUnisalento.jpg" height="220px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
The K1151038 digestion with EcoRI displays a profile confirming its molecular <a name="o2"></a>weight.<br><br><br><br><br><br><br><br><br>
 +
</p><br><br>
 +
</section>
 +
<section id="intro">
 +
<h3>2 - HpNikR characterization data</h3>
 +
<p>
 +
<br>We received this part by Dr. Alberto Danielli, a researcher in molecular biology at the Department of Pharmacology and Biotechnology at the University of Bologna. He sent us the gene encoding HpNikR (from the genome of <i>H. pylori</i> G27) inserted into a pET-15b plasmid.<a name="o2_1"></a><br>For studying HpNikR, submitted as <a href="http://parts.igem.org/Part:BBa_K1151000">BBa_K1151000</a>, we proceeded with the following workflow. Go to the <a href="https://2013.igem.org/Team:UniSalento_Lecce/Protocols">Protocols page</a> to see our experimental procedures.<br><br><br>
 +
</p>
 +
<h4><b>2.1 - HpNikR PCR</b><br><br></h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/4/44/NikRPCR.jpg" height="250px" alt="" align="right" style="margin-left:15px;margin-top:0px"/>
 +
This part was amplified by PCR from the plasmid pETNikR.<br>Primers used (including Biobrick Prefix and Suffix, lowercase):<br>nikRFor:<br>gtttcttcgaattcgcggccgcttctagATGGATACACCCAATAAAGACG<br>nikRRev:<br>gtttcttcctgcagcggccgctactagtattatta<a name="o2_2"></a>CTATTCATTGTGTTCAAAG<br><br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4><b>2.2 - HpNikR expression using BL21(DE3) cells</b><br><br></h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/9/9a/RitUnisalento.jpg" height="380px" alt="" align="right" style="margin-left:25px;margin-top:0px"/>
 +
First we made ​​competent BL21 cells and we transformed it with the plasmid containing HpNikR. We then proceeded with the normal protocol of induction with IPTG for a time of 1, 2 and 4 <a name="o2_3"></a>hours.<br><br><br><br><br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4><b>2.3 - Cytosol/membrane separation by Zerial method</b><br><br></h4>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/d/d5/42Unisalento.jpg" height="380px" alt="" align="right" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
To confirm that NikR is a cytosolic protein (not expressed in multivesicular bodies, and then in membrane) we performed a separation membrane-cytosol (Zerial method) (sample: 2-hours induced <a name="o2_4"></a>cells).<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br>
 +
</p>
 +
<h4><b>2.4 - HpNikR purification by Ni-NTA resin</h4><br></b>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/e/e6/41Unisalento.jpg" height="380px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
<br><a name="o2_5"></a>NikR (sample: 2-hours induced cells) can be purified by Ni-NTA resin, which has a high affinity for histidine residues.<br><br>
 +
</p>
 +
<h4><b>2.5 - ICP-AES assay</b><br><br></h4>
 +
<p>
 +
Inductively-Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) is a type of emission spectroscopy that uses the inductively coupled plasma to produce excited atoms and ions that emit electromagnetic radiation at wavelengths characteristic of a particular element. The intensity of this emission is indicative of the concentration of the element within the sample. These are the samples (also here the final volume of each is 100 ul) analyzed, see the Protocols page for Incubation protocol:
 +
</p>
 +
<ol>
 +
<li>100 ul Incubation buffer</li>
 +
<li>1,5 ul Nickel sulfate + 98,5 ul Incubation buffer</li>
 +
<li>1,2 ul (1 ug) NikR + 0,3 ul Nickel sulfate + 98,5 ul Incubation buffer</li>
 +
<li>6,1 ul (5 ug) NikR + 1,5 ul Nickel sulfate + 92,4 ul Incubation buffer</li>
 +
<li>12,2 ul (10 ug) NikR + 3 ul Nickel sulfate + 84,8 ul Incubation buffer</li>
 +
<li>Sephadex resin after incubation with the sample n.4</li>
 +
</ol>
 +
<br>
 +
<br>
 +
<p style="margin:16px,0,16px,0">
 +
<img src="https://static.igem.org/mediawiki/parts/4/45/Icp3Unisalento.jpg" height="250px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
<img src="https://static.igem.org/mediawiki/parts/6/6d/Icp2Unisalento.jpg" height="300px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
<br><a name="o2_6"></a>Although it remains difficult to identify accurately the binding NikR-nickel stoichiometry we can say, however, that between the two variables exists a direct relationship.<br><br><br>
 +
</p>
 +
<h4><b>2.6 - ATR-FTIR spectroscopy assay</b><br><br></h4>
 +
<p>
 +
<img src="https://static.igem.org/mediawiki/parts/f/f5/ATRUnisalento.jpg" height="250px" alt="" align="center" style="margin-left:50px;margin-bottom:25px;margin-top:0px"/>
 +
<br>To complete our analysis on the protein, we studied the conformational changes which HpNikR goes under in the bond with Ni2+ ions through Attentuated Total Reflectance Fourier Transform Infrared Spectroscopy (ATR-FTIR). With this technique it is possible to acquire the infrared absorption spectra of our control (Apo-HpNikR) and of our protein treated with NiSO4 (complex HpNikR:Ni), so as to obtain the IR differential spectrum. By means of these it will be possible to highlight how some spectrum peaks suffer changes in infrared absorption due to changes in protein conformation induced by the nickel binding.<br>
 +
<img src="https://static.igem.org/mediawiki/parts/f/f8/Y3Unisalento.jpg" height="250px" alt="" align="center" style="margin-left:100px;margin-bottom:25px;margin-top:0px"/>
 +
<br>Our hypothesis: The analysis of the spectrum of the native protein shows two peaks at values ​​of wave number of 1261 cm-1 and 800 cm-1; these peaks are absent in the protein in the presence of nickel and everything is confirmed by the differential spectrum. <a name="o2_7"></a>These peaks could be assigned to a tyrosine residue that due to the interaction with nickel undergoes a deprotonation of the hydroxyl functional group. So it can be assumed that the bond to the metal induces a change necessary to the regulator NikR for the interaction with DNA.<br><br><br><br>
 +
</p>
 +
<h4><b>2.7 - Raman spectroscopy assay</h4></b><br><br>
 +
<img src="https://static.igem.org/mediawiki/2013/4/47/TotalenoNiUnisalento.png" width="100%"/><br>
 +
<img src="https://static.igem.org/mediawiki/2013/3/31/TotaleNiUnisalento.png" width="100%"/>
 +
<p>
 +
<br><br>Raman spectroscopy is a spectroscopic method based on the interaction between electromagnetic radiation used to observe vibrational, rotational, and other low-frequency modes in a system.<br>With Raman spectroscopy analysis it is possible to state that in the 1000-1600 cm-1 region the difference in signal comes from amide groups (I, II e III). Instead, to high frequences, in the 2900-3200 cm-1 region the difference in signal comes from the stretching of the CH2 and CH3 bonds.<br><a name="o2_8"></a>Conformational deformations could be seen in the amide regions, but further investigations are necessary.<br><br><br><br>
 +
</p>
 +
<h4><b>2.8 - CryoTEM microscopy of purified HpNikR</b><br><br></h4>
 +
<p>
 +
<img src="https://static.igem.org/mediawiki/2013/6/6a/CryobigUnisalento.jpg" height="380px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
<img src="https://static.igem.org/mediawiki/2013/4/46/TEMzoomUnisalento.png" height="250px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
<br>The images above shown are for explicative use only. For a full resolution image click <a href="https://static.igem.org/mediawiki/2013/f/f7/CryoTEMHpNikR_HQ.tif">here</a><br>The high quality of the CryoTEM image displays:<br>
 +
<ul>
 +
<li> We made a correct sample preparation</li>
 +
<li> We set up correct set of experimental and instrumental conditions</li>
 +
<li> There is high probability that the image is relative to purified HpNikR protein. Assuming that ribosomal particles, whose molecular weight is around 200 kDa, have a diameter around 20 nm, the particle of diameter of around 1-2 nm which can be seen may coincide with a particle of MW around 20 kDa. HpNikR MW is around 17 kDa.</li>
 +
</ul>
 +
<a name="o3"></a>
 +
<br>
 +
<br>
 +
<br>
 +
<a name="o3_1"></a>
 +
</p>
 +
</section>
 +
<section id="intro">
 +
<h3>3 - Nickel responsive promoters characterization data<br><br></h3>
 +
<h4><b>3.1 - PCR amplification of the promoters</b><br><br></h4>
 +
<p>
 +
We obtained the promoters from PCR with the following primers:<br><br>
 +
</p>
 +
<p style="text-align:center">
 +
IntergenicaFor: gtttcttcgaattcgcggccgcttctagag<b>TGAGAAAAATCCTTTTTTG</b><br>pnikrev: gtttcttcctgcagcggccgctactagta<b>TGAGAAAAATCCTTTTTTG</b><br>pnikfor: gtttcttcgaattcgcggccgcttctagag<b>AATTCAAACGCTCTTATG</b><br>pexbfor: gtttcttcgaattcgcggccgcttctagag<b>ACTGGATTTAAATGGTTG</b><br>pexbrev:gtttcttcctgcagcggccgctactagta<b>GCACCCTATAAGAAGGCATC</b><br><br><br>
 +
<img src="https://static.igem.org/mediawiki/2013/6/69/PCRpromUnisalento.jpg" height="350px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
 +
</p>
 +
<h4><b>Fluorescence Decay assays</b><br><br></h4>
 +
<p>
 +
We set up these experiments to evaluate the shutdown of the fluorescence signal, through a series of measurements conducted at fluorometer. We added a fixed quantity of IPTG and nickel to BL21 cells transformed with the plasmid containing this part, and exploited the ability of Holo-NikR to bind the pnikR and the double divergent promoter, thus repressing the transcription of GFP. (Nickel and IPTG added per flask: 0.3 ul from stock 10 ug / ul; 5 ul 1M)<br><br><br><a name="o3_2"></a>
 +
<img src="https://static.igem.org/mediawiki/parts/4/43/Beute1Unisalento.jpg" height="250px" alt="" align="center" style="margin-left:25px;margin-bottom:25px;margin-top:0px"/>
 +
</p>
 +
<h4><b>3.2 - pnikR</b><br><br></h4>
 +
<p>
 +
To characterize this part we used <a href="http://parts.igem.org/Part:BBa_K1151036">BBa_K1151036</a>. These data shows the ability of HpNikR to regulate pnikR, regulating GFP expression.<br><br>
 +
</p>
 +
<img src="https://static.igem.org/mediawiki/parts/9/91/1036.2Unisalento.jpg" widht="120px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
 +
<img src="https://static.igem.org/mediawiki/parts/2/2e/DecayasUnisalento.jpg" height="300px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
 +
<br>
 +
<img src="https://static.igem.org/mediawiki/parts/7/78/1036.3Unisalento.jpg" widht="120px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/><a name="o3_3"></a>
 +
<img src="https://static.igem.org/mediawiki/parts/a/a2/Gfp2Unisalento.jpg" height="300px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
 +
<h4><b>3.3 - Double divergent promoter pnikR-pexbB</b><br><br></h4>
 +
<p>
 +
To characterize this part we used <a href="http://parts.igem.org/Part:BBa_K1151038">BBa_K1151038</a>. These data shows the ability of HpNikR to bind to the divergent promoter, with GFP cds cloned downstream of pexbB (ExbB promoter).<br>
</p><br>
</p><br>
-
 
+
<img src="https://static.igem.org/mediawiki/parts/4/44/1038.2Unisalento.jpg" widht="120px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
-
<p><b>NikR purification by Ni-NTA resin</b></p><br>
+
<img src="https://static.igem.org/mediawiki/parts/c/cd/Gfp3Unisalento.jpg" height="300px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
-
Foto: 41
+
<img src="https://static.igem.org/mediawiki/parts/1/11/1038.1Unisalento.jpg" widht="120px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
-
NikR (sample: 2-hours induced cells) can be purified by Ni-NTA resin, which has a high affinity for histidine residues.
+
<img src="https://static.igem.org/mediawiki/parts/4/49/Gfp4Unisalento.jpg" height="300px" alt="" align="center" style="margin-left:70px;margin-bottom:25px;margin-top:0px"/>
-
 
+
<p>
-
<p><b>NikR incubation with nickel sulfate and Sephadex molecular exclusion chromatography</b></p><br>
+
All the graphs show the difference between the 3 control samples (LB, LB + Ni2+, LB + IPTG) and the Ni-IPTG incubated sample regarding variations in time-dependent fluorescence signal. The expression of the repressor, HpNikR (<a href="http://parts.igem.org/Part:BBa_K1151000">BBa_K1151000</a>), under the control of a pLac promoter, has effects on the fluorescence level of GFP only in the cultures incubated with nickel. The response of repression of GFP is found in both the constructs (<a href=”http://parts.igem.org/Part:BBa_K1151036”>BBa_K1151036</a> and <a href=”http://parts.igem.org/Part:BBa_K1151038”>BBa_K1151038</a>) with HpNiKR responsive promoters and it is quite clear despite the long half-life of GFP. The proof showed the correct operation of the Biobricks, in particular the good functionality of the repression mechanism, nickel-dependent, operated by NikR on the two promoters, that composed a divergent intergenic region of <i>Helicobacter pylori</i>, pnikR and pexbB. Measurements were made, with a Tecan Infinite 200 PRO Multimode Reader, at the two typical wavelenghts of GFP in order to have a complete and secure framework of the experiments.
-
Foto: resina
+
</p>
-
We therefore decided to study the NikR protein: first, we focused on its characteristic to bind nickel. We have developed a protocol of incubation of the protein with nickel sulfate (stock: 10 ug/ul), in presence of an Incubation buffer (20 mM Tris pH 7,6, 100 mM NaCl). These are the samples we tested (each has a final volume of 100 ul):
+
</section>
-
1. 1,2 ul (1 ug) NikR + 0,3 ul Nickel sulfate + 98,5 ul Incubation buffer
+
</div>
-
2. 6,1 ul (5 ug) NikR + 1,5 ul Nickel sulfate + 92,4 ul Incubation buffer
+
</div>
-
3. 12,2 ul (10 ug) NikR + 3 ul Nickel sulfate + 84,8 ul Incubation buffer
+
</div>
-
The samples were put on wheel at 4°C overnight.
+
-
In order to eliminate the nickel eccess we proceeded with a molecular exclusion chromatography on Sephadex G-25 resin.
+
-
In this way the protein with the nickel-binding sites saturated will be released first from the column, collecting the eluate easily. The nickel in excess will remain trapped in the pores of the resin.
+
-
 
+
-
<p><b>ICP-AES assay</b></p><br>
+
-
Foto: machinery
+
-
Inductively-Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) is a type of emission spectroscopy that uses the inductively coupled plasma to produce excited atoms and ions that emit electromagnetic radiation at wavelengths characteristic of a particular element. The intensity of this emission is indicative of the concentration of the element within the sample. These are the samples (also here the final volume of each is 100 ul) that we have analyzed:
+
-
1. 100 ul Incubation buffer
+
-
2. 1,5 ul Nickel sulfate + 98,5 ul Incubation buffer
+
-
3. 1,2 ul (1 ug) NikR + 0,3 ul Nickel sulfate + 98,5 ul Incubation buffer
+
-
4. 6,1 ul (5 ug) NikR + 1,5 ul Nickel sulfate + 92,4 ul Incubation buffer
+
-
5. 12,2 ul (10 ug) NikR + 3 ul Nickel sulfate + 84,8 ul Incubation buffer
+
-
6. Sephadex resin after incubation with the sample n.4
+
-
Results:
+
-
Foto: tabella1, icp2, icp3
+
-
Discussion:
+
-
Although it remains difficult to identify accurately the binding NikR-nickel stoichiometry: we can say, however, that between the two variables exists a direct relationship.
+
-
 
+
-
<p><b>ATR-FTIR assay</b></p><br>
+
-
Foto: ATR
+
-
To complete our analysis on the protein, we studied the conformational changes which HpNikR goes against in the bond with Ni2+ ions through Attentuated Total Reflectance Fourier Transform Infrared Spectroscopy (ATR-FTIR). With this technique it is possible to acquire the infrared absorption spectra of our control (Apo-HpNikR) and of our protein treated with NiSO4 (complex HpNikR:Ni), so as to obtain the IR differential spectrum. By means of these it will be possible to highlight how some spectrum peaks suffer changes in infrared absorption due to changes in protein conformation induced by the nickel binding.
+
-
Our hypothesis:
+
-
foto: y3
+
-
The analysis of the spectrum of the native protein shows two peaks at values ​​of wave number of 1261 cm-1 and 800 cm-1; these peaks are absent in the protein in the presence of nickel and everything is confirmed by the differential spectrum.These peaks could be assigned to a tyrosine residue that due to the interaction with nickel undergoes a deprotonation of the hydroxyl functional group. So it can be assumed that the bond to the metal induces a change necessary to the regulator NikR for the interaction with DNA.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
<section id="intro">
+
-
<h3>title</h3>
+
-
<p>
+
-
Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Nam liber tempor cum soluta nobis eleifend option congue nihil imperdiet doming id quod mazim placerat facer possim assum. Typi non habent claritatem insitam; est usus legentis in iis qui facit eorum claritatem. Investigationes demonstraverunt lectores legere me lius quod ii legunt saepius. Claritas est etiam processus dynamicus, qui sequitur mutationem consuetudium lectorum. Mirum est notare quam littera gothica, quam nunc putamus parum claram, anteposuerit litterarum formas humanitatis per seacula quarta decima et quinta decima. Eodem modo typi, qui nunc nobis videntur parum clari, fiant sollemnes in futurum.
+
-
</p>
+
-
</section>
+
-
</div>
+
-
</div>
+
-
</div>
+
</div>
</div>
<div class="clear"></div>
<div class="clear"></div>
<!-- ********************* Start Footer *********************************** -->
<!-- ********************* Start Footer *********************************** -->
-
<footer></footer>
+
<footer>
 +
<div id="main_wrap">
 +
<div class="split2_3r" style="width:50%;text-align:right;padding-right:50px">
 +
<img src="https://static.igem.org/mediawiki/2013/f/f9/Unisalento_igem_official.png" width="200px" align="left" style="margin-top:20px;margin-left:-45px">
 +
<h2 style="margin-right:70px;color:#cccccc">Sponsors</h2>
 +
<table style="float:right;background-color:transparent">
 +
<tr>
 +
<td><a href="http://www.mps.it/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/5/56/Unisalento_sponsor_mps_small.png" width="45px" align="center"/></a></td>
 +
<td><a href="http://www.mathworks.it/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/1/1f/Unisalento_sponsor_mathworks_small.png" width="45px" align="center"/></a></td>
 +
<td><a href="http://www.unisalentostore.it/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/4/41/Unisalento_sponsor_unisalentostore_small.png" height="45px" align="right"/></a></td>
 +
</tr>
 +
<tr>
 +
<td><a href="http://www.idt.com/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/f/f4/Unisalento_sponsor_idt_small.png" width="45px" align="center"/></a></td>
 +
<td><a href="https://www.neb.com/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/2/25/Unisalento_sponsor_neb_small.png" height="45px" align="center"/></a></td>
 +
<td><a href="http://www.dasitsciences.it/" style="background: none"><img src="https://static.igem.org/mediawiki/2013/4/44/Unisalento_sponsor_dasit_small.png" width="45px" align="right"/></a></td>
 +
</tr>
 +
</table>
 +
</div>
 +
<div class="split2l" style="width:30%;text-align:left;margin-left:50px">
 +
<h2 style="margin-left:40px;color:#cccccc">Contacts</h2>
 +
<table style="float:left;background-color:transparent">
 +
<tr>
 +
<td><a href="https://www.facebook.com/IgemUnisalento2013" style="background: none"><img src="https://static.igem.org/mediawiki/2013/a/ac/Unisalento_facebook_small.png" width="35px" align="left"/></a></td>
 +
<td><font style="font-size:15px;color:#cccccc">Facebook</font></td>
 +
</tr>
 +
<tr>
 +
<td><a href="https://www.twitter.com/iGEM_UniSalento" style="background: none"><img src="https://static.igem.org/mediawiki/2013/b/b7/Unisalento_twitter_small.png" width="35px" align="left"/></a></td>
 +
<td><font style="font-size:15px;color:#cccccc">Twitter</font></td>
 +
</tr>
 +
<tr>
 +
<td><a href="https://plus.google.com/u/0/108724165022727316894" style="background: none"><img src="https://static.igem.org/mediawiki/2013/d/d7/Unisalento_google_small.png" width="35px" align="left"/></a></td>
 +
<td><font style="font-size:15px;color:#cccccc">Google+</font></td>
 +
</tr>
 +
</table>
 +
<br><br><br><br>
 +
<p style="margin-top:20px">
 +
<font style="font-size:15px">
 +
E-mail:
 +
</font>
 +
<a href="mailto:igem.unisalento@gmail.com" style="color:#cccccc;background:none;font-size: 15px">
 +
igem.unisalento@gmail.com
 +
</a>
 +
<br>
 +
</p>
 +
</div>
 +
<div class="clear"></div>
 +
<div class="nosplit">
 +
<p style="text-align:center;color:#cccccc">
 +
<br><br>Design by Mattia Corvaglia - <a href="http://www.mattiacorvaglia.com" style="color:#cccccc">www.mattiacorvaglia.com</a> - Visitors:
 +
<!-- hitwebcounter Code START -->
 +
<a href="http://www.hitwebcounter.com/" target="_blank">
 +
<img src="http://hitwebcounter.com/counter/counter.php?page=5095130&style=0008&nbdigits=5&type=page&initCount=0" title="URLS counter" Alt="URLS counter" border="0" >
 +
</a><br/>
 +
<!--<a href="http://www.hitwebcounter.com/" title="Free Counters" target="_blank" style="font-family: sans-serif, Arial, Helvetica; font-size: 9px; color: #9F9F97; text-decoration: none ;">
 +
<strong>Free Counters</strong>
 +
</a>-->
 +
</p>
 +
</div>
 +
</div>
 +
</footer>
<!-- ********************* End Footer ************************************* -->
<!-- ********************* End Footer ************************************* -->
<!-- ********************* Start Button "Back-to-top" *********************************** -->
<!-- ********************* Start Button "Back-to-top" *********************************** -->
<p id="back-top">
<p id="back-top">
-
<a href="#top"><span></span>Back to Top</a>
+
<a href="#top"><span></span>Back to Top</a>
</p>
</p>
<!-- ********************* End Button "Back-to-top" *********************************** -->
<!-- ********************* End Button "Back-to-top" *********************************** -->
</body>
</body>
</html>
</html>

Latest revision as of 15:51, 4 October 2013


Experimental data and results



1 - Submitted parts agarose gel analysis


Here you can find a PCR and/or a restriction analysis of these parts: BBa_K1151001, BBa_K1151005, BBa_K1151009, BBa_K1151010, BBa_K1151011, BBa_K1151036, BBa_K1151038, made to evaluate their identity.
The molecular weight of these parts has been evaluated with the Invitrogen 1kb DNA Ladder (15615-016)

BBa_K1151001

The K1151001 digestion with EcoRI and PstI displays a profile confirming its molecular weight.





The K1151001 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.







BBa_K1151005

The K1151005 digestion with EcoRI and PstI displays a profile confirming its molecular weight.






The K1151005 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.








BBa_K1151009

The K1151009 digestion with EcoRI and PstI displays a profile confirming its molecular weight.









The K1151009 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.







BBa_K1151010

The K1151010 digestion with EcoRI and PstI displays a profile confirming its molecular weight.









The K1151010 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.








BBa_K1151011

The K1151011 digestion with EcoRI and PstI displays a profile confirming its molecular weight.






The K1151011 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.





BBa_K1151036

The K1151036 PCR with VF2 (BBa_BBa_G00100) and VR (BBa_BBa_G00101) displays a profile confirming its molecular weight.









BBa_K1151038

The K1151038 digestion with EcoRI displays a profile confirming its molecular weight.










2 - HpNikR characterization data


We received this part by Dr. Alberto Danielli, a researcher in molecular biology at the Department of Pharmacology and Biotechnology at the University of Bologna. He sent us the gene encoding HpNikR (from the genome of H. pylori G27) inserted into a pET-15b plasmid.
For studying HpNikR, submitted as BBa_K1151000, we proceeded with the following workflow. Go to the Protocols page to see our experimental procedures.


2.1 - HpNikR PCR

This part was amplified by PCR from the plasmid pETNikR.
Primers used (including Biobrick Prefix and Suffix, lowercase):
nikRFor:
gtttcttcgaattcgcggccgcttctagATGGATACACCCAATAAAGACG
nikRRev:
gtttcttcctgcagcggccgctactagtattattaCTATTCATTGTGTTCAAAG








2.2 - HpNikR expression using BL21(DE3) cells

First we made ​​competent BL21 cells and we transformed it with the plasmid containing HpNikR. We then proceeded with the normal protocol of induction with IPTG for a time of 1, 2 and 4 hours.











2.3 - Cytosol/membrane separation by Zerial method

To confirm that NikR is a cytosolic protein (not expressed in multivesicular bodies, and then in membrane) we performed a separation membrane-cytosol (Zerial method) (sample: 2-hours induced cells).














2.4 - HpNikR purification by Ni-NTA resin



NikR (sample: 2-hours induced cells) can be purified by Ni-NTA resin, which has a high affinity for histidine residues.

2.5 - ICP-AES assay

Inductively-Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) is a type of emission spectroscopy that uses the inductively coupled plasma to produce excited atoms and ions that emit electromagnetic radiation at wavelengths characteristic of a particular element. The intensity of this emission is indicative of the concentration of the element within the sample. These are the samples (also here the final volume of each is 100 ul) analyzed, see the Protocols page for Incubation protocol:

  1. 100 ul Incubation buffer
  2. 1,5 ul Nickel sulfate + 98,5 ul Incubation buffer
  3. 1,2 ul (1 ug) NikR + 0,3 ul Nickel sulfate + 98,5 ul Incubation buffer
  4. 6,1 ul (5 ug) NikR + 1,5 ul Nickel sulfate + 92,4 ul Incubation buffer
  5. 12,2 ul (10 ug) NikR + 3 ul Nickel sulfate + 84,8 ul Incubation buffer
  6. Sephadex resin after incubation with the sample n.4



Although it remains difficult to identify accurately the binding NikR-nickel stoichiometry we can say, however, that between the two variables exists a direct relationship.


2.6 - ATR-FTIR spectroscopy assay


To complete our analysis on the protein, we studied the conformational changes which HpNikR goes under in the bond with Ni2+ ions through Attentuated Total Reflectance Fourier Transform Infrared Spectroscopy (ATR-FTIR). With this technique it is possible to acquire the infrared absorption spectra of our control (Apo-HpNikR) and of our protein treated with NiSO4 (complex HpNikR:Ni), so as to obtain the IR differential spectrum. By means of these it will be possible to highlight how some spectrum peaks suffer changes in infrared absorption due to changes in protein conformation induced by the nickel binding.

Our hypothesis: The analysis of the spectrum of the native protein shows two peaks at values ​​of wave number of 1261 cm-1 and 800 cm-1; these peaks are absent in the protein in the presence of nickel and everything is confirmed by the differential spectrum. These peaks could be assigned to a tyrosine residue that due to the interaction with nickel undergoes a deprotonation of the hydroxyl functional group. So it can be assumed that the bond to the metal induces a change necessary to the regulator NikR for the interaction with DNA.



2.7 - Raman spectroscopy assay






Raman spectroscopy is a spectroscopic method based on the interaction between electromagnetic radiation used to observe vibrational, rotational, and other low-frequency modes in a system.
With Raman spectroscopy analysis it is possible to state that in the 1000-1600 cm-1 region the difference in signal comes from amide groups (I, II e III). Instead, to high frequences, in the 2900-3200 cm-1 region the difference in signal comes from the stretching of the CH2 and CH3 bonds.
Conformational deformations could be seen in the amide regions, but further investigations are necessary.



2.8 - CryoTEM microscopy of purified HpNikR


The images above shown are for explicative use only. For a full resolution image click here
The high quality of the CryoTEM image displays:

  • We made a correct sample preparation
  • We set up correct set of experimental and instrumental conditions
  • There is high probability that the image is relative to purified HpNikR protein. Assuming that ribosomal particles, whose molecular weight is around 200 kDa, have a diameter around 20 nm, the particle of diameter of around 1-2 nm which can be seen may coincide with a particle of MW around 20 kDa. HpNikR MW is around 17 kDa.



3 - Nickel responsive promoters characterization data

3.1 - PCR amplification of the promoters

We obtained the promoters from PCR with the following primers:

IntergenicaFor: gtttcttcgaattcgcggccgcttctagagTGAGAAAAATCCTTTTTTG
pnikrev: gtttcttcctgcagcggccgctactagtaTGAGAAAAATCCTTTTTTG
pnikfor: gtttcttcgaattcgcggccgcttctagagAATTCAAACGCTCTTATG
pexbfor: gtttcttcgaattcgcggccgcttctagagACTGGATTTAAATGGTTG
pexbrev:gtttcttcctgcagcggccgctactagtaGCACCCTATAAGAAGGCATC


Fluorescence Decay assays

We set up these experiments to evaluate the shutdown of the fluorescence signal, through a series of measurements conducted at fluorometer. We added a fixed quantity of IPTG and nickel to BL21 cells transformed with the plasmid containing this part, and exploited the ability of Holo-NikR to bind the pnikR and the double divergent promoter, thus repressing the transcription of GFP. (Nickel and IPTG added per flask: 0.3 ul from stock 10 ug / ul; 5 ul 1M)


3.2 - pnikR

To characterize this part we used BBa_K1151036. These data shows the ability of HpNikR to regulate pnikR, regulating GFP expression.


3.3 - Double divergent promoter pnikR-pexbB

To characterize this part we used BBa_K1151038. These data shows the ability of HpNikR to bind to the divergent promoter, with GFP cds cloned downstream of pexbB (ExbB promoter).


All the graphs show the difference between the 3 control samples (LB, LB + Ni2+, LB + IPTG) and the Ni-IPTG incubated sample regarding variations in time-dependent fluorescence signal. The expression of the repressor, HpNikR (BBa_K1151000), under the control of a pLac promoter, has effects on the fluorescence level of GFP only in the cultures incubated with nickel. The response of repression of GFP is found in both the constructs (BBa_K1151036 and BBa_K1151038) with HpNiKR responsive promoters and it is quite clear despite the long half-life of GFP. The proof showed the correct operation of the Biobricks, in particular the good functionality of the repression mechanism, nickel-dependent, operated by NikR on the two promoters, that composed a divergent intergenic region of Helicobacter pylori, pnikR and pexbB. Measurements were made, with a Tecan Infinite 200 PRO Multimode Reader, at the two typical wavelenghts of GFP in order to have a complete and secure framework of the experiments.

Back to Top