"
Team:INSA Toulouse/contenu/lab practice/parts/other parts
From 2013.igem.org
(Difference between revisions)
Mesnageclem (Talk | contribs) |
|||
| (14 intermediate revisions not shown) | |||
| Line 63: | Line 63: | ||
.tablecontent td{padding:0 25px 0 20px;} | .tablecontent td{padding:0 25px 0 20px;} | ||
| - | + | ||
| + | h2.faq { | ||
display:list-item; | display:list-item; | ||
list-style-image : url(https://static.igem.org/mediawiki/2013/8/84/Insa-toulouse2013-listpuce1.png); | list-style-image : url(https://static.igem.org/mediawiki/2013/8/84/Insa-toulouse2013-listpuce1.png); | ||
width:auto; | width:auto; | ||
| - | |||
line-height:24px; | line-height:24px; | ||
background: no-repeat; | background: no-repeat; | ||
border:none; | border:none; | ||
color:#5a6060; | color:#5a6060; | ||
| - | |||
font-weight:400; | font-weight:400; | ||
font-family:'Open Sans'; | font-family:'Open Sans'; | ||
| - | margin:0 0 | + | margin:0 0 90px 80px; |
| - | font-size: | + | font-size:16px; |
} | } | ||
| - | .infos {width:680px; margin:0 | + | .infos {width:680px; margin:0 0 90px 95px; color:#5a6060; font-family:'Open Sans'; font-size:14px; line-height:24px; } |
| Line 122: | Line 121: | ||
<h2 class="title2">PhiC31</h2> | <h2 class="title2">PhiC31</h2> | ||
| - | <p class="texte">PhiC31 is preceded by a riboregulator whose detailed function is described here. </p> | + | <p class="texte">PhiC31 is preceded by a riboregulator whose detailed function is described <a href="https://2013.igem.org/Team:INSA_Toulouse/contenu/project/biological_construction/logic_gates#ancre100">here</a>. </p> |
| - | < | + | |
| + | |||
| + | <h3 class="title3">Description</h3> | ||
| + | <p class="texte"> | ||
Isolated from the bacteriophage PhiC31, the PhiC31 integrase (frequently also written as: ΦC31 integrase) encodes a serine-type recombinase that mediates the sequence-specific recombination between two different attachment sites, called attB and attP, which share a 3 bp central region, where the crossover occurs (Thorpe et al., 2000). Because the two sites recognized by the PhiC31 integrase differ and the recombination event leads to two different sites (attR and attL), PhiC31 based switch is unidirectional and definitive, except if the required excisionase factor is present. Recombination occurs irrespective of whether the substrate is supercoiled or linear, and does not require anything more than the integrase and attB, attP sites . (HELENA M. THORPE AND MARGARET C. M. SMITH, <i>In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvaseyinvertase family</i>, 1998). </p> | Isolated from the bacteriophage PhiC31, the PhiC31 integrase (frequently also written as: ΦC31 integrase) encodes a serine-type recombinase that mediates the sequence-specific recombination between two different attachment sites, called attB and attP, which share a 3 bp central region, where the crossover occurs (Thorpe et al., 2000). Because the two sites recognized by the PhiC31 integrase differ and the recombination event leads to two different sites (attR and attL), PhiC31 based switch is unidirectional and definitive, except if the required excisionase factor is present. Recombination occurs irrespective of whether the substrate is supercoiled or linear, and does not require anything more than the integrase and attB, attP sites . (HELENA M. THORPE AND MARGARET C. M. SMITH, <i>In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvaseyinvertase family</i>, 1998). </p> | ||
| Line 132: | Line 134: | ||
<div class="accordeon"> | <div class="accordeon"> | ||
| - | <h2 class="faq" title="Click to open the FAQ"> Open reading frame : 1842 bp </h2> | + | <h2 class="faq" title="Click to open the FAQ">Open reading frame : 1842 bp</h2> |
<div class="infos"> | <div class="infos"> | ||
| - | + | atgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacgaccgtcagtcgcgcgagcgcgagaattcgagcgcagcaag | |
| - | + | cccagcgacacagcgtagcgccaacgaagacaaggcggccgaccttcagcgcgaagtcgagcgcgacgggggccggttcaggttcgtcg | |
| - | + | ggcatttcagcgaagcgccgggcacgtcggcgttcgggacggcggagcgcccggagttcgaacgcatcctgaacgaatgccgcgccggg | |
| - | + | cggctcaacatgatcattgtctatgacgtgtcgcgcttctcgcgcctgaaggtcatggacgcgattccgattgtctcggaattgctcgccctggg | |
| - | + | cgtgacgattgtttccactcaggaaggcgtcttccggcagggaaacgtcatggacctgattcacctgattatgcggctcgacgcgtcgcacaaa | |
| - | + | gaatcttcgctgaagtcggcgaagattctcgacacgaagaaccttcagcgcgaattgggcgggtacgtcggcgggaaggcgccttacggctt | |
| - | + | cgagcttgtttcggagacgaaggagatcacgcgcaacggccgaatggtcaatgtcgtcatcaacaagcttgcgcactcgaccactccccttacc | |
| - | + | ggacccttcgagttcgagcccgacgtaatccggtggtggtggcgtgagatcaagacgcacaaacaccttcccttcaagccgggcagtcaagcc | |
| - | + | gccattcacccgggcagcatcacggggctttgtaagcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagaccg | |
| - | + | cttcaagcgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggcttcgccgctgaggtgatctacaagaagaagcc | |
| - | + | ggacggcacgccgaccacgaagattgagggttaccgcattcagcgcgacccgatcacgctccggccggtcgagcttgattgcggaccgatcat | |
| - | + | cgagcccgctgagtggtatgagcttcaggcgtggttggacggcagggggcgcggcaaggggctttcccgggggcaagccattctgtccgcca | |
| - | + | tggacaagctgtactgcgagtgtggcgccgtcatgacttcgaagcgcggggaagaatcgatcaaggactcttaccgctgccgtcgccggaagg | |
| - | + | tggtcgacccgtccgcacctgggcagcacgaaggcacgtgcaacgtcagcatggcggcactcgacaagttcgttgcggaacgcatcttcaacaa | |
| - | + | gatcaggcacgccgaaggcgacgaagagacgttggcgcttctgtgggaagccgcccgacgcttcggcaagctcactgaggcgcctgagaaga | |
| - | + | gcggcgaacgggcgaaccttgttgcggagcgcgccgacgccctgaacgcccttgaagagctgtacgaagaccgcgcggcaggcgcgtacga | |
| - | + | cggacccgttggcaggaagcacttccggaagcaacaggcagcgctgacgctccggcagcaaggggcggaagagcggcttgccgaacttgaa | |
| - | + | gccgccgaagccccgaagcttccccttgaccaatggttccccgaagacgccgacgctgacccgaccggccctaagtcgtggtgggggcgcgcg | |
| - | + | tcagtagacgacaagcgcgtgttcgtcgggctcttcgtagacaagatcgttgtcacgaagtcgactacgggcagggggcagggaacgcccatcg | |
| - | + | agaagcgcgcttcgatcacgtgggcgaagccgccgaccgacgacgacgaagacgacgcccaggacggcacggaagacgtagcggcgtag | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
</div> | </div> | ||
</div> | </div> | ||
| - | < | + | <h2 class="title2">Tp901.1</h2> |
| + | <p class="texte"> | ||
The construction containing Tp901.1 is available on GenBank <a href="http://www.ncbi.nlm.nih.gov/nuccore/KC529324" target “_blank”> there </a>, accession number KC529324. </p> | The construction containing Tp901.1 is available on GenBank <a href="http://www.ncbi.nlm.nih.gov/nuccore/KC529324" target “_blank”> there </a>, accession number KC529324. </p> | ||
| - | < | + | |
| + | |||
| + | <h3 class="title3">Description</h3> | ||
| + | <p class="texte"> | ||
The site-specific recombination system of temperate lactococcal bacteriophage TP901-1 integrase mediates site-specific recombination system. Originally from temperate lactoccocal bacteriophage TP901-1, this is a serine-type integrase able to invert, integrate or excise a DNA fragment according to the position and orientation of its specific recognition sites, attB and attP. This process is directional and definitive because of the transformation of attB and attP into attL and attR during recombination. </p> | The site-specific recombination system of temperate lactococcal bacteriophage TP901-1 integrase mediates site-specific recombination system. Originally from temperate lactoccocal bacteriophage TP901-1, this is a serine-type integrase able to invert, integrate or excise a DNA fragment according to the position and orientation of its specific recognition sites, attB and attP. This process is directional and definitive because of the transformation of attB and attP into attL and attR during recombination. </p> | ||
| Line 179: | Line 176: | ||
| - | < | + | |
| + | <div class="accordeon"> | ||
| + | <h2 class="faq" title="Click to open the FAQ">Open Reading Frame : 1527 bp</h2> | ||
| + | <div class="infos"> | ||
atgaaac atcatcacca | atgaaac atcatcacca | ||
tcaccaccag gccggcacta agaaagtagc aatctataca cgagtatcca ctactaacca | tcaccaccag gccggcacta agaaagtagc aatctataca cgagtatcca ctactaacca | ||
| Line 206: | Line 206: | ||
taataaaaag aaaatcgtca acaaccttgt atcaaaggtt gatgttactg ctgataatgt | taataaaaag aaaatcgtca acaaccttgt atcaaaggtt gatgttactg ctgataatgt | ||
agatatcata tttaaattcc aactcgctac cggtgctgct aaggacgaaa actacgctct | agatatcata tttaaattcc aactcgctac cggtgctgct aaggacgaaa actacgctct | ||
| - | ggctgcttaa</ | + | ggctgcttaa |
| + | </div> | ||
| + | </div> | ||
<div class="clear"></div> | <div class="clear"></div> | ||
Latest revision as of 01:23, 5 October 2013
Parts
Other Parts not Submitted
For two of our recombinases, we asked Piro Siuti (for PhiC31) and Jérome Bonnet (for Tp901.1) to send us their samples. Information on the parts they sent is available here.
PhiC31
PhiC31 is preceded by a riboregulator whose detailed function is described here.
Description
Isolated from the bacteriophage PhiC31, the PhiC31 integrase (frequently also written as: ΦC31 integrase) encodes a serine-type recombinase that mediates the sequence-specific recombination between two different attachment sites, called attB and attP, which share a 3 bp central region, where the crossover occurs (Thorpe et al., 2000). Because the two sites recognized by the PhiC31 integrase differ and the recombination event leads to two different sites (attR and attL), PhiC31 based switch is unidirectional and definitive, except if the required excisionase factor is present. Recombination occurs irrespective of whether the substrate is supercoiled or linear, and does not require anything more than the integrase and attB, attP sites . (HELENA M. THORPE AND MARGARET C. M. SMITH, In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvaseyinvertase family, 1998).
The recombination sites can be designed differently (position – orientation) in order to obtain a DNA 180° inversion or an integration of the desired DNA sequence. The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.
Open reading frame : 1842 bp
atgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacgaccgtcagtcgcgcgagcgcgagaattcgagcgcagcaag
cccagcgacacagcgtagcgccaacgaagacaaggcggccgaccttcagcgcgaagtcgagcgcgacgggggccggttcaggttcgtcg
ggcatttcagcgaagcgccgggcacgtcggcgttcgggacggcggagcgcccggagttcgaacgcatcctgaacgaatgccgcgccggg
cggctcaacatgatcattgtctatgacgtgtcgcgcttctcgcgcctgaaggtcatggacgcgattccgattgtctcggaattgctcgccctggg
cgtgacgattgtttccactcaggaaggcgtcttccggcagggaaacgtcatggacctgattcacctgattatgcggctcgacgcgtcgcacaaa
gaatcttcgctgaagtcggcgaagattctcgacacgaagaaccttcagcgcgaattgggcgggtacgtcggcgggaaggcgccttacggctt
cgagcttgtttcggagacgaaggagatcacgcgcaacggccgaatggtcaatgtcgtcatcaacaagcttgcgcactcgaccactccccttacc
ggacccttcgagttcgagcccgacgtaatccggtggtggtggcgtgagatcaagacgcacaaacaccttcccttcaagccgggcagtcaagcc
gccattcacccgggcagcatcacggggctttgtaagcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagaccg
cttcaagcgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggcttcgccgctgaggtgatctacaagaagaagcc
ggacggcacgccgaccacgaagattgagggttaccgcattcagcgcgacccgatcacgctccggccggtcgagcttgattgcggaccgatcat
cgagcccgctgagtggtatgagcttcaggcgtggttggacggcagggggcgcggcaaggggctttcccgggggcaagccattctgtccgcca
tggacaagctgtactgcgagtgtggcgccgtcatgacttcgaagcgcggggaagaatcgatcaaggactcttaccgctgccgtcgccggaagg
tggtcgacccgtccgcacctgggcagcacgaaggcacgtgcaacgtcagcatggcggcactcgacaagttcgttgcggaacgcatcttcaacaa
gatcaggcacgccgaaggcgacgaagagacgttggcgcttctgtgggaagccgcccgacgcttcggcaagctcactgaggcgcctgagaaga
gcggcgaacgggcgaaccttgttgcggagcgcgccgacgccctgaacgcccttgaagagctgtacgaagaccgcgcggcaggcgcgtacga
cggacccgttggcaggaagcacttccggaagcaacaggcagcgctgacgctccggcagcaaggggcggaagagcggcttgccgaacttgaa
gccgccgaagccccgaagcttccccttgaccaatggttccccgaagacgccgacgctgacccgaccggccctaagtcgtggtgggggcgcgcg
tcagtagacgacaagcgcgtgttcgtcgggctcttcgtagacaagatcgttgtcacgaagtcgactacgggcagggggcagggaacgcccatcg
agaagcgcgcttcgatcacgtgggcgaagccgccgaccgacgacgacgaagacgacgcccaggacggcacggaagacgtagcggcgtag
Tp901.1
The construction containing Tp901.1 is available on GenBank there , accession number KC529324.
Description
The site-specific recombination system of temperate lactococcal bacteriophage TP901-1 integrase mediates site-specific recombination system. Originally from temperate lactoccocal bacteriophage TP901-1, this is a serine-type integrase able to invert, integrate or excise a DNA fragment according to the position and orientation of its specific recognition sites, attB and attP. This process is directional and definitive because of the transformation of attB and attP into attL and attR during recombination.
The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.
Open Reading Frame : 1527 bp
atgaaac atcatcacca
tcaccaccag gccggcacta agaaagtagc aatctataca cgagtatcca ctactaacca
agcagaggaa ggcttctcaa ttgatgagca aattgaccgt ttaacaaaat atgctgaagc
aatggggtgg caagtatctg atacttatac tgatgctggt ttttcagggg ccaaacttga
acgcccagca atgcaaagat taatcaacga tatcgagaat aaagcttttg atacagttct
tgtatataag ctagaccgcc tttcacgtag tgtaagagat actctttatc ttgttaagga
tgtgttcaca aaaaataaaa tagactttat ctcgcttaat gaaagtattg atacttcttc
tgctatgggt agcttgtttc tcactattct ttctgcaatt aatgagtttg aaagagagaa
tataaaagaa cgcatgacta tgggtaaact agggcgagcg aaatctggta agtctatgat
gtggactaag acagcttttg ggtattacca caacagaaag acaggtatat tagaaattgt
tcctttacaa gctacaatag ttgaacaaat attcactgat tatttatcag gaatatcact
tacaaaatta agagataaac tcaatgaatc tggacacatc ggtaaagata taccgtggtc
ttatcgtacc ctaagacaaa cacttgataa tccagtttac tgtggttata tcaaatttaa
ggacagccta tttgaaggta tgcacaaacc aattatccct tatgagactt atttaaaagt
tcaaaaagag ctagaagaaa gacaacagca gacttatgaa agaaataaca accctagacc
tttccaagct aaatatatgc tgtcagggat ggcaaggtgc ggttactgtg gagcaccttt
aaaaattgtt cttggccaca aaagaaaaga tggaagccgc actatgaaat atcactgtgc
aaatagattt cctcgaaaaa caaaaggaat tacagtatat aatgacaata aaaagtgtga
ttcaggaact tatgatttaa gtaatttaga aaatactgtt attgacaacc tgattggatt
tcaagaaaat aatgactcct tattgaaaat tatcaatggc aacaaccaac ctattcttga
tacttcgtca tttaaaaagc aaatttcaca gatcgataaa aaaatacaaa agaactctga
tttgtaccta aatgatttta tcactatgga tgagttgaaa gatcgtactg attcccttca
ggctgagaaa aagctgctta aagctaagat tagcgaaaat aaatttaatg actctactga
tgtttttgag ttagttaaaa ctcagttggg ctcaattccg attaatgaac tatcatatga
taataaaaag aaaatcgtca acaaccttgt atcaaaggtt gatgttactg ctgataatgt
agatatcata tttaaattcc aactcgctac cggtgctgct aaggacgaaa actacgctct
ggctgcttaa
