"
Team:INSA Toulouse/contenu/lab practice/parts/other parts
From 2013.igem.org
Mesnageclem (Talk | contribs) |
|||
| (5 intermediate revisions not shown) | |||
| Line 75: | Line 75: | ||
font-family:'Open Sans'; | font-family:'Open Sans'; | ||
margin:0 0 90px 80px; | margin:0 0 90px 80px; | ||
| - | font-size: | + | font-size:16px; |
} | } | ||
| Line 121: | Line 121: | ||
<h2 class="title2">PhiC31</h2> | <h2 class="title2">PhiC31</h2> | ||
| - | <p class="texte">PhiC31 is preceded by a riboregulator whose detailed function is described here. </p> | + | <p class="texte">PhiC31 is preceded by a riboregulator whose detailed function is described <a href="https://2013.igem.org/Team:INSA_Toulouse/contenu/project/biological_construction/logic_gates#ancre100">here</a>. </p> |
| Line 136: | Line 136: | ||
<h2 class="faq" title="Click to open the FAQ">Open reading frame : 1842 bp</h2> | <h2 class="faq" title="Click to open the FAQ">Open reading frame : 1842 bp</h2> | ||
<div class="infos"> | <div class="infos"> | ||
| - | + | atgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacgaccgtcagtcgcgcgagcgcgagaattcgagcgcagcaag | |
| - | + | cccagcgacacagcgtagcgccaacgaagacaaggcggccgaccttcagcgcgaagtcgagcgcgacgggggccggttcaggttcgtcg | |
| - | + | ggcatttcagcgaagcgccgggcacgtcggcgttcgggacggcggagcgcccggagttcgaacgcatcctgaacgaatgccgcgccggg | |
| - | + | cggctcaacatgatcattgtctatgacgtgtcgcgcttctcgcgcctgaaggtcatggacgcgattccgattgtctcggaattgctcgccctggg | |
| - | + | cgtgacgattgtttccactcaggaaggcgtcttccggcagggaaacgtcatggacctgattcacctgattatgcggctcgacgcgtcgcacaaa | |
| - | + | gaatcttcgctgaagtcggcgaagattctcgacacgaagaaccttcagcgcgaattgggcgggtacgtcggcgggaaggcgccttacggctt | |
| - | + | cgagcttgtttcggagacgaaggagatcacgcgcaacggccgaatggtcaatgtcgtcatcaacaagcttgcgcactcgaccactccccttacc | |
| - | + | ggacccttcgagttcgagcccgacgtaatccggtggtggtggcgtgagatcaagacgcacaaacaccttcccttcaagccgggcagtcaagcc | |
| - | + | gccattcacccgggcagcatcacggggctttgtaagcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagaccg | |
| - | + | cttcaagcgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggcttcgccgctgaggtgatctacaagaagaagcc | |
| - | + | ggacggcacgccgaccacgaagattgagggttaccgcattcagcgcgacccgatcacgctccggccggtcgagcttgattgcggaccgatcat | |
| - | + | cgagcccgctgagtggtatgagcttcaggcgtggttggacggcagggggcgcggcaaggggctttcccgggggcaagccattctgtccgcca | |
| - | + | tggacaagctgtactgcgagtgtggcgccgtcatgacttcgaagcgcggggaagaatcgatcaaggactcttaccgctgccgtcgccggaagg | |
| - | + | tggtcgacccgtccgcacctgggcagcacgaaggcacgtgcaacgtcagcatggcggcactcgacaagttcgttgcggaacgcatcttcaacaa | |
| - | + | gatcaggcacgccgaaggcgacgaagagacgttggcgcttctgtgggaagccgcccgacgcttcggcaagctcactgaggcgcctgagaaga | |
| - | + | gcggcgaacgggcgaaccttgttgcggagcgcgccgacgccctgaacgcccttgaagagctgtacgaagaccgcgcggcaggcgcgtacga | |
| - | + | cggacccgttggcaggaagcacttccggaagcaacaggcagcgctgacgctccggcagcaaggggcggaagagcggcttgccgaacttgaa | |
| - | + | gccgccgaagccccgaagcttccccttgaccaatggttccccgaagacgccgacgctgacccgaccggccctaagtcgtggtgggggcgcgcg | |
| - | + | tcagtagacgacaagcgcgtgttcgtcgggctcttcgtagacaagatcgttgtcacgaagtcgactacgggcagggggcagggaacgcccatcg | |
| - | + | agaagcgcgcttcgatcacgtgggcgaagccgccgaccgacgacgacgaagacgacgcccaggacggcacggaagacgtagcggcgtag | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
</div> | </div> | ||
</div> | </div> | ||
Latest revision as of 01:23, 5 October 2013
Parts
Other Parts not Submitted
For two of our recombinases, we asked Piro Siuti (for PhiC31) and Jérome Bonnet (for Tp901.1) to send us their samples. Information on the parts they sent is available here.
PhiC31
PhiC31 is preceded by a riboregulator whose detailed function is described here.
Description
Isolated from the bacteriophage PhiC31, the PhiC31 integrase (frequently also written as: ΦC31 integrase) encodes a serine-type recombinase that mediates the sequence-specific recombination between two different attachment sites, called attB and attP, which share a 3 bp central region, where the crossover occurs (Thorpe et al., 2000). Because the two sites recognized by the PhiC31 integrase differ and the recombination event leads to two different sites (attR and attL), PhiC31 based switch is unidirectional and definitive, except if the required excisionase factor is present. Recombination occurs irrespective of whether the substrate is supercoiled or linear, and does not require anything more than the integrase and attB, attP sites . (HELENA M. THORPE AND MARGARET C. M. SMITH, In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvaseyinvertase family, 1998).
The recombination sites can be designed differently (position – orientation) in order to obtain a DNA 180° inversion or an integration of the desired DNA sequence. The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.
Open reading frame : 1842 bp
Tp901.1
The construction containing Tp901.1 is available on GenBank there , accession number KC529324.
Description
The site-specific recombination system of temperate lactococcal bacteriophage TP901-1 integrase mediates site-specific recombination system. Originally from temperate lactoccocal bacteriophage TP901-1, this is a serine-type integrase able to invert, integrate or excise a DNA fragment according to the position and orientation of its specific recognition sites, attB and attP. This process is directional and definitive because of the transformation of attB and attP into attL and attR during recombination.
The 180° switch permits to design a lot of regulation tools, such as logical gates that can be found on our wiki.
Open Reading Frame : 1527 bp
