Latest revision as of 18:07, 28 October 2013

Our Design

After an extensive research on the biomarkers used for prognosis of Acute Coronary Syndrome (ACS), we elected three that we could work on to somehow make our bacteria detect: IMA, TMAO and BNP.

IMA, which means Ischemia Modified Albumin, was a tricky one. Literature indicated that, although a good marker for ischemia, IMA could be better used as a negative predictor for ACS prognosis. Because of that, we developed a system to use the expression of YFP in E. coli as a warning that IMA is increasing, in which the absence of yellow fluorescence means that everything is still ok. Since IMA is known to have lower capacity to bind cobalt than normal human serum albumin, a clinical test based on the detection of cobalt added to a patient’s blood serum is available; therefore, we decided to incorporate this method in our bacterial system by using a cobalt-inducible promoter, Rcna (BBa_K540001), associated with the YFP translational unit (BBa_E0430). Bacteria carrying this plasmid construction growing in medium containing cobalt should express high levels of YFP, which can be easily detected by fluorimetric methods. However, if we add normal serum, the albumin should bind the cobalt resulting in lower fluorescence. Thus, the presence of IMA in sera from ACS patients could be detected by measuring YFP expression: in the presence of IMA, cobalt remains in its free form and, through the activation of the co-inducible promoter, the bacteria will express YFP.

TMAO is a biomarker that was recently linked to heart diseases, and one that our research literature showed that could activate an inducible bacterial promoter, part of the TorCAD operon. Since this promoter was not deposited in the Parts Registry, we ordered it to be synthesized, with modifications to its structure to enhance its activity [1]. The sequence of the promoter we ordered was:

5’ – CGAACGAATTCGCGGCCGCTTCTAGAGATTCTGTTCATATCTGTTCATATTCCGTTCATCCT

GACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCATACTAGTAGCGGCCGCTGCAG – 3’

We selected RFP as a reporter to detect this biomarker, and thus our construction for this device became the TorCAD promoter we had synthesized followed by the RFP translational unit (BBa_J06702).

Our last target is BNP (Brain Natriuretic Peptide), a major prognostic biomarker for ACS. To detect it, we tried to synthesize a biobrick containing the coding region of NPRA, a receptor capable of detecting BNP and respond unleashing an intracellular cGMP cascade. And to detect the cGMP produced by the receptor, we also ordered the synthesis of another promoter, belonging to PDE5 (phosphodiesterase 5), which is positively regulated by this molecule. Putting it all together, the plan was to create a plasmid containing two constructions: 1) a constitutive promoter associated with the translational unit of NPRA, to make our bacteria detect BNP and respond producing cGMP, and 2) PDE5 promoter associated with the translational unit of another fluorescent protein, like CFP, to make our bacteria produce a signal when the biomarker was detected. However, we were unable to proceed with the detection of BNP, due to the high content of CG pairs on both the NPRA receptor and PDE5 promoter, which rendered their synthesis impossible.

Thus, by inserting all of these inside our Escherichia coli, we’d have in our hands our heart vigilant bacteria, ready to save some lives!

References:

Ansaldi M, Simon G, Lepelletier M, Mejean V (2000). "The TorR high-affinity binding site plays a key role in both torR autoregulation and torCAD operon expression in Escherichia coli." J Bacteriol 2000;182(4);961-6. PMID: 10648521

Our Sponsors

@@ Line 3: / Line 3: @@
 {{Cardbio_barra_home_project}}
 {{Cardbio_barra_project}}
+<html>
+<style>
+#iconP2{
+  background-color:#F83939;
+}
+</style>
+</html>
 =Our Design=

Team:UFMG Brazil/Ourdesign

From 2013.igem.org

Latest revision as of 18:07, 28 October 2013

Our Design