Notebook

Protocols

Plasmid Backbones

This protocol was developed by Tom Knight. Samples of standard Registry plasmid backbones prepared using this method are sent out in the DNA Distribution kits.

Why Linearized Plasmid Backbones?
Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.

The DNA Distribution should come with a set of linearized plasmid backbones: pSB1A3, pSB1C3, pSB1K3.m1, and pSB1T3. The linearized plasmid backbones (25ng/µl at 50µl) should be stored at 4°C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.

Digest
· Enzyme Master Mix for Plasmid Backbone (25µl total, for 6 rxns)
➔ 5 µl NEB Buffer 2
➔ 0.5 µl BSA
➔ 0.5 µl EcoRI-HF
➔ 0.5 µl PstI
➔ 0.5 µl DpnI (Used to digest any template DNA from production)
➔ 18 µl dH20
· Digest Plasmid Backbone
➔ Add 4 µl linearized plasmid backbone (25ng/µl for 100ng total)
➔ Add 4 µl of Enzyme Master Mix
➔ Digest 37C/30 min, heat kill 80C/20 min

Ligation
· Add 2µl of digested plasmid backbone (25 ng)
· Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 µl)
· Add equimolar amount of XbaI PstI digested fragment (< 3 µl)
· Add 1 µl T4 DNA ligase buffer. Note: Do not use quick ligase
· Add 0.5 µl T4 DNA ligase
· Add water to 10 µl
· Ligate 16C/30 min, heat kill 80C/20 min
· Transform with 1-2 µl of product
Note: For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of BBa_J04450 was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.

Bulk Production
The following is the protocol that we used to create the linearized plasmid backbones shipped with the Spring 2011 DNA Distribution. The protocol is in 96 well format, but may be scaled down to suit smaller batches.

PCR mix
Primers

gccgctgcagtccggcaaaaaa,SB-prep-3P-1
atgaattccagaaatcatccttagcg,SB-prep-2Ea

Diluted to 30 pmol/µl
These primers have been tested with pSB1C3, pSB1A3, pSB1K3, and pSB1T3.

Bulk Reaction
· 9.6ml of PCR Supermix High Fidelity
· 67 µl of primer SB-prep-2Eb
· 67 µl of primer SB-prep-3P-1
· 10 µl of template DNA at 10ng/µl (100ng total)
➔ Notes:
a. Do not use a sample of linearized plasmid backbones (PCRed) as a template,
b. The Registry uses plasmid backbones with a BBa_J04450 insert as a template
· Aliquot 100µl per well in 96 well plate

PCR program

1. 95°C/2min
2. 95°C/30s
3. 55°C/30s
4. 68°C/3min
5. Repeat cycle (steps 2 to 4, 37 more times)
6. 68°C/10min

PCR cleanup
Purification of 96 well plates was done through Promega Wizard SV 96 PCR Clean-Up kit and a vacuum manifold. The protocol below follows the manual, with a few changes (in bold), however please see manual for setup instructions.

Single Reaction PCR
PCR mix
· 100 µl PCR Supermix High Fidelity
· 0.7 µl of SB-prep-3P-1
· 0.7 µl of SB-prep-2Ea
· 0.5 µl template DNA at 10 ng/µl
➔ Notes:
a. Do not use a sample of linearized plasmid backbones (PCRed) as a template,
b. The Registry uses BBa_J04450 as a template

PCR program

PCR cleanup
QIAquick PCR Purification
· Add 500 µl Qiagen buffer PB
· Spin through a column twice, discard flow through
· Wash 1x with 700 µl buffer PB
· Wash 2x with 760 µl buffer PE
· Discard liquid, spin dry at 17000g for 3 min
· Elute into a new tube twice with 50 µl of TE (100 µl total)

Quality Control
We recommend QCing constructed linearized plasmid backbones, to test success of PCR, ligation efficiency, and background.

Digest
➔ Digest Master Mix (10rxns)
· 15 µl NEB Buffer 2
· 1.5 µl BSA
· 90 µl dH20
➔ Run Digest
· 4 µl of plasmid backbone (approximately 100 ng)
· 10.5 µl of Digest Master Mix
· 0.5 µl either EcoRI-HF or PstI enzyme (not both!)
· Digest 37°C/30min; 80°C/20 min
· Proceed directly to ligation

Ligation
➔ Ligation Master Mix (10rxns)
· 20 µl T4 DNA ligase buffer
· 5 µl T4 DNA ligase
· 25 µl water
➔ Ligation Test
· Add 5 µl of ligation master mix to digested product
· Ligate 16°C/30min; 80°C/20 min
· Run all 20 µl on a gel
· Compare intensity of the single and double length bands. More efficient ligations will show stronger double length bands than single.

Transformation test
· Transform 1 µl of the diluted final product into highly competent cells
· Control transform 10 pg of pUC19
· Plate on the appropriate antibiotic
· Observe few colonies. Any colonies represent background to the three antibiotic assembly process
· Quantify the effective amount of remaining circular DNA able to transform

Transformation
· 100 µL Competent Cells + 2µL DNA (or more, ok to 15-20 µL)
· Incubate 10 min in ice
· HeatShock 42°C, 1’30
· +900µL LB or SOC (prefer SOC) (complete to 1µL)
· Incubate 45min at 37°C
Then centri. for 3 min at 13000 RPM, discard 900µL of supernatant and retake the pellet. The step is for concentrating the solution we put on petri dishes. It seems to be better for spreading and growing of colonies.
· Spread on a Petri Dish (care with antibiotic resistance)