Team:BYU Provo/Notebook/Cholera - Enzyme/May-June/Period1/Dailylog

Cholera Enzyme

March-April

May-June

July-August

September

Protocols

• Get enzymes
  • Dipersin B - contact previous iGem team (5/1/13)
    • If no response by 5/6/13, we will order gene sequence
  • Subtilisin savinase - order gene sequence (5/3/13) - get genes back by 5/13/13
• Clone enzymes into E. coli -
  • Dispersin B - cloned in by 5/20/13
  • Subtilisin savinase - cloned in by 5/20/13
• Run assays on enzymes
  • AmyA - Run assays and be done with AmyA by 5/13/13
  • Dispersin B - Run assays and be done by 5/29/13
  • Subtilisin savinase - Run assays and be done by 5/29/13
• Gather data/optimize system
  • Start 5/31/13
  • Start mathematical modeling with data by 6/17/13

We also emailed several iGem teams that have used Dispersin B in the past to see if we could get their parts for the dspB gene. If we don't hear back from them by Monday, then we will work with Dr. Grose to have our dspB gene synthesized for us.

We have also had difficulties finding a source to obtain our Subtilisin savinase gene, so we may need to order the Subtilisin savinase gene as well. We emailed Dr. Grose the sequence that we need, as well as possible costs from several companies.

iGem Teams Contacted:
University of British Colombia iGem Contact: ubcigem@gmail.com Parts: BBa_K391006 - just the DspB enzyme BBa_K391007 - Constitutive promoter (J23100) + RBS (B0034)+ Dispersin B (K391006)

Team Lyon-INSA iGem Contact: lyon.biosciences.igem@gmail.com Part: BBa_K802001 - constitutive promoter (Pveg) + dispersin B gene (dspB)

Subtilisin savinase: aa sequence (269 aa; 807 bp) ORIGIN

   	1 aqsvpwgisr vqapaahnrg ltgsgvkvav ldtgisthpd lnirggasfv pgepstqdgn
  	61 ghgthvagti aalnnsigvl gvapsaelya vkvlgasgsg svssiaqgle wagnngmhva
 	121 nlslgspsps atleqavnsa tsrgvlvvaa sgnsgagsis yparyanama vgatdqnnnr
 	181 asfsqygagl divapgvnvq stypgstyas lngtsmatph vagaaalvkq knpswsnvqi
 	241 rnhlkntats lgstnlygsg lvnaeaatr

Pasted from <http://www.ncbi.nlm.nih.gov/protein/P29600.1>

DispersinB: bp sequence (1086 bp) ORIGIN

   	1 aattgttgcg taaaaggcaa ttccatatat ccgcaaaaaa caagtaccaa gcagaccgga
  	61 ttaatgctgg acatcgcccg acatttttat tcacccgagg tgattaaatc ctttattgat
 	121 accatcagcc tttccggcgg taattttctg cacctgcatt tttccgacca tgaaaactat
 	181 gcgatagaaa gccatttact taatcaacgt gcggaaaatg ccgtgcaggg caaagacggt
 	241 atttatatta atccttatac cggaaagcca ttcttgagtt atcggcaact tgacgatatc
 	301 aaagcctatg ctaaggcaaa aggcattgag ttgattcccg aacttgacag cccgaatcac
 	361 atgacggcga tctttaaact ggtgcaaaaa gacagagggg tcaagtacct tcaaggatta
 	421 aaatcacgcc aggtagatga tgaaattgat attactaatg ctgacagtat tacttttatg
 	481 caatctttaa tgagtgaggt tattgatatt tttggcgaca cgagtcagca ttttcatatt
 	541 ggtggcgatg aatttggtta ttctgtggaa agtaatcatg agtttattac gtatgccaat
 	601 aaactatcct actttttaga gaaaaaaggg ttgaaaaccc gaatgtggaa tgacggatta
 	661 attaaaaata cttttgagca aatcaacccg aatattgaaa ttacttattg gagctatgat
 	721 ggcgatacgc aggacaaaaa tgaagctgcc gagcgccgtg atatgcgggt cagtttgccg
 	781 gagttgctgg cgaaaggctt tactgtcctg aactataatt cctattatct ttacattgtt
 	841 ccgaaagctt caccaacctt ctcgcaagat gccgcctttg ccgccaaaga tgttataaaa
 	901 aattgggatc ttggtgtttg ggatggacga aacaccaaaa accgcgtaca aaatactcat
 	961 gaaatagccg gcgcagcatt atcgatctgg ggagaagatg caaaagcgct gaaagacgaa
	1021 acaattcaga aaaacacgaa aagtttattg gaagcggtga ttcataagac gaatggggat
	1081 gagtga

Pasted from <http://www.ncbi.nlm.nih.gov/nuccore/ay228551>

5/3/13

We started new cultures of cholera to grow over the weekend. Cultures were prepared in 4mL of our high salt LB. We also streaked our cholera onto a new plate. Both the plate and the overnight cultures were placed in the 30°C incubator to grow over the weekend.

We heard back from the Lyons, France iGem team about getting part BBa_K802001 from them, however they are on vacation until Monday. They will send us the part as soon as they get back. We emailed them our FedEx shipping number and address. We also checked on the primers that last year's iGem team prepared for the DspB, but they were using a different plasmid vector so we will have to redesign new primers for the part that we are getting so that we can use it in the pet-15B plasmid in order to allow us to easily purify the proteins once we get the gene cloned into E. coli and are producing the enzyme. We will work on designing the new primers this weekend so that we can order them on Monday.

We are also going to research assay methods for our specific enzymes to be able to test the ability of our enzymes to degrade biofilms. On Monday we will go over the different methods we researched and plan which assays we are going to use for our specific enzymes.

We gave the sequence of the Subtilisin savinase gene to Dr. Grose for her to order today. Their turn around time is seven days, then a few extra to mail it to us. We will adjust our goal dates according to when we receive the sequence back.

5/6/13

We talked to Dr. Robison today and were able to get a sample of Bacillus subtilis from his lab. The savinase produced by this bacteria strain is a homolog to the savinase that we were originally looking for. We plated the sample that we got from him and put it in the incubator at 30C to grow the culture. Once the bacteria is grown we can amplify the gene that we want and clone it into the pET15b plasmid to allow us to purify the gene after it is produced, as the pET15b plasmid attaches a His-tag to the protein that causes it to be excreted from the cell and easily isolated and purified.

Primers:
We also designed our primers for AmyA, DspB, and savinase and submitted these to Dr. Grose to be ordered:

DspB forward (BI242):

GGGCATATGAATTGTTGCGTAAAAGGCAATTCCATATAT

DspB reverse (BI243):

CCCGGATCCTCACTCATCCCCATTCGTCTTATGAA

AmyA forward (BI259):

CCGCATATGCGTAATCCCACGCTGTTACAATGT

AmyA reverse (BI260):

GCG GGATCC TTA AAT CAC CTC TTC GAT AAC CCA CAC G

Subtilisin savinase forward (BI255):

GGGCATATGAATAAGAAAATGGGGAAAATTGTTG

Subtilisin savinase reverse (BI256):

CCCGGATCCTTAACGTGTTGCCGCTTCTGCGTTAACAA

We also heard back from the France iGem team (Lyons team) and they will send us their DspB part when they get back in the lab next week. We also looked up the academic calendar for the other iGem team that could send us the part, University of British Colombia (UBC), but they are on vacation until Monday 5/13/13. We will see if they get back to us then.

Research:
EPS purification/Crystal Violet Staining:

Ilana Kolodkin-Gal, S. C., Liraz Chai, Thomas Bottcher, Roberto Kolter, Jon Clardy, and Richard Losick (2012). "A self-produced trigger for biofilm disassembly that targets exopolysaccharide." Cell 149: 684-692.

AmyA Degradation:

Samuel A. Shelburne Ill, D. B. K., Michael T. Davenport, Stephen B. Beres, Ronan K. Carroll and James M. Musser (2009). "Contribution of AmyA, an extracelular a-glucan degrading enzyme, to group A streptococcal host-pathogen interaction." Molecular Microbiology 74(1): 159-174.

Alternative seawater medium:

Shuyang Sun, S. K., Diane McDougald (2013). "Relative Contributions of Vibrio Polysaccharide and Quorum Sensing to the Resistance of Vibrio cholerae to Predation by Heterotrophic Protists." PLoS ONE 8(2): e56338.

Quantification of Biofilm Biomass:

Shuyang Sun, S. K., Diane McDougald (2013). "Relative Contributions of Vibrio Polysaccharide and Quorum Sensing to the Resistance of Vibrio cholerae to Predation by Heterotrophic Protists." PLoS ONE 8(2): e56338.

Jun Zhu, M. B. M., Russell E. Vance, Michelle Dzlejman, Bonnie L. Bassler and John J. Mekalanos (2002). "Quorum-sensing regulators control virulence gene expression in Vibrio cholerae." PNAS 99(5): 3129-3134.

Papers to consider for enzyme assay/biofilm breakdown:

Daniel Nelson, R. S., Peter Chahales, Shiwei Zhu and Vincent A. Fischetti (2006). "PlyC: A multimeric bacteriophage lysin." PNAS 103(28): 10765-10770.

Anneleen Cornelissen, P.-J. C., Jeroen T'Syen, Helena Van Praet, Jean-Paul Noben, Olga V. Shaburova, Victor N. Krylov, Guido Volckaert, Rob Lavigne (2011). "The T7-related Pseudomonas putida phage O15 displays virion-associated biofilm degradation properties." PLoS ONE 6(4): e18597.

5/8/13

We are waiting for our primers to get in, but we set up five polyacrylamide gels in preparation for protein assays that we will do in the near future. We also discussed the different papers that we have each researched to find a suitable assay for biofilm degradation analysis. Most of the papers that we found referred back to a 2003 paper for the general protocol followed:

Pitts, B.; Hamilton, M.; Zelver, N.; Stewart, P. A Microtiter-Plate Screening Method for Biofilm Disinfection and Removal. J. Micro Methods 2003, 54, 269-276.

We decided to base our assay off of the protocol presented in this paper, then adjust for our specific needs with cholera. We’ll all go over this paper again in preparation for Friday so we can order the reagents that we will need for this.

5/9/13

Today the primers designed for dspB, AmyA, and Savinase were received in the mail. Cholera overnights #1 were seeded and left in the 30 degree incubator. Overnights were made by adding: 4 mL Salt LB + 0.5 mL previous cholera overnight.

5/10/13

We started a new V. cholerae culture and seeded it from the cultures started on 5/3/2013. The biofilm growth continues to be really good when using our SLB media. We also got our primers back so we will start our pcr and cloning for AmyA and Savinase on Monday.

We also compiled the following list of necessary reagents for our enzyme assay. We sent the list to Dr. Grose to see what is available here and what needs to be ordered. We will alter the protocol on Monday to fit our specific needs.

Enzyme Assay:
Equipment:

• 96-well microtiter plate
• 96-pin replicator to seed the plates
• Nunc-Immuno wash 8 channel device (they used to rinse the plates, I don't know if we need this or can use something else)
• BioTek FL600 plate reader to measure absorbance

Reagents:

• Crystal violet stain
• CTC stain (5-cyano-2,3-ditolyl tetrazolium chloride)
• 95% ethanol
• For baselines they used urea and sodium hypochlorite (NaOCl) with Na2S203 as a neutralizing agent

Reference for biofilm assay protocol: Pitts, B.; Hamilton, M.; Zelver, N.; Stewart, P. A Microtiter-Plate Screening Method for Biofilm Disinfection and Removal. J. Micro Methods 2003, 54, 269-276.

5/13/13

We rechecked our biofilm growth. Allowing the biofilm to grow for 72 hrs in the SLB media gives the highest yield of biofilm in our overnights.

We will use the Pet15 plasmid for our enzymes: Restriction sites are Nde1/BamH1.

We input the following primers into the database:

• DspB BI242: Forward primer
• DspB BI243: Reverse primer
• Savinase BI255: Forward primer
• Savinase BI256: Reverse primer
• AmyA BI259: Forward primer
• AmyA BI260: Reverse primer

AmyA plasmid for cloning: pIG 86 Followed protocol for phusion PCR of AMyA and Savinase -Sample 2x with each

The following is our modified biofilm assay protocol:

Biofilm Prep

1. Overnight culture of V. cholerae grown in Salt LB at 30 °C for 72 hrs.
2. 20 ml of culture added to 180 ml of salt LB for dilution
3. Fill each well of a 96-well plate with 200 ul of salt LB
4. To inoculate wells, immerse replicator pins in the diluted bacterial suspension for 30 seconds, then lower replicator pins into wells and agitate for 15 seconds.
5. Plates are covered and incubated with shaking at 30 °C for 24 hrs.
6. Every 10-12 hrs during the incubation period, spent nutrients are pipetted from wells and replaced with fresh Salt LB

Enzyme Treatment

1. At 24 hrs, planktonic suspensions and nutrient solutions are aspirated and wells are rinsed by carefully removing and adding liquid from the side of the well using a micropipette. Wells are washed four times.
2. Enzymes are added to wells immediately after rinsing and allowed to sit for 1 hour.
3. After 1 hour, wells are washed again and the stains are applied:
   1. 0.16% filter-sterilized CTC incubated at room temperature for 2 hr, CTC solutions are prepared directly prior to staining
   2. 0.3% CV solution incubated at room temperature for 5 min
4. After incubation times, absorbed stain is eluted from attached cells with 95% ethanol
   1. Wells are rinsed four times to remove excess stain
   2. Wells then filled with 200 ul ethanol and incubated
      1. CTC incubated for 15 min at room temp
      2. CV incubated for 5 min at room temp

Absorbance Readings

1. Plates are vigorously shaken for 10 seconds, then light absorbances are read with BioTek FL600 plate reader
   1. CTC absorbance is read at 450 nm
   2. CV absorbance is read at 540 nm
2. Each raw absorbance value is then corrected by subtracting the mean of absorbance readings for the blank wells prior to statistical analysis