Submission of BioBricks

The MLS was cloned from a commercial plasmid, pCMV/myc/mito (Invitrogen) by PCR. For the MLS BioBrick, we have submitted the MLS BioBrick in RFC 10 and RFC 25, the Freiburg format which allows protein fusion, to facilitate other team to fuse the MLS with other protein for purpose of introducing other protein into mitochondria.

For characterization, MLS and green fluorescence protein was fused with constitutive mammalian CMV promoter. The promoter was cloned from pEGFP-N1 (Clonetech) in RFC10 format, since such part could not be found in partsregistry. The CMV cloned for our characterization construct was also submitted. The two construct for characterization, the CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 and CMV promoter – mitochondria leader sequence – green fluorescence protein – polyadenylation sequence – pSB1C3 composite parts are also submitted.

Characterization

In order to characterize mitochondria that it can translocate protein into mitochondria in standard BioBrick, we constructed CMV promoter – mitochondria leader sequence – green fluorescent protein – polyadenylation sequence – pSB1C3. We use pCMV/myc/mito.GFP (Invitrogen) as positive control, which include MLS with GFP reporter, and we built negative control, CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 for response without MLS. Characterization was conducted on HEK 293FT cell. If the result shows that GFP is localized in mitochondria while the negative control is scatter all around cell, we can conclude that MLS is targeting GFP into mitochondria in HEK 293FT Cell.

Since we could not find a constitutive promoter BioBrick allow expression in mammalian cell, we amplified pCMV from pEGFP-N1 (Clonetech). To characterize this CMV promoter, we used CMV promoter – green fluorescent protein – polyadenylation sequence construct with pEGFP-N1 as positive control and GFP-PolyA in pSB1C3 as negative control. If the result shows that GFP is expressed and scatter around in cell, while negative control shows no GFP signal in cell, we can conclude that CMV is functioning.

Characterization for MLS:

CMV-MLS-GFP-PolyA in pSB1C3 Promoter CMV mammalian promoter to allow expressing the construct in mammalian cell.

Forward primer: [TTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGCTGTGGATAACCGTATTACCGCCATGC]

Reverse primer: [CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAACCAGCTCTGC]

to amplify CMV from pEGFP-N1 (Clonetech) in RFC 10 format. Since not enough length is kept after the transcription start site, future user may need to put spacer between the CMV promoter and the part need to be transcribed.

Mitochondria Leader Sequence MLS was cloned from pCMV/myc/mito (Invitrogen) using forward primer:

[GATCATGAATTCGCGGCCGCTTCTAGATGGCCGGCATGTCCGTCCTGACGCCGC]

and reverse primer: [GATCATCTGCAGCGGCCGCTACTAGTATTAACCGGTCAACGAATGGATCTTGGCGCG].

The MLS was cloned with RFC 25 Freiburg standard prefix and suffix to allow doing fusion protein with MLS, to allow trafficking of reporter into mitochondria.