Team:Hong Kong HKUST/experiment/exp4

From 2013.igem.org

(Difference between revisions)
Line 183: Line 183:
<body>
<body>
<ol class="pos_fixed">
<ol class="pos_fixed">
-
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp4">Glyoxylate Shunt</a></li>
+
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/hp/https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp4">Glyoxylate Shunt</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp3">Protein Trafficking</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp3">Protein Trafficking</a></li>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp2">FA Sensing Mechanism</a></il>
<li><a href="https://2013.igem.org/Team:Hong_Kong_HKUST/experiment/exp2">FA Sensing Mechanism</a></il>
Line 266: Line 266:
<p id="yo"><b>Constitutive Promoter</b>In line with the UCLA’s experiment, we will fuse<i> aceB</i> gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha promoter is often useful in conditions where other promoters (such as CMV promoter) have diminished activity or have been silenced. We cloned EF-1alpha promoter from plasmid called iDUET101a (Addgene).</p>
<p id="yo"><b>Constitutive Promoter</b>In line with the UCLA’s experiment, we will fuse<i> aceB</i> gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha promoter is often useful in conditions where other promoters (such as CMV promoter) have diminished activity or have been silenced. We cloned EF-1alpha promoter from plasmid called iDUET101a (Addgene).</p>
-
<p id="yo"><b>Tag protein </b>We engineered in a FLAG protein tag in the 3’ ends of ACEB by including the sequence in <i>aceB</i> extraction primer.
+
<p id="yo"><b>Tag protein </b>We engineered in a FLAG protein tag in the 3’ ends of AceB by including the sequence in <i>aceB</i> extraction primer.
-
<p id="yo">3’ primer to extract aceB with engineered FLAG tag:</p>
+
<p id="yo">3’ primer to extract <i>aceB</i> with engineered FLAG tag gene sequence:</p>
<p id="yo">GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG</p>
<p id="yo">GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG</p>
<p id="yo"><i>[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]</i></p>
<p id="yo"><i>[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]</i></p>

Revision as of 20:59, 27 September 2013

  1. Glyoxylate Shunt
  2. Protein Trafficking
  3. FA Sensing Mechanism
  4. Cell Viability & FA Quantifictaion



Glyoxylate Shunt


Overview

Our artificial futile cycle is driven by the expression of two key enzymes in glyoxylate cycle. Since mammalian cells lack genes expressing glyoxylate shunt, we introduce these genes from E. coli and assemble them in a constitutive construct that will allow the expression of prokaryotic gene in eukaryotic cell. In addition to the constitutive system, we will also assemble an inducible construct which will allow tunable gene expression according to the concentration of fatty acid in the medium. We decided to introduce inducible system to prevent fatty acid deficiency in low concentration of plasma fatty acid and facilitate greater fatty acid uptake at a high circulating fatty acid levels. The inducible and constitutive system will be compared in terms of fatty acid uptake rate in a range concentration of fatty acid.

Construct

The two key enzymes of glyoxylate system are isocitrate lyase and malate synthase. These two enzymes are encoded by aceA and aceB genes, respectively. We planned to assemble aceA and aceB construct in one vector plasmid to minimize the possibility of mosaic expression of isocitrate lyase and malate synthase throughout the cell line. The mosaic expression can be caused by cell transfection with only either aceA-containing plasmid or aceB-containing plasmid. The constitutive system will be fused with a mammalian constitutive promoter, a mitochondrial leader sequence, a tagging protein and a polyadenylation sequence. Mitochondrial leader sequence is needed for protein translocation to the mitochondria. Tagging protein is essential for detecting the protein expression by means of western blot. Polyadenylation site enhances the gene expression as it is transfected into a mammalian where post-transcription modification exists. aceA and aceB construct will be assembled separately in different plasmid before being combined into one plasmid.

ACEA Construct

Backbone For ACEA construct, we decided to use a commercial plasmid called pShooter/myc/mito (Invitrogen). The vector is designed for expression in mammalian cell. In addition, the vector already contains mitochondrial leader sequence (MLS), a constitutive CMV promoter, Myc tag protein and polyadenylation site.

Constitutive Promoter In order for the prokaryotic genes to be expressed in mammalian cell, we need to fuse them with eukaryotic promoter. In order to generate the same result as UCLA team’s experiment, we adhere to their choice of promoter by fusing aceA gene with CMV promoter. Cytomegalovirus (CMV) promoter is a commonly used constitutive promoter to drive protein expression in mammalian cell.

Assembly ACEA construct is assembled by extracting out aceA gene from E. coli BW25113 genome. The ligation product was confirmed by digestion check and sequencing.

ACEB Construct

Backbone pSB1C3 was used for ACEB construct.

Constitutive PromoterIn line with the UCLA’s experiment, we will fuse aceB gene with human elongation factor-1 alpha (EF-1alpha) promoter. EF-1alpha promoter is often useful in conditions where other promoters (such as CMV promoter) have diminished activity or have been silenced. We cloned EF-1alpha promoter from plasmid called iDUET101a (Addgene).

Tag protein We engineered in a FLAG protein tag in the 3’ ends of AceB by including the sequence in aceB extraction primer.

3’ primer to extract aceB with engineered FLAG tag gene sequence:

GATCAT CTCGAG CTTATCGTCGTCATCCTTGTAATC CGCTAACAGGCGGTAG

[6’ Cap][6’ XhoI restriction site][24’ FLAG protein][25' reverse complementary of 3’ aceB]

Mitochondrial Leader Sequence Since pSB1C3 backbone does not have any MLS and aceB needs to be translocated to mitochondria to serve glyoxylate shunt, we extract MLS out from pShooter/myc/mito (Invitrogen).

Assembly ACEB construct contain 5 parts that needs to be assembled: EF-1alpha promoter, mitochondria leader sequence, AceB engineered with FLAG tag, and polyadenylation sequence in pSB1C3 backbone. We tried traditional digestion and ligation to construct ACEB but we found that four segments ligation is hard to be achieved and time-consuming. As an alternative, we used Gibson assembly to assemble four segments at the same time. More details on the Gibson assembly can be viewed in Protocol page.