Team:INSA Toulouse/contenu/lab practice/notebook/calendar/polT7

From 2013.igem.org

(Difference between revisions)
Line 148: Line 148:
   <h1 class="title1">Calendar</h1>
   <h1 class="title1">Calendar</h1>
-
   <h2 class="title2">T7 Polymerase Characterization</h2>
+
   <h2 class="title2">T7 Polymerase</h2>
    
    
Line 165: Line 165:
   <ul class="circlearrow">
   <ul class="circlearrow">
   <li><span class="spantitle2">Week 3 (24-30 June)</span></br>
   <li><span class="spantitle2">Week 3 (24-30 June)</span></br>
-
25/06  
+
25/06 <br>
-
PCR extraction of T7 polymerase from the genome of BL21-DE3 (UNIPROT accession number C6EJI5).
+
PCR extraction of T7 polymerase from the genome of BL21-DE3 (UNIPROT accession number C6EJI5).<br>
-
Primers was designed to included restrictions sites of EcoRI, XbaI, SpeI and PstI.
+
Primers was designed to included restrictions sites of EcoRI, XbaI, SpeI and PstI.<br>
-
Forward primer: GCA GAATTC TCTAGAATGAACACGATTAACATCGC
+
Forward primer: GCA GAATTC TCTAGAATGAACACGATTAACATCGC <br>
-
Reverse primer: GCA CTGCAG ACTAGT TAACGCGAACGCGAAGTCC
+
Reverse primer: GCA CTGCAG ACTAGT TAACGCGAACGCGAAGTCC <br>
-
PCR condition (on colony) : 3 min 95° C,  1min30 95°, 45s  55°, 2 min30 72°, 5min 72°, HOLD 10° ; 25 run.
+
PCR condition (on colony) : 3 min 95° C,  1min30 95°, 45s  55°, 2 min30 72°, 5min 72°, HOLD 10° ; 25 run.<br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Presence of unspecific hybridation. PCR conditions need to be improved.
+
Presence of unspecific hybridation. PCR conditions need to be improved.<br>
-
27/06
+
27/06<br>
-
PCR extraction of T7 polymerase from the genome of BL21-DE3.
+
PCR extraction of T7 polymerase from the genome of BL21-DE3.<br>
-
PCR condition (on colony): 3 min 95°,  1min30 95°, 45s  60°, 2 min30 72°, 5min 72°, HOLD 10° ; 30 run.
+
PCR condition (on colony): 3 min 95°,  1min30 95°, 45s  60°, 2 min30 72°, 5min 72°, HOLD 10° ; 30 run.<br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Unspecific hybridation disappear, but the intensity of the band is quite low.  PCR conditions need to be improved.
+
Unspecific hybridation disappear, but the intensity of the band is quite low.  PCR conditions need to be improved.<br>
   </ul>
   </ul>
Line 193: Line 193:
   <ul class="circlearrow">
   <ul class="circlearrow">
   <li><span class="spantitle2">Week 4 (1-7 July)</span><br>
   <li><span class="spantitle2">Week 4 (1-7 July)</span><br>
-
02/07
+
02/07<br><br>
PCR extraction of T7 polymerase from the genome of BL21-DE3.
PCR extraction of T7 polymerase from the genome of BL21-DE3.
-
PCR condition (on colony): 5 min 95°,  1min30 95°, 1min30  60° (decrease 0,1 each round) , 2 min30 72°, 5min 72°, HOLD 4°; 30 run.
+
PCR condition (on colony): 5 min 95°,  1min30 95°, 1min30  60° (decrease 0,1 each round) , 2 min30 72°, 5min 72°, HOLD 4°; 30 run.<br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Presence of unspecific hybridation. Changes in the PCR conditions do not improved the results.
+
Presence of unspecific hybridation. Changes in the PCR conditions do not improved the results.<br>
-
03/07
+
03/07<br>
-
PCR extraction of T7 polymerase from the genome of BL21-DE3. Test of different hybridation temperatures
+
PCR extraction of T7 polymerase from the genome of BL21-DE3. Test of different hybridation temperatures<br>
-
PCR condition (on colony): 5 min 95°,  1min30 95°, 1min30  between 57 and 63°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
+
PCR condition (on colony): 5 min 95°,  1min30 95°, 1min30  between 57 and 63°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.<br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Results showed that 60,6 °C seems the best hybridation temperature. Absence of unspecific hybridation.
+
Results showed that 60,6 °C seems the best hybridation temperature. Absence of unspecific hybridation.<br>
-
PCR purification using kit. It failed because of a defective buffer.
+
PCR purification using kit. It failed because of a defective buffer.<br>
-
04/07
+
04/07<br>
-
PCR extraction again using the same condition than yesterday.  
+
PCR extraction again using the same condition than yesterday. <br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Absence of T7 polymerase but presence of unspecific hybridation. PCR extraction seems to be extremely sensitive.
+
Absence of T7 polymerase but presence of unspecific hybridation. PCR extraction seems to be extremely sensitive.<br>
-
In order to maximize our chance to obtain the desired product of PCR reaction, we choose to test different hybridation temperature ( between 57 et 63 °C) and different concentration of DNA template (1,2, 4 µL in 50 µL total volume) at the same time.
+
In order to maximize our chance to obtain the desired product of PCR reaction, we choose to test different hybridation temperature ( between 57 et 63 °C) and different concentration of DNA template (1,2, 4 µL in 50 µL total volume) at the same time.<br>
-
Verification by electrophoris gel 0,8%.
+
Verification by electrophoris gel 0,8%.<br>
-
Good results for different conditions but unspecific products are still present.
+
Good results for different conditions but unspecific products are still present.<br>
-
05/07
+
05/07<br>
-
PCR purification using kit.
+
PCR purification using kit.<br>
    
    
   <li><span class="spantitle2">Week 5 (8-14 July)</span><br>
   <li><span class="spantitle2">Week 5 (8-14 July)</span><br>
-
08/07
+
08/07<br>
-
Elimination of unspecific product using pressing technique.
+
Elimination of unspecific product using pressing technique.<br>
-
Verification by electrophoris gel 0,8%: success.
+
Verification by electrophoris gel 0,8%: success.<br>
-
09/07
+
09/07<br>
-
Cloning T7 polymerase (linear) with strong promoter strong rbs (spsr) using 3A assembly method.
+
Cloning T7 polymerase (linear) with strong promoter strong rbs (spsr) using 3A assembly method.<br>
-
11/07
+
11/07<br>
-
Minipreps and gel verification  with:
+
Minipreps and gel verification  with:<br>
-
- EcoRI/PstI
+
- EcoRI/PstI<br>
-
- BspxI, cutting inside T7 polymerase
+
- BspxI, cutting inside T7 polymerase<br>
-
Results: Failed, no insert
+
Results: Failed, no insert<br>
-
Transformation of the rest of the ligation of cloning 09/07
+
Transformation of the rest of the ligation of cloning 09/07<br>
-
12/07
+
12/07<br>
-
Minipreps and gel verification with EcoRI/PstI: failed, no insert.
+
Minipreps and gel verification with EcoRI/PstI: failed, no insert.<br>
Line 241: Line 241:
</li>
</li>
   <li><span class="spantitle2">Week 6 (15-21 July)</span><br>
   <li><span class="spantitle2">Week 6 (15-21 July)</span><br>
-
15/07
+
15/07<br>
-
PCR on the purified product by pressing to obtain a higher concentration of T7 polymerase.
+
PCR on the purified product by pressing to obtain a higher concentration of T7 polymerase.<br>
-
PCR condition: 5 min 95°,  1min30 95°, 1min30  60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
+
PCR condition: 5 min 95°,  1min30 95°, 1min30  60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.<br>
-
Verification by electrophoris gel 0,8%. Results: No PCR products.
+
Verification by electrophoris gel 0,8%.<br> Results: No PCR products.<br>
-
16/07
+
16/07<br>
-
PCR on colony (BL21-DE3)
+
PCR on colony (BL21-DE3)<br>
-
PCR condition: 5 min 95°,  1min30 95°, 1min30  60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
+
PCR condition: 5 min 95°,  1min30 95°, 1min30  60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.<br>
-
Verification by electrophoris gel 0,8%. Results: No PCR products.
+
Verification by electrophoris gel 0,8%.<br> Results: No PCR products.<br>
-
17/07
+
17/07<br>
-
PCR on colony (BL21-DE3). Increasing time of extension
+
PCR on colony (BL21-DE3). Increasing time of extension<br>
-
PCR condition: 5 min 95°,  30s 95°, 30s  60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.
+
PCR condition: 5 min 95°,  30s 95°, 30s  60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.<br>
-
Verification by electrophoris gel 0,8%.  
+
Verification by electrophoris gel 0,8%. <br>
-
Results: Band more intense but  there are some unspecific products.
+
Results: Band more intense but  there are some unspecific products.<br>
-
18/07
+
18/07<br>
-
Elimination of unspecific product using pressing technique.
+
Elimination of unspecific product using pressing technique.<br>
-
Verification by electrophoris gel 0,8%: success.
+
Verification by electrophoris gel 0,8%: success.<br>
-
Cloning using 3A assembly method:
+
Cloning using 3A assembly method:<br>
-
- T7 polymerase with spsr
+
- T7 polymerase with spsr<br>
-
- T7 polymerase with terminator
+
- T7 polymerase with terminator<br>
-
- T7 Promoter  (pT7) with RFP
+
- T7 Promoter  (pT7) with RFP<br>
-
19/07
+
19/07<br>
-
Minipreps and gel verification with EcoRI/PstI:
+
Minipreps and gel verification with EcoRI/PstI:<br>
-
- No insert for T7 polymerase
+
- No insert for T7 polymerase<br>
-
- Insert of good length for pt7-RFP, but clones present red phenotype: only RFP  inserted into the acceptor vector (clones are supposed to be red only in the presence of T7 polymerase, which is not the case in the cloning strain)
+
- Insert of good length for pt7-RFP, but clones present red phenotype: only RFP  inserted into the acceptor vector (clones are supposed to be red only in the presence of T7 polymerase, which is not the case in the cloning strain)<br>
</li>
</li>
   <li><span class="spantitle2">Week 7 (22-28 July)</span><br>
   <li><span class="spantitle2">Week 7 (22-28 July)</span><br>
-
23/07
+
23/07<br>
-
Cloning:
+
Cloning:<br>
-
- T7 polymerase with spsr using 3A assembly method
+
- T7 polymerase with spsr using 3A assembly method<br>
-
- T7 polymerase inside the vector containing spsr (bipartite)
+
- T7 polymerase inside the vector containing spsr (bipartite)<br>
-
- T7 polymerase with terminator using 3A assembly method
+
- T7 polymerase with terminator using 3A assembly method<br>
-
- T7 polymerase inside the vector containing the terminator (bipartite)
+
- T7 polymerase inside the vector containing the terminator (bipartite)<br>
-
24/07
+
24/07<br>
-
Minipreps and gel verification with EcoRI/PstI: failed, no insert
+
Minipreps and gel verification with EcoRI/PstI: failed, no insert<br>
-
25/07
+
25/07<br>
-
Cloning:
+
Cloning:<br>
-
- T7 polymerase with spsr using 3A assembly method
+
- T7 polymerase with spsr using 3A assembly method<br>
-
- T7 polymerase with spsr (bipartite)
+
- T7 polymerase with spsr (bipartite)<br>
-
- T7 polymerase with terminator using 3A assembly method
+
- T7 polymerase with terminator using 3A assembly method<br>
-
- T7 polymerase with terminator (bipartite)
+
- T7 polymerase with terminator (bipartite)<br>
-
- pT7 with RFP (bipartite)
+
- pT7 with RFP (bipartite)<br>
-
26/07
+
26/07<br>
-
Minipreps and gel verification with EcoRI/PstI: failed, no insert
+
Minipreps and gel verification with EcoRI/PstI: failed, no insert<br>
</li>
</li>
Line 304: Line 304:
   <ul class="circlearrow">
   <ul class="circlearrow">
   <li><span class="spantitle2">Week 8 (29-4 August)</span><br>
   <li><span class="spantitle2">Week 8 (29-4 August)</span><br>
-
29/07
+
29/07<br>
-
PCR on colony (BL21-DE3).
+
PCR on colony (BL21-DE3).<br>
-
PCR condition: 5 min 95°,  30s 95°, 30s  60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.
+
PCR condition: 5 min 95°,  30s 95°, 30s  60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.<br>
-
Verification by electrophoris gel 0,8%.  
+
Verification by electrophoris gel 0,8%. <br>
-
Results: Bands intense but there are some unspecific products.
+
Results: Bands intense but there are some unspecific products.<br>
-
30/07
+
30/07<br>
-
Elimination of unspecific product using pressing technique.
+
Elimination of unspecific product using pressing technique.<br>
-
Verification by electrophoris gel 0,8%: success.
+
Verification by electrophoris gel 0,8%: success.<br>
-
31/07
+
31/07<br>
-
Cloning:
+
Cloning:<br>
-
- T7 polymerase with spsr using 3A assembly method
+
- T7 polymerase with spsr using 3A assembly method<br>
-
- T7 polymerase with spsr (bipartite)
+
- T7 polymerase with spsr (bipartite)<br>
-
- pT7 with RFP (bipartite)
+
- pT7 with RFP (bipartite)<br>
-
01/08
+
01/08<br>
-
Minipreps and gel verification with EcoRI/PstI:
+
Minipreps and gel verification with EcoRI/PstI:<br>
-
- for T7 polymerase: failed, no insert
+
- for T7 polymerase: failed, no insert<br>
-
- for pt7-RFP: success, insert of good length, white phenotype
+
- for pt7-RFP: success, insert of good length, white phenotype <br>
Further verifications are necessary for pT7-RFP like phenotypic test. Transformation of the plasmid into BL21-DE3 should give white colonies without ITPG and red colonies  with IPTG (T7 polymerase is under control of a promoter Lac in BL21-DE3).
Further verifications are necessary for pT7-RFP like phenotypic test. Transformation of the plasmid into BL21-DE3 should give white colonies without ITPG and red colonies  with IPTG (T7 polymerase is under control of a promoter Lac in BL21-DE3).
</li>
</li>
   <li><span class="spantitle2">Week 9 (5-11 August)</span><br>
   <li><span class="spantitle2">Week 9 (5-11 August)</span><br>
-
05/08
+
05/08<br>
-
Making competent cells of BL21-DE3 strain (sodium chloride method)
+
Making competent cells of BL21-DE3 strain (sodium chloride method)<br>
-
Transformation of plasmid containing pt7-RFP into competent cells.  White colonies obtained.
+
Transformation of plasmid containing pt7-RFP into competent cells.  White colonies obtained.<br>
-
07/08
+
07/08<br>
-
Culture of whites colonies into ITPG plate overnight. Whites colonies turn into red colonies.
+
Culture of whites colonies into ITPG plate overnight. Whites colonies turn into red colonies.<br>
-
Phenotypic  test  of pT7-RFP is confirmed
+
Phenotypic  test  of pT7-RFP is confirmed<br>
-
Cloning T7 polymerase into psB1A3, psB1K3 and psB1C3.
+
Cloning T7 polymerase into psB1A3, psB1K3 and psB1C3.<br>
-
08/08
+
08/08<br>
-
Minipreps and gel verification with EcoRI/PstI:
+
Minipreps and gel verification with EcoRI/PstI:<br>
-
- for T7 polymerase into psB1C3, psB1K3: failed
+
- for T7 polymerase into psB1C3, psB1K3: failed <br>
-
- for T7 polymerase into psB1A3: success
+
- for T7 polymerase into psB1A3: success<br>
-
09/08
+
09/08<br>
-
Cloning:
+
Cloning:<br>
-
- T7 polymerase with spsr (bipartite)
+
- T7 polymerase with spsr (bipartite)<br>
-
- T7 polymerase and spsr into psB1K3
+
- T7 polymerase and spsr into psB1K3<br>
-
- T7 polymerase with terminator (bipartite)
+
- T7 polymerase with terminator (bipartite)<br>
-
- T7 polymerase and terminator into psB1K3
+
- T7 polymerase and terminator into psB1K3<br>
-
.<br>
+
</li>
-
  <img src="https://static.igem.org/mediawiki/2013/1/11/General_inducer4_-_h190px.png" class="imgcontent" /></li>
+
   <li><span class="spantitle2">Week 10 (12-18 August)</span><br>
   <li><span class="spantitle2">Week 10 (12-18 August)</span><br>
-
12/08
+
12/08<br>
-
Minipreps and gel verification with EcoRI/PstI, EcoI, XbaI, PstI: failed
+
Minipreps and gel verification with EcoRI/PstI, EcoI, XbaI, PstI: failed<br>
-
14/08
+
14/08<br>
-
Cloning:
+
Cloning:<br>
-
- T7 polymerase with spsr (bipartite)
+
- T7 polymerase with spsr (bipartite)<br>
-
- T7 polymerase with spmr (bipartite)
+
- T7 polymerase with spmr (bipartite)<br>
-
- T7 polymerase with terminator (bipartite)
+
- T7 polymerase with terminator (bipartite)<br>
-
- T7 polymerase into psB1C3
+
- T7 polymerase into psB1C3<br>
-
16/08
+
16/08<br>
-
Minipreps and gel verification with EcoRI/PstI:  
+
Minipreps and gel verification with EcoRI/PstI: <br>
-
- for T7 polymerase with spsr and spmr: success
+
- for T7 polymerase with spsr and spmr: success<br>
-
- for T7 polymerase with terminator and into psB1C3: failed
+
- for T7 polymerase with terminator and into psB1C3: failed<br>
-
<br>
+
</li>
-
  <img src="https://static.igem.org/mediawiki/2013/5/59/General_inducer5_-_h140px.png" class="imgcontent" /><br>
+
-
This one seems to work but we are waiting for the sequencing to confirm the construct.<br><br></li>
+
   <li><span class="spantitle2">Week 11 (19-25 August) </span><br>
   <li><span class="spantitle2">Week 11 (19-25 August) </span><br>
</li>
</li>
-
19/08
+
19/08 <br>
-
Further verification by restriction:
+
Further verification by restriction:<br>
-
- EcoRI
+
- EcoRI<br>
-
- PstI
+
- PstI<br>
-
- AvrII/PstI, AvrI cutting into spsr and into spmr
+
- AvrII/PstI, AvrI cutting into spsr and into spmr<br>
-
For spmr- T7 polymerase, results showed the absence of the promoter. Clonage Failed
+
For spmr- T7 polymerase, results showed the absence of the promoter. Clonage Failed<br>
-
For spsr- T7 polymerase, length of the fragment obtained corresponds to what is expected. Success confirmed by restriction.
+
For spsr- T7 polymerase, length of the fragment obtained corresponds to what is expected. Success confirmed by restriction.<br>
-
21/08
+
21/08<br>
-
Cloning:
+
Cloning:<br>
-
- Spsr- T7 polymerase into psB1K3
+
- Spsr- T7 polymerase into psB1K3<br>
-
- Spsr- T7 polymerase into psB1A3
+
- Spsr- T7 polymerase into psB1A3<br>
-
- Spsr- T7 polymerase into Terminator
+
- Spsr- T7 polymerase into Terminator<br>
 +
 
 +
22/08<br>
 +
Minipreps and gel verification with EcoRI/PstI: <br>
 +
- for spsr- T7 polymerase into Terminator: success<br>
 +
- for T7 polymerase into psB1K3, psB1A3: success<br>
 +
</li>
 +
  <li><span class="spantitle2">Week 12 (25-31 August) </span><br>
 +
</li>
 +
28/08<br>
 +
Further verification by restriction:<br>
 +
- EcoRI<br>
 +
- HpaI/PstI, HpaI cutting inside T7 polymerase (expected length of 1075 in presence of the terminator, 975 if the terminator is absent)<br>
 +
- AvrII/PstI, AvrII cutting inside the promoter<br>
 +
Results invalidate some cloning: spsr- T7 polymerase into terminator and spsr- T7 polymerase into psB1K3<br>
 +
Success confirmed for the cloning: spsr- T7 polymerase into psB1A3<br>
 +
29/08<br>
 +
Cloning spsr- T7 polymerase into terminator <br>
-
22/08
+
30/08<br>
-
Minipreps and gel verification with EcoRI/PstI:  
+
Minipreps and gel verification with EcoRI/PstI: failed<br>
-
- for spsr- T7 polymerase into Terminator: success
+
-
- for T7 polymerase into psB1K3, psB1A3: success
+
-
28/08
 
-
Further verification by restriction:
 
-
- EcoRI
 
-
- HpaI/PstI, HpaI cutting inside T7 polymerase (expected length of 1075 in presence of the terminator, 975 if the terminator is absent)
 
-
- AvrII/PstI, AvrII cutting inside the promoter
 
-
Results invalidate some cloning: spsr- T7 polymerase into terminator and spsr- T7 polymerase into psB1K3
 
-
Success confirmed for the cloning: spsr- T7 polymerase into psB1A3
 
   </div>
   </div>
Line 407: Line 412:
   <div class="infos">
   <div class="infos">
   <ul class="circlearrow">
   <ul class="circlearrow">
-
   <li><span class="spantitle2">Week .. (29-4 sept)</span><br>
+
   <li><span class="spantitle2">Week 13 (2-8 September)</span><br>
-
blablabalba</li>
+
04/09<br>
-
  <li><span class="spantitle2">Week .. (29-4 sept)</span><br>
+
Cloning spsr- T7 polymerase into terminator (Bba-B0015)<br>
 +
05/09<br>
 +
Minipreps and gel verification with EcoRI/PstI: failed<br>
 +
Due to time limitation, cloning in order to add terminator to the biobrick spsr- T7 polymerase was stopped<br>
-
blablabalba</li>
+
</li>
-
  <li><span class="spantitle2">Week .. (29-4 sept)</span><br>
+
-
blablabalba</li>
 
</ul>
</ul>

Revision as of 19:07, 1 October 2013

logo


Calendar

T7 Polymerase

T7 polymerase is necessary in our system to activate the two T7 promoters in the AND1 and AND2 gate. We choose to extract it from the genome of E.Coli BL21-DE3. Cloning are necessary to add a promoter, a rbs and a terminator. In order to characterize the activity of the polymerase, cloning of a RFP under T7 promoter control will be also lead.

June 2013

  • Week 3 (24-30 June)
    25/06
    PCR extraction of T7 polymerase from the genome of BL21-DE3 (UNIPROT accession number C6EJI5).
    Primers was designed to included restrictions sites of EcoRI, XbaI, SpeI and PstI.
    Forward primer: GCA GAATTC TCTAGAATGAACACGATTAACATCGC
    Reverse primer: GCA CTGCAG ACTAGT TAACGCGAACGCGAAGTCC
    PCR condition (on colony) : 3 min 95° C, 1min30 95°, 45s 55°, 2 min30 72°, 5min 72°, HOLD 10° ; 25 run.
    Verification by electrophoris gel 0,8%.
    Presence of unspecific hybridation. PCR conditions need to be improved.
    27/06
    PCR extraction of T7 polymerase from the genome of BL21-DE3.
    PCR condition (on colony): 3 min 95°, 1min30 95°, 45s 60°, 2 min30 72°, 5min 72°, HOLD 10° ; 30 run.
    Verification by electrophoris gel 0,8%.
    Unspecific hybridation disappear, but the intensity of the band is quite low. PCR conditions need to be improved.

July 2013

  • Week 4 (1-7 July)
    02/07

    PCR extraction of T7 polymerase from the genome of BL21-DE3. PCR condition (on colony): 5 min 95°, 1min30 95°, 1min30 60° (decrease 0,1 each round) , 2 min30 72°, 5min 72°, HOLD 4°; 30 run.
    Verification by electrophoris gel 0,8%.
    Presence of unspecific hybridation. Changes in the PCR conditions do not improved the results.
    03/07
    PCR extraction of T7 polymerase from the genome of BL21-DE3. Test of different hybridation temperatures
    PCR condition (on colony): 5 min 95°, 1min30 95°, 1min30 between 57 and 63°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
    Verification by electrophoris gel 0,8%.
    Results showed that 60,6 °C seems the best hybridation temperature. Absence of unspecific hybridation.
    PCR purification using kit. It failed because of a defective buffer.
    04/07
    PCR extraction again using the same condition than yesterday.
    Verification by electrophoris gel 0,8%.
    Absence of T7 polymerase but presence of unspecific hybridation. PCR extraction seems to be extremely sensitive.
    In order to maximize our chance to obtain the desired product of PCR reaction, we choose to test different hybridation temperature ( between 57 et 63 °C) and different concentration of DNA template (1,2, 4 µL in 50 µL total volume) at the same time.
    Verification by electrophoris gel 0,8%.
    Good results for different conditions but unspecific products are still present.
    05/07
    PCR purification using kit.
  • Week 5 (8-14 July)
    08/07
    Elimination of unspecific product using pressing technique.
    Verification by electrophoris gel 0,8%: success.
    09/07
    Cloning T7 polymerase (linear) with strong promoter strong rbs (spsr) using 3A assembly method.
    11/07
    Minipreps and gel verification with:
    - EcoRI/PstI
    - BspxI, cutting inside T7 polymerase
    Results: Failed, no insert
    Transformation of the rest of the ligation of cloning 09/07
    12/07
    Minipreps and gel verification with EcoRI/PstI: failed, no insert.
  • Week 6 (15-21 July)
    15/07
    PCR on the purified product by pressing to obtain a higher concentration of T7 polymerase.
    PCR condition: 5 min 95°, 1min30 95°, 1min30 60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
    Verification by electrophoris gel 0,8%.
    Results: No PCR products.
    16/07
    PCR on colony (BL21-DE3)
    PCR condition: 5 min 95°, 1min30 95°, 1min30 60°, 2 min30 72°, 5min 72°, HOLD 4°; 35 run.
    Verification by electrophoris gel 0,8%.
    Results: No PCR products.
    17/07
    PCR on colony (BL21-DE3). Increasing time of extension
    PCR condition: 5 min 95°, 30s 95°, 30s 60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.
    Verification by electrophoris gel 0,8%.
    Results: Band more intense but there are some unspecific products.
    18/07
    Elimination of unspecific product using pressing technique.
    Verification by electrophoris gel 0,8%: success.
    Cloning using 3A assembly method:
    - T7 polymerase with spsr
    - T7 polymerase with terminator
    - T7 Promoter (pT7) with RFP
    19/07
    Minipreps and gel verification with EcoRI/PstI:
    - No insert for T7 polymerase
    - Insert of good length for pt7-RFP, but clones present red phenotype: only RFP inserted into the acceptor vector (clones are supposed to be red only in the presence of T7 polymerase, which is not the case in the cloning strain)
  • Week 7 (22-28 July)
    23/07
    Cloning:
    - T7 polymerase with spsr using 3A assembly method
    - T7 polymerase inside the vector containing spsr (bipartite)
    - T7 polymerase with terminator using 3A assembly method
    - T7 polymerase inside the vector containing the terminator (bipartite)
    24/07
    Minipreps and gel verification with EcoRI/PstI: failed, no insert
    25/07
    Cloning:
    - T7 polymerase with spsr using 3A assembly method
    - T7 polymerase with spsr (bipartite)
    - T7 polymerase with terminator using 3A assembly method
    - T7 polymerase with terminator (bipartite)
    - pT7 with RFP (bipartite)
    26/07
    Minipreps and gel verification with EcoRI/PstI: failed, no insert

August 2013

  • Week 8 (29-4 August)
    29/07
    PCR on colony (BL21-DE3).
    PCR condition: 5 min 95°, 30s 95°, 30s 60°, 5min 72°, 10min 72°, HOLD 4°; 35 run.
    Verification by electrophoris gel 0,8%.
    Results: Bands intense but there are some unspecific products.
    30/07
    Elimination of unspecific product using pressing technique.
    Verification by electrophoris gel 0,8%: success.
    31/07
    Cloning:
    - T7 polymerase with spsr using 3A assembly method
    - T7 polymerase with spsr (bipartite)
    - pT7 with RFP (bipartite)
    01/08
    Minipreps and gel verification with EcoRI/PstI:
    - for T7 polymerase: failed, no insert
    - for pt7-RFP: success, insert of good length, white phenotype
    Further verifications are necessary for pT7-RFP like phenotypic test. Transformation of the plasmid into BL21-DE3 should give white colonies without ITPG and red colonies with IPTG (T7 polymerase is under control of a promoter Lac in BL21-DE3).
  • Week 9 (5-11 August)
    05/08
    Making competent cells of BL21-DE3 strain (sodium chloride method)
    Transformation of plasmid containing pt7-RFP into competent cells. White colonies obtained.
    07/08
    Culture of whites colonies into ITPG plate overnight. Whites colonies turn into red colonies.
    Phenotypic test of pT7-RFP is confirmed
    Cloning T7 polymerase into psB1A3, psB1K3 and psB1C3.
    08/08
    Minipreps and gel verification with EcoRI/PstI:
    - for T7 polymerase into psB1C3, psB1K3: failed
    - for T7 polymerase into psB1A3: success
    09/08
    Cloning:
    - T7 polymerase with spsr (bipartite)
    - T7 polymerase and spsr into psB1K3
    - T7 polymerase with terminator (bipartite)
    - T7 polymerase and terminator into psB1K3
  • Week 10 (12-18 August)
    12/08
    Minipreps and gel verification with EcoRI/PstI, EcoI, XbaI, PstI: failed
    14/08
    Cloning:
    - T7 polymerase with spsr (bipartite)
    - T7 polymerase with spmr (bipartite)
    - T7 polymerase with terminator (bipartite)
    - T7 polymerase into psB1C3
    16/08
    Minipreps and gel verification with EcoRI/PstI:
    - for T7 polymerase with spsr and spmr: success
    - for T7 polymerase with terminator and into psB1C3: failed
  • Week 11 (19-25 August)
    • 19/08
    Further verification by restriction:
    - EcoRI
    - PstI
    - AvrII/PstI, AvrI cutting into spsr and into spmr
    For spmr- T7 polymerase, results showed the absence of the promoter. Clonage Failed
    For spsr- T7 polymerase, length of the fragment obtained corresponds to what is expected. Success confirmed by restriction.
    21/08
    Cloning:
    - Spsr- T7 polymerase into psB1K3
    - Spsr- T7 polymerase into psB1A3
    - Spsr- T7 polymerase into Terminator
    22/08
    Minipreps and gel verification with EcoRI/PstI:
    - for spsr- T7 polymerase into Terminator: success
    - for T7 polymerase into psB1K3, psB1A3: success
  • Week 12 (25-31 August)
    • 28/08
    Further verification by restriction:
    - EcoRI
    - HpaI/PstI, HpaI cutting inside T7 polymerase (expected length of 1075 in presence of the terminator, 975 if the terminator is absent)
    - AvrII/PstI, AvrII cutting inside the promoter
    Results invalidate some cloning: spsr- T7 polymerase into terminator and spsr- T7 polymerase into psB1K3
    Success confirmed for the cloning: spsr- T7 polymerase into psB1A3
    29/08
    Cloning spsr- T7 polymerase into terminator
    30/08
    Minipreps and gel verification with EcoRI/PstI: failed

September 2013

  • Week 13 (2-8 September)
    04/09
    Cloning spsr- T7 polymerase into terminator (Bba-B0015)
    05/09
    Minipreps and gel verification with EcoRI/PstI: failed
    Due to time limitation, cloning in order to add terminator to the biobrick spsr- T7 polymerase was stopped

Back to Wet Lab

Retrieved from "http://2013.igem.org/Team:INSA_Toulouse/contenu/lab_practice/notebook/calendar/polT7"