Team:Paris Bettencourt/Notebook

From 2013.igem.org

(Difference between revisions)

Revision as of 03:09, 28 October 2013

PROJECT
- OVERVIEW
- DETECT
- TARGET
- INFILTRATE
- SABOTAGE
ACHIEVEMENTS
HUMAN PRACTICE
SAFETY
COLLABORATION
- COLLABORATION
- SENSIGEM
NOTEBOOK
TEAM

@iGEM_Paris

Please be patient. It may take a few seconds to load

DAY NOTES

Detect

ASDF

Saturday 13^th August

PCR circular and linear, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert, Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

Reagent	Volume
	1x
Nuclease-free water	37.25 ul
5x Phusion HF Buffer	10 ul
10 mM dNTPs	1 ul
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template Plasmid	0.25 ul
Phusion DNA Polymerase	0.5 ul
Total Volume	50 ul

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	5 min	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

KEIOΔMPYRF has a deletion of PYRF to be replaced by KAN
We pitched 4 singles colonies into 50µL of H2O
Boil 5 minutes at 95°C
1,5 µL of this can be used directly for PCR

PCR reaction
Keep all the regents at 4°C while preparing the mixture

Reagent	Volume
JW 182 (10 uM) JW 183 (10 uM) Template DNA Quick-load Tag 2x Master Mix Nuclease free water	0,5 µL 0,5 µL 1,5 µL 12,5 µL 10 µL
Total volume	25 µL

Thermocycler Protocol : NEB Quick-Load

	Temperature	Time
Start Cycle1 Cycle 2 Cycle 3 Finish Store	95°C 95°C 50°C 68°C 68°C 10°C	30 seconds 15 seconds 30 seconds 1 minute/kB 5 minutes Forever	melt melt anneal extend - 35 cycles extend store

Monday 22^nd July

Culture purification by streak plate method and preparing the glycerol stock for the sSP001 (TN 57) and sSP002 (NEC) strains.

Place your note here

Detect

ASDF

Tuesday 23^rd July

Colony PCR

· Strain: Keio ΔpyrF
· Primers: JW182 and JW183
· Amplified region: kanamycine resistance gene

Detect

ASDF

PCR (gradient + usual) of SPCR1, SPCR7, SPCR8, SPCR10, SPCR9, SPCR4

Reagent	Volume
	1x
Nuclease-free water	37.25 µL
5x Phusion HF Buffer	10 µL
10 mM dNTPs	1 µL
Forward Primer (10 µM)	0.5 µL
Reverse Primer (10 µM)	0.5 µL
Template Plasmid	0.25 µL
Phusion DNA Polymerase	0.5 µL
Total Volume	50 µL

Gradient:
Pos 1: 40°
Pos 2: 40,2°
Pos 3: 41,3°
Pos 4: 43,1°
Pos 5: 45,4°
Pos 6: 48°
Pos 7: 50,7°
Pos 8: 53,5°
Pos 9: 56,0°
Pos 10: 58,1°
Pos 11: 59,8°C
(Pos 12: 60,6°)

Usual PCR: 52°

Detect

ASDF

Friday 2^nd August

Place your twit here

Gels with PCR products: 1% Agar
100V 20 Min
10 min staining in BET

Detect

ASDF

Monday 5^th August

Place your twit here

5ml liquid culture with proper antibiotics of:
SSp001 + F+
sSP002 + F+
keio delta pyrF + F+

Gelelectrophoresis: 1% Agar, 100 V 20 min

Detect

ASDF

Tuesday 6^th August

Liquid cultures of sSP008-sSP0011

Detect

ASDF

Wednesday 7^th August

Glycerol Stock of sSP008-sSP0011, M13 Test, Single Colonies, Liquid cultures, PCR and Transformation

Glycerol Stock of sSP008-sSP0011
Take 1.5ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

M13 Test
Plate from ON culture:
1) 1:1000 - sSP012: sSP009 (plate 200ul)
2) 200 ul sSP012
3) 200ul sSp009

Single Colonies
streak out ON culture of sSP012 to get single colonies

Liquid cultures of pir+ E.coli and pKD13 from Jake

PCR of SPCR4, SPCR7, SPCR8, SPCR9, SPCR10 from circuar backbone, directly taken from Biobrick plate

Protocol

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Transformation Biobricks BBa_K649304 (with pSB1C3 backbone) and BBa_J04450 (with pSB1A3 backbone) into NEB Turbo (heat shock trafo)

1) Thaw competent cells on ice.
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8) Incubate at 37 °C. Transformants should appear within 12 hrs.

Result: BBa_J04450: many colonies, BBa_K649304 no colonies, plate rest

Detect

ASDF

Thursday 8^th August

Liquid culture of FR-433 (M13)

PCR circular and linear 40.5°C/ 60°C, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert and Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Conjugation of XL-10 (with sSP011)
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare tube (in BD tubes) :
- Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)
6) Incubate overnight at 37°C

Patches
check and make new ones

Digestion M13 backbone, RFP insert
for Backbone (M13mp18 plasmid): 3ug
7,58 ul plasmid (c=395ng/ul)
3 ul EcoRI
3 ul PstI
3ul 10x Fast Digest
13,42 ul H20
incubate for 12 min on 37°
heat inactivation: 80° 5 min
for insert (BBa_J04450): 5ug
31,4 ul plasmid
5 ul EcoRi
5 ul PstI
3,6 ul H20
incubate for 20 min at 37°
heat inactivation: 80° 5min

Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)
100V, 20 min 1% gel

Detect

ASDF

Wednesday 14^th August

Gel of PCR, Gel of Digest, Gel Extraction, DpnI digest of PCR products, PCR purification

Gel of PCR (Amp 60° circ, lin, Chl 40.5 circ, lin) 100V, 20 min 1% gel

Gel of Digest
100V, 20 min 1% gel

Restreak XL-1 Blue Litmus28i, PCR, PCR purification Backbone (M13mp18), Ligation (RFP into M13mp18 backbone), Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo and Test Xgal

Restreak XL-1 Blue Litmus28i

PCR

SPCR5, SPCR6, 49,3°C

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

PCR purification and pooling
Pool all samples that worked
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

c(SPCR5)= ng/ul
c(SPCR6)= ng/ul

Digestion M13 backbone, RFP insert

Backbone/Insert (double the amount)

Regent	Volume
Purified Plasmid	20 ul
H2O	65 ul
10x FastDigest Buffer	10 ul
FastDigest Enzyme 1 (EcoRI)	2,5 ul
FastDigest Enzyme 2 (PstI)	2,5 ul
FastAP Phosphatase	0 ul
Total Volume	100ul

Digest for 2.5 hours at 37 °C with shaking.

Test Digestion in Gel
1%, 100V, 20 min

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

c=13,6ng/ul

Liquid culture
sSP015

Purification of Backbone Cloning
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Miniprep sSP015
1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Friday 23^rd August

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC), Microscope, Gradient PCR of SPCR2, Digestion of SPCR 5 and SPCR7 and Purification of Digestion.

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC)
Dilute ON culture 1:100
Centrifuge (1 min, 10rpm)
Wash 1x with 70% of Volume M9 Glucose
Centrifuge again
Take up in 70% of the VOlume M9 Gluo
100ul in each 96 well plate (see pipetting file)
Add MMC 10ug/ml in corresponding wells and incubate in the plate reader
After 90 min add phages into correscponding wells
put back on the plate reader

Microscope
look at the shape and fluorescence at t=0 of sSP001
look at the shape and fluorescence at=90 mi of sSP001 + 10ug/ml MMC
take photos

Gradient PCR of SPCR2
iSP001 (gblock) and iS002

Reagent	Volume
	1x
Nuclease-free water	37,25µL
5x Phusion HF Buffer	10µL
10 mM dNTPs	1µL
Forward Primer (10 µM)	0.5µL
Reverse Primer (10 µM)	0.5µL
Template Plasmid	0.25µL
Phusion DNA Polymerase	0.5µL
Total Volume	50µL

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	40.5°C / 60°C	25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72°C	5 min	Extend
Store	10°C	Forever	Store

Digestion of SPCR 5 and SPCR7

Reagent	Volume
Purified PCR Product	16 ul
H2O	0 ul
10x FastDigest Buffer	2 ul
FastDigest Enzyme 1	1 ul
FastDigest Enzyme 2	1 ul
Total Volume	20 ul

Incubate at 37°C for 1h shaking

Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Sunday 25^th August

Gel of Gradient PCR, Liquid Cultures, Ligation M13 + RFP, Ligation SPCR5, SPCR7, Electrocompetent cells, Gibson Assembly, Transformation (Gibson)and Transformation (Gibson, Ligations.

Gel of Gradient PCR
1%, 100V, 20min

Liquid Cultures
NEB Turbo
XL10

Ligation

Ligation M13 + RFP
0.5ul Vector (M13)
2.6ul Insert (RFP)
5.4ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Ligation SPCR5, SPCR7
1.0ul Vector (SPCR5)
1.5ul Insert (SPCR7)
6.0ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Incubate ~30min at 37 C

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat. 6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Gibson Assembly

Amount per Reaction
Positive Control**

PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*

Gibson
Assembly Master
Mix (2X)
10 μl

Deionized H2O
XX μl

Total Volume
20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes. After incubation, store the samples on ice or at -20°C for subsequent transformation
Note: Extended incubation up to 60 minutes may help to improve assembly efficiency in some cases (for further details see FAQ section).
Transform NEB 5-alpha Competent E. coli cells (provided with the kit) with 2 μl of the assembly reaction, following the transformation protocol.

Transformation (Gibson)
Thaw competent cells on ice.
Add 2 μl of the chilled assembly product to the competent cells. Mix gently by pipetting up and down or by flicking the tube 4–5 times. Do not vortex.
Place the mixture on ice for 30 minutes. Do not mix.
Heat shock at 42°C for 30 seconds. Do not mix.
Transfer tubes to ice for 2 minutes.
Add 950 μl of room-temperature SOC media to the tube.
Incubate the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
Warm selection plates to 37°C.
Spread 100 μl of the cells onto the selection plates. Use Amp plates for positive control sample.
Incubate overnight at 37°C.

Transformation (Gibson, Ligations)
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

ASDF

Monday 26^th August

Picking colonies (Trafo Gibson, BBC SPCR5/7)
chosing 5-7 colonies and start liquid cultures

Detect

ASDF

Tuesday 27^th August

Starting liquid cultures and Miniprep of pS.005 and pS.006.

Starting liquid cultures
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Miniprep of pS.005 and pS.006
1) Pellet 2x 9ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Colony PCR

Reagent	Volume
Forward Primer (10 uM)	0,5 ul
Reverse Primer (10 uM)	0,5 ul
Template DNA (Miniprep)	0,5 ul
Quick-Load® Taq 2X Master Mix	12,5 ul
Nuclease-free water	10,0 ul
Total volume	25 ul

Thermocycler Protocol: Dream Taq Green
	Temp	Time
Start	95°C	30 sec1	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46,8°C	30 sec	Anneal
Cycle 3	68°C	1 min per kb	Extend	cellule 2

Finish	68°C	5 min	Extend
Store	10°C	Forever	Store

Detect

ASDF

Wednesday 28^th August

Gel Colony PCR, Liquid Cultures (1:100), Analytical Digest, Gel Ligation/Gibson, Gel Analytical digest, DpnI digest of SPCR5, SPCR6, SPCR7, Gel DpnI digest, PCR purification of DpnI digested SPCR5, SPCR6, SPCR7, Stress test microscope and M13 Test.

Gel Colony PCR
pS005 (C1-C5) - pS006 (C1-C7)
1% 100V 20 min

Liquid Cultures (1:100)
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Analytical Digest

Reagent	Volume
Plasmid Miniprep	5 ul
H2O	12 ul
c10x FastDigest Buffer	2ul
FastDigest Enzyme 1	0,5 ul
FastDigest Enzyme 2	0,5 ul
Total Volume	20,0 ul

Digest for 15 minutes at 37 °C with shaking

Gel Ligation/Gibson
pS005 - pS006 - M13/RFP
1% 100V 20min

Gel Analytical digest
pS005 (C1-C5)-pS006 (C1-C7)
1% 100V 20min

DpnI digest of SPCR5, SPCR6, SPCR7
add 4ul of DpnI into each tube, mix and incubate for 1h at 37°C

Gel DpnI digest
let each 5ul run on a gel
1%, 100V 20min

PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Stress test microscope
Dilute ON cultures of sSP001, sSP002, sSP010, sSP011, sSP012 1:100 and incubate up to an OD of 0.3
Take out 2ml of sSP001, sSP002, sSP010, sSP011
add:
sSP001: 10ug/ml MMC
sSP002: 10ug/ml MMC
sSP010: 20ul sSP012 supernatant
sSP011: 20ul sSP012 supernatant

incubate for 90 min

take pictures under the microscope (trans and YFP) of (un-)treated samples

M13 Test
Liquid cultures of sSP012 and sSP020
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Detect

ASDF

Friday 30^th August

M13 test, DpnI digest (SPCR5,6,7), Gel SPCR5,6,7 and PCR purification of DpnI digested SPCR5, SPCR6, SPCR7

M13 test
dilute ON cultures (NEB turbo, FR-433) 1: 100, grow up to an OD of ~0.6
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

DpnI digest (SPCR5,6,7)
add 8ul DpnI per tube and digest for 1h at 37°, shaking

Gel SPCR5,6,7
1%, 100V, 20min

PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Day Number^suffix Month

Place your twit here

Place your note here

Detect

ASDF

Wednesday 4^th September

Starting Liquid culture, PCRs, Gel, DpnI digest, Digestion of SPCR5,7, Purification of Digestion, Ligation of SPCR5,7, Gibson Assembly, Making Electrocompetent Cells, Transformation, Redo SPCR12/13 ,

Starting Liquid culture
NEB turbo, grow up to an OD of 0.6

PCRs
SPCR1, SPCR2, SPCR4, SPCR12, SPCR13

Reagant	Volume
	1x (SPCR2)	11x (SPCR12)	11x (SPCR13)	8x (SPCR1)	8x (SPCR4)
Nuclease-free water	37.25 µl	447 µl	447 µl	335,25µl	335,25µl
5x Phusion HF Buffer	10 µl	120 µl	120 µl	90 µl	90 µl
10 mM dNTPs	1 µl	12 µl	12 µl	9 µl	9 µl
Forward Primer (10 uM)	0.5 µl	6 µl	6 µl	4.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	6 µl	6 µl	4.5 µl	4.5 µl
Template Plasmid	0.25 µl	3 µl	3 µl	2.25 µl	2.25 µl
Phusion DNA Polymerase	0.5 µl	6 µl	6 µl	4,5 µl	4,5 µl
Total Volume	50 µl	600 µl	600 µl	450 µl	450 µl

for SPCR 12/13 gradient, 2,5 min
for SPCR3, SPCR11 51°, 45s
for SPCR 1, SPCR2, 48,8°, 2 min
for SPCR4, 40,8°, 1 min

Gel
1%, 100V, 20 min

1.small gel (SPCR1,2,3,4,11)
2. big gel (SPCR12)
3. big Gel (SPCR13)

DpnI digest
SPCR 1: add 10ul DpnI
SPCR4: add 10ul DpnI
SPCR2,3,11: add 1 ul DpnI

incubate for 1h at 37°

Digestion of SPCR5,7

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
XbaI	1 µl
SpeI	1 µl
Total Volume	20.0 µl

Incubate for 1h at 37°, shaking

Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Ligation of SPCR5,7

Reagent	Volume
Vector	1 µl
Insert	3 µl
H2O	4.5 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

Incubate at room temperature for ~1h

Gibson Assembly

Amount per Reaction : Positive Control**

PCR Fragment(s)+ linearized vector : 2-10 μl (0.02–0.5 pmols)*

Gibson Assembly Master Mix (2X): 10 μl

Deionized H2O : XX μl

Total Volume : 20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice
Insert: 2,4 ul
Vector: 0,6 ul

Making Electrocompetent Cells

1) Start a liquid culture of cells. NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS005, pS006, SPCR3 (IDT plasmid) M13mp18
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Redo SPCR12/13

Reagent	Volume
	11x (SPCR12)	11x (SPCR13)
Nuclease-free water	447 µl	447 µl
5x Phusion HF Buffer	120 µl	120 µl
10 mM dNTPs	12 µl	12 µl
Forward Primer (10 uM)	6 µl	6 µl
Reverse Primer (10 uM)	6 µl	6 µl
Template Plasmid	3 µl	3 µl
Phusion DNA Polymerase	6 µl	6 µl
Total Volume	600 µl	600 µl

Cycling protocol as usual + gradient + topdown

Detect

ASDF

Thursday 5^th September

Gel, Colony PCR, Topdown PCR and gels

Gel
SPCR12, SPCR13
1%, 100V, 20 min

Pictures: 13/09/05_SPCR12_corresponding primers

13/09/05_SPCR13_corresponding primers

Colony PCR

Reagent	Volume
Forward Primer (10 uM)/td>	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Total Volume	25 ul

Thermocycler Protocol: DreamTaq Green PCR MM
	Temp	Time
Start	95°C	1 min	Melt

Cycle 1	95°C	30 sec	Melt	35 cycles
Cyle 2	52.6/46.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72°C	10 min	Extend
Store	10°C	Forever	Store

Topdown PCR
SPCR 1,4,12,13

Reagent	Volume
	x1>/b>
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

increases every cycle 1°C, starting from 40°

Gels
1%, 100V, 20+ Min

Pictures:
13/09/05_colony PCR_pS005_C1-C8_BB verification primers

13/09/05_colony PCR_pS005_C9-C16_BB verification primers

13/09/05_colony PCR_pS006_C1-C8_BB verification primers

13/09/05_colony PCR_pS006_C9-C16_BB verification primers

13/09/05_top down PCR_SPCR1,4,12,13

Detect

ASDF

Friday 6^th September

Place your twit here

Digestions: linearized pSB1C3, linearized pSB1A3, SPCR2, SPCR3, SPCR11

Reagent	Volume
Purified PCR Product	16 µl
H2OH2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
cFastDigest Enzyme 2	1 µl
Total Volume	4 µl

SPCR5, pSB1C3: XbaI/SpeI
SPCR11, pSB1A3, pSB1C3: EcoRI/PstI
SPCR13, pSB1A3, pSB1C3: EcoRI/PstI
SPCR2, pSB1A3, pSB1C3: EcoRI/PstI

1h at 37° shaking

Detect

ASDF

Saturday 7^th September

Ligation, Making Electrocompetent Cells, Gibson Assembly, Transformation, Liquid culture of E1010

Ligation

Reagent	Volume
Vector	1 µl
Insert	3 µl
H2O	4.5 µl
Fermentas T4 Ligase Buffer	1
Fermentas T4 Ligase Enzyme	0.5
Total Volume	10 µl

SPCR5, pSB1C3
SPCR11, pSB1A3, pSB1C3
SPCR13, pSB1A3, pSB1C3
SPCR2, pSB1A3, pSB1C3

Incubate at room temperature for 10 minutes.

Making Electrocompetent Cells
1) Start a liquid culture of cells.
NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Gibson Assembly

Amount per Reaction
Positive Control**

PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*

Gibson
Assembly Master
Mix (2X)
10 μl

Deionized H2O
XX μl

Total Volume
20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice

Transformation pS002 (Chl), pS002 (Amp), pS003 (Amp), pS004 (Chl), pS004 (Amp), pS005 (Chl), pS006-7 (Chl), pS007 (Chl), pS008 (Amp), pS009 (Chl), pS012 (Amp), pS013 (Chl), pS013 (Amp)

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Liquid culture of E1010

Detect

ASDF

Sunday 8^th September

Replating of transformation and Miniprep of E1010

Replating of Transformation

Miniprep of E1010
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Monday 16^th September

Result Cloning, Protocol: E. coli Colony PCR, Extraction of DNA, PCR Reaction and Gels

Result Cloning:
Colonies?
pS002 (Chl): no
pS002 (Amp): yes
pS003 (Amp):yes
pS004 (Chl): no
pS004 (Amp): yes
pS005 (Chl): yes
pS006-7 (Chl): yes
pS006 (Chl): no
pS007 (Chl): yes
pS008 (Amp): yes
pS009 (Chl): yes
pS012 (Amp): yes
pS013 (Chl): no
pS013 (Amp): yes

Protocol: E. coli Colony PCR
Using the Dream Taq Master Mix

Extraction of DNA

1) Pick a single colony into 50 ul of H20.

2) Boil for 5 minutes.

PCR Reaction (pS002 (Chl-Lig), pS005 (Chl-G), pS006-7 (Chl-Lig), pS007 (Chl-G), pS008 (Amp-G), pS009 (Chl-G))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Nuclease-free water	10 ul
Total Volume	25 ul

Thermocycler Protocol: NEB Quick-Load
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	45.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	15 min	Extand
Store	10°C	Forever	Store

Gels
100V, 25-30 min, 1%

Pictures:
13/09/16_colony PCR_ps007.BMP

13/09/16_colony PCR_pS006-7.BMP

13/09/16_colony PCR_ps005.BMP

Result: didn’t work

Detect

ASDF

Tuesday 17^th September

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume
Forward Primer (10 uM)	0.5 ul
Reverse Primer (10 uM)	0.5 ul
Template DNA (from above)	1.5 ul
Quick-Load® Taq 2X Master Mix	12.5 ul
Nuclease-free water	10 ul
Total Volume	25 ul

Thermocycler Protocol: NEB Quick-Load
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	45.8 °C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	15 min	Extand
Store	10°C	Forever	Store

Gels
100V, 30 min, 1%

Pictures: 13/09/17_colony PCR_pS009.JPG

13/09/17_colony PCR_pS008_pS002.jpg

13/09/17_colony PCR_pS003.JPG

13/09/17_colony PCR_pS004.JPG

13/09/17_colony PCR_pS012.JPG

13/09/17_colony PCR_pS013.JPG

Result:
pS003: row 3,5 might have worked -> analytical digest
pS004: all might have worked -> analytical digest
pS013: all might have worked -> analytical digest
pS012: row 3,4,5 might have workes -> analytical digest

Sequencing
Bringing primers/plasmids away for sequencin
Bacbbone, SPCR2 with iS002, iS032, iS028, iS029, iS030

Detect

ASDF

Wednesday 16^th September

Ligations

Ligation

SPCR2 - Chl

Reagent	Volume
SPCR2	1 µl
Chl	2,95 µl
H2O	4.55 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR2 - Amp

Reagent	Volume
SPCR2	1 µl
Amp	3.4 µl
H2O	4.1 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR3 - Chl

Reagent	Volume
SPCR3	1 µl
Amp	1.79 µl
H2O	5.71 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR3 - Amp7

Reagent	Volume
Amp	1 µl
SPCR 3	1.56 µl
H2O	5.94 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR5 - Chl

Reagent	Volume
SPCR 5	0.5 µl
Chl	4.55 µl
H2O	3.45 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR11 - Chl

Reagent	Volume
Chl	1 µl
SPCR11	1.3 µl
H2O	6.2 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

SPCR2 - Amp

Reagent	Volume
Amp	1 µl
SPCR11	1.13 µl
H2O	6.37 µl
Fermentas T4 Ligase Buffer	1.0 µl
Fermentas T4 Ligase Enzyme	0.5 µl
Total Volume	10 µl

at 16° for 1h

Transformation
1) Thaw competent cells on ice (Gibson Kit competent cells)
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Gel of Ligation products
1%, 100V, 40 min

Detect

ASDF

Sunday 22^nd September

PCR and Gels

PCR
M13 backbone

SPCR16,17

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Protocol see fotos

Gel 100V, 1%, 1,5h

Detect

ASDF

Monday 23^rd September

Gels and PCR

Gel
100V, 1%, 1,5h

Picture: 13/09/23_SPCR16_17_corresponding primers - PCRs didn't worked

PCR
SPCR 16 (normal phusion at 48°C)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: NEB Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2	72°C	30 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Detect

ASDF

Tuesday 24^th September

Overlap PCR, PCR of Overlap, Digestion, Gel extraction, Gels, PCR Purification, PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3) and liquid culture

Overlap PCR
SPCR5-SPCR2

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Template Plasmid(10 uM)	1 µl
Template Plasmid (10 uM)	1 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

PCR of Overlap

Digestion
M13 (EcoRI, PstI), pSB1C3 (EcoRI, PstI), psB1C3 (XbaI, SpeI)

Reagent	Volume
Purified Plasmid	20 µl
H2O	63 µl
10x FastDigest Buffer	10 µl
FastDigest Enzyme 1	2.5 µl
FastDigest Enzyme 2	2.5 µl
FastAP Phosphatase	2 µl
Total Volume	100 µl

SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI)

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
FastDigest Enzyme 2	1 µl
Total Volume	20 µl

Gel
pSB1C3
1%, 100V, 1h
Picture: 13/09/24_pSB1C3 digest_EcoRI/PstI_XbaI/SpeI - digest worked

Gel extraction
1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
3. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
4. Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products) 5. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
6. Discard flow-through and place QIAquick column back in the same collection tube.
7. To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
8. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
9. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
10. To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

Gel
PCR Overlap
1%, 100V, 1h
Picture: 13/09/24_Overlap PCR PCR SCPR5_SPCR2 - PCR didn't work

PCR Purification (M13 (EcoRI, PstI), SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI))
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3)
each 8x

Reagent	Volume
	1x
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Liquid culture
NEB, sSP004, Fr-433

Detect

ASDF

Wednesday 25^th September

Gel of PCR, PCR (SPCR5,6) and Miniprep Cas9, M13mp18

Gel of PCR
1%, 100V, 1h

Picture: 13/09/25_SPCR2-11 - SPCR2: worked, SPCR3: worked, SPCR5: didn't work, SPCR6: didn't work, SPCR7: didn't work, SPCR8: didn't work, SPCR9: didn't work, SPCR10: didn't work, SCPR11: worked

PCR (SPCR5,6)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	1 µl
Reverse Primer (10 uM)	1 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Miniprep Cas9, M13mp18
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

ASDF

Thursday 26^th September

Gel PCR 5,6, Digestion, PCR (SPCR7-10) and PCR purification

Gel PCR 5,6 1%, 100V, 1h

Picture: 13/09/26_SPCR5_6 - PCR didn't work

Digestions: SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Reagent	Volume
Purified PCR Product	16 µl
H2O	0 µl
10x FastDigest Buffer	2 µl
FastDigest Enzyme 1	1 µl
FastDigest Enzyme 2	1 µl
Total Volume	20 µl

PCR (SPCR7-10)

Reagent	Volume
	x1
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	1 µl
Reverse Primer (10 uM)	1 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

PCR Purification: (SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

ASDF

Friday 27^th September

Gel SPCR7-10, NEB liquid culture, Ligation, Electrocompetent cells and transformation

Gel SPCR7-10
1%, 100V, 1h

Picture: 13/09/27_SPCR7_8_9_10 - PCRs worked

NEB liquid culture
1:1000 of ON culture

Ligation

pS006

Reagent	Volume
SPCR5	1 µl
SPCR7	0,28 µl
H2O	7.22 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS006’

Reagent	Volume
SPCR5	1 µl
lin pSB1C3 (XbaI/SpeI)	0,47 µl
H2O	7.03 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS006*

Reagent	Volume
SPCR5	1 µl
lin pSB1A3 (XbaI/SpeI)	0,67 µl
H2O	6.83 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013

Reagent	Volume
SPCR4	1 µl
SPCR11	0,24 µl
H2O	7.26 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013'

Reagent	Volume
lin pSB1C3 (EcoRI, SpeI)	1 µl
SPCR11	0,28 µl
H2O	7.22 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS013*

Reagent	Volume
lin pSB1A3 (EcoRI, PstI))	1 µl
SPCR11	0,3 µl
H2O	7.2 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004

Reagent	Volume
SPCR4	1 µl
SPCR3	0,2 µl
H2O	7.3 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004'

Reagent	Volume
lin pSB1C3 (EcoRI, PstI)	1 µl
SPCR3	0,3 µl
H2O	7.2 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS004*

Reagent	Volume
lin pSB1A3 (EcoRI, PstI)	1 µl
SPCR3	0,27 µl
H2O	7.23 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS002'

Reagent	Volume
SPCR2	1 µl
lin pSB1C3 (EcoRI, PstI)	0,8 µl
H2O	6.7 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

pS002*

Reagent	Volume
SPCR2	1 µl
lin pSB1A3 (EcoRI, PstI)	0,6 µl
H2O	6.9 µl
Fermentas T4 Ligase Buffer	1 µl
Fermentas T4 Ligase Enzime	0.5 µl
Total Volume	10 µl

45min at 22°, 15 min at 16°

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS006, pS006’, pS006*, pS013, pS013’, pS013*, pS004, pS004’, pS004*, pS002’, pS002*

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

ASDF

Saturday 28^th September

Extraction of Genomic DNA, PCR Reaction and Restreak plates

Protocol: E. coli Colony PCR (pS006’, pS006*, pS013, pS004, pS004*, pS002*)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8
Pipet 2 ul into 5ml Media with antibiotics to make liquid cultures

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume	9x Volume
Forward Primer (10 uM)	0.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	4.5 µl
Template DNA (from above)	1.5 µl	13.5 µl
Quick-Load® Taq 2X Master Mix	12.5 µl	112.5 µl9x Volume
Nuclease-free water	10 µl	90 µl
Total Volume	25 µl	125 µl

Thermocycler Protocol: Green Dream Taq
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46.8°C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	10 min	Extand
Store	10°C	Forever	Store

Restreak plates
Some of the plates were too full grown -> Rstreak for single colonies

Detect

ASDF

Monday 30^th September

Extraction of Genomic DNA, PCR reaction, Gels, Miniprep, PCR: SPCR5, SPCR6 and Liquid culture of pS004’ and pS013’

Protocol: E. coli Colony PCR (pS006, pS013’,pS013*, pS004’, pS002’)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent	Volume	9x Volume
Forward Primer (10 uM)	0.5 µl	4.5 µl
Reverse Primer (10 uM)	0.5 µl	4.5 µl
Template DNA (from above)	1.5 µl	13.5 µl
Quick-Load® Taq 2X Master Mix	12.5 µl	112.5 µl9x Volume
Nuclease-free water	10 µl	90 µl
Total Volume	25 µl	125 µl

Thermocycler Protocol: Green Dream Taq
	Temp	Time
Start	95°C	30 sec	Melt

Cycle 1	95°C	15 sec	Melt	35 cycles
Cycle 2	46.8°C	30 sec	Anneal
Cycle 3	72°C	1 min per kb	Extend

Finish	72 °C	10 min	Extand
Store	10°C	Forever	Store

Gels
1%, 100V, 45 min

Pictures + Results
13/09/30_colony pcr_pS004_pS013 - 1-8: pS004 (gRNA - Amp), 9-16: pS013 (crRNA - Amp) - seems to have worked beside pS013 C7

13/09/30_colony PCR_pS004*_pS002* - 1-8: pS004* (gRNA - Amp), 9-16: pS002 (reporter - Amp) - pS004* seems to have worked (C1, C2, C3, C6)

13/09/30_colony PCR_pS006'_pS006* - 1-8: pS006' (Cas9 - Chl), 9-16: pS006* (Cas9 - Amp) - didn’t work

13/09/30_Colony PCR_pS013'_pS013* - 1-8: pS013' (crRNA - Chl), 9-16: pS013* (crRNA - Amp) - Seems to have worked beside 13’ C7, C8

13/09/30_colony PCR_pS004'_pS002' - 1-8: pS004' (gRNA - Chl), 9-16: pS002' (reporter - Chl) - pS004' seems to have worked beside C6

13/09/30_Colony PCR_pS006 - didn’t work

other gel images that proof that the reporter as well as the Cas9 construct worked will follow soon!

Miniprep
pS013, pS004
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

PCR: SPCR5, SPCR6 (gradient + touch down 55-75, -1°/cycle)

Reagent	Volume
	11x
Nuclease-free water	37.25 µl
5x Phusion HF Buffer	10 µl
10 mM dNTPs	1 µl
Forward Primer (10 uM)	0.5 µl
Reverse Primer (10 uM)	0.5 µl
Template Plasmid)	0.25 µl
Phusion DNA Polymerase	0.5 µl
Total Volume	50 µl

Thermocycler Protocol: Fermentas Phusion
	Temp	Time
Start	98°C	30 sec	Melt

Cycle 1	98°C	5 sec	Melt	35 cycles
Cycle 2		25 sec	Anneal
Cycle 3	72°C	30 sec per kb	Extend

Finish	72 °C	5 min	Extand
Store	10°C	Forever	Store

Detect

ASDF

Tuesday 15^th October

Digestion Reporter and SPCR3

BB: SpeI, PstI
SPCR: XbaI, PstI
2h 37°, heat inactivation

Electrocompetent cells: sSP008, sSP009
Transform SPCR2-A3/C3 both into sSP008/9

Detect

ASDF

Design of SirA genes for synthesis

SirA

Mycobacterium tuberculosis
Reference: Pinto et al. 2007. Sulfite Reduction in Mycobacteria doi: 10.1128/JB.00487-07
Primers:
TBsirA F GGAATTCCATATGTCCGCGAAGGAGAACCCC
TBsirA R AAGGAAAAAAGCGGCCGCTCATCGCAGGTCGTCCTCCTCGGCCCGGAT
We blasted the above primers used to clone sirA from M. tuberculosis into E. coli. We then extracted the sequence from genbank to retrieve the following sequence which includes the restriction sites introduced by Pinto et al.

ggaattccat atgtccgcga aggagaaccc ccaaatgacc actgcacgtc
ccgccaaggc tcgaaatgag ggccagtggg cgctgggaca tcgcgagcca
ctcaacgcca acgaagagct gaagaaggcc ggcaacccgc tcgacgtgcg
ggagcgcatc gaaaacatct acgccaaaca gggtttcgac agcatcgaca
agaccgacct gcgagggcgc tttcgctggt ggggcctgta cacccagcgt
gagcagggct acgacggcac ctggaccggt gacgacaaca tcgacaagct
cgaggccaaa tacttcatga tgcgggtgcg ttgcgacggc ggcgcgctct
cggctgccgc gctgcgcacg ctgggccaga tctcgacgga gttcgcgcgc
gataccgccg atatctccga ccggcagaac gtgcaatacc actggatcga
agtggaaaac gtccctgaaa tctggcgacg gttagacgat gtcggactgc
agaccaccga ggcgtgcggt gactgcccgc gggtagtgct gggctcgccg
ttggccggcg agtcgctcga cgaagtgctc gacccgacct gggcgatcga
ggagatcgtg cgtcgctaca tcggcaagcc cgacttcgcc gacttgccgc
gcaagtacaa gaccgccatc tctggcctgc aggacgtcgc gcacgagatc
aacgacgtcg ccttcatcgg cgtcaaccat cccgagcacg gaccaggcct
ggatctgtgg gtgggcggtg gactgtcgac caacccgatg ctggcccagc
gggtcggcgc ctgggttcca ctgggcgaag tgcccgaggt gtgggcggcg
gtcacctcgg tgtttcgcga ctacggctac cggcgactgc gcgccaaggc
ccggctgaaa tttctgatca aagactgggg catagcgaag ttccgcgaag
tgctcgaaac cgagtacctc aagcgtccgc tgatcgacgg tccggccccc
gaaccggtca agcatccgat cgaccacgtc ggggtgcaac gactcaagaa
cgggctcaac gccgtcggag tcgcccccat cgccgggcgg gtatcgggca
ccatcctcac ggcggtcgcc gacctgatgg cgcgggccgg ttccgaccgg
atccggttca ccccctacca gaagctggtc atcctcgaca ttccggacgc
cttgctcgac gacttgatcg ccggtctgga cgcgctgggg ctgcagtcgc
gcccgtcgca ttggcgccgg aacttgatgg cgtgcagcgg gattgagttc
tgcaagttgt cattcgccga aacccgggtt cgagcacagc atttggtgcc
cgagctggaa cgccggcttg aggacatcaa ctcgcagctc gacgtaccga
tcaccgtcaa catcaacggc tgcccgaact catgtgcgcg aattcaaatc
gccgacatcg gattcaaggg acagatgatc gacgacggac acggcggctc
cgtcgaaggc ttccaggtgc atctgggcgg acacctcggc ctggatgccg
gattcggccg caaactgcgc cagcacaagg tcaccagtga cgaactcggc
gactacatcg accgggtggt gcgcaacttc gtcaaacacc gcagcgaagg
tgaacgcttc gcgcagtggg tcatccgggc cgaggaggac gacctgcgat
gagcggccgc ttttttcctt

This sequence was then inserted into Geneious. The PstI and EcoRI sites were manually removed and replaced with silent mutations. A NcoI site was inserted at the start codon and an extra glycine was added after the start codon for the NcoI site to function properly. We chose glycine as it is small an unlikely to interfere with either polar or non-polar domains within the protein. We used GGC as the codon as it is the highest used glycine codon in e. coli. We also added an AvrII site on the 3’ end of the site. We then added biobrick restriction sites on the ends of the sequence (EcoRI, XbaI, SpeI, PstI). This will allow us to clone into our expression vector pACYCDuet-1 with NcoI and AvrII enzymes and into a biobrick registry with EcoRI and PstI. The insertion into pACYCDuet-1 removes both protein tags and cuts out the second MCS resulting in vector pACYCDuet-TBsirA. The resulting sequence for TB SirA follows:

catggaattc tagaccatgg gctccgcgaa ggagaacccc caaatgacca
ctgcacgtcc cgccaaggct cgaaatgagg gccagtgggc gctgggacat
cgcgagccac tcaacgccaa cgaagagctg aagaaggccg gcaacccgct
cgacgtgcgg gagcgcatcg aaaacatcta cgccaaacag ggtttcgaca
gcatcgacaa gaccgacctg cgagggcgct ttcgctggtg gggcctgtac
acccagcgtg agcagggcta cgacggcacc tggaccggtg acgacaacat
cgacaagctc gaggccaaat acttcatgat gcgggtgcgt tgcgacggcg
gcgcgctctc ggctgccgcg ctgcgcacgc tgggccagat ctcgacggag
ttcgcgcgcg ataccgccga tatctccgac cggcagaacg tgcaatacca
ctggatcgaa gtggaaaacg tccctgaaat ctggcgacgg ttagacgatg
tcggacttca gaccaccgag gcgtgcggtg actgcccgcg ggtagtgctg
ggctcgccgt tggccggcga gtcgctcgac gaagtgctcg acccgacctg
ggcgatcgag gagatcgtgc gtcgctacat cggcaagccc gacttcgccg
acttgccgcg caagtacaag accgccatct ctggccttca ggacgtcgcg
cacgagatca acgacgtcgc cttcatcggc gtcaaccatc ccgagcacgg
accaggcctg gatctgtggg tgggcggtgg actgtcgacc aacccgatgc
tggcccagcg ggtcggcgcc tgggttccac tgggcgaagt gcccgaggtg
tgggcggcgg tcacctcggt gtttcgcgac tacggctacc ggcgactgcg
cgccaaggcc cggctgaaat ttctgatcaa agactggggc atagcgaagt
tccgcgaagt gctcgaaacc gagtacctca agcgtccgct gatcgacggt
ccggcccccg aaccggtcaa gcatccgatc gaccacgtcg gggtgcaacg
actcaagaac gggctcaacg ccgtcggagt cgcccccatc gccgggcggg
tatcgggcac catcctcacg gcggtcgccg acctgatggc gcgggccggt
tccgaccgga tccggttcac cccctaccag aagctggtca tcctcgacat
tccggacgcc ttgctcgacg acttgatcgc cggtctggac gcgctggggc
ttcagtcgcg cccgtcgcat tggcgccgga acttgatggc gtgcagcggg
attgagttct gcaagttgtc attcgccgaa acccgggttc gagcacagca
tttggtgccc gagctggaac gccggcttga ggacatcaac tcgcagctcg
acgtaccgat caccgtcaac atcaacggct gcccgaactc atgtgcgcga
gttcaaatcg ccgacatcgg attcaaggga cagatgatcg acgacggaca
cggcggctcc gtcgaaggct tccaggtgca tctgggcgga cacctcggcc
tggatgccgg attcggccgc aaactgcgcc agcacaaggt caccagtgac
gaactcggcg actacatcga ccgggtggtg cgcaacttcg tcaaacaccg
cagcgaaggt gaacgcttcg cgcagtgggt catccgggcc gaggaggacg
acctgcgatg agcggccgcc taggactact agtctgcagt ttttcctt

Mycobacterium smegmatis
This reference also contains the cloning of sirA from T. smegmatis. We used the primers below taken from Pinto et al, blasted against the T. smegmatis genome and extracted the sirA sequence from genbank as above.
Primers:
smegsirA F TACAGCTGATGCTCGAAGACGAGTACTTCAT
smegsirA R CCCAAGCTTTCACGTTGCCTACCTCAAATCCGCTTCGTC

tacagctgat gctcgaagac gagtacttca tgctgcgcgt gcgctgcgat
ggtggcgcgc tgaccactgc agcgctgcgc acgctcggcg gcatctcgac
cgagttcgcg cgcgacaccg ccgacatctc cgaccgcgag aacgtccagt
accactggat ccaggtcgag aacatgcccg agatctggaa gcgcctcgac
gccgtcggcc tgcagaccac cgaggcgtgc ggcgactgcc cgcgtgtggt
cctcggctcg ccgctggccg gtgagtccct cgacgaggtg atcgacggga
cccccgcgat cgacgagatc gtgcgccgct acatcggcaa gcccgagtac
tcgaacctgc cgcgcaagtt caagaccgcg atctcggggc ttcaggacgt
ggtccacgag gtcaacgacg tcgcgttcat cggcgtcaac caccccgagc
acggcccggg cttcgacctg tgggtcggtg gcggcctgtc gaccaacccg
atgctggccc agcgcgtcgg ggtgtgggtg ccgctcgacg aggtgcccga
cgtctgggag ggcgtcgtca gcatcttccg cgactacggt taccggcgtc
tgcggtcgaa ggcgcggctg aagttcctga tcaaggactg gggcgtcgaa
aagttcaggg aagtgctgga aaccgagtac ctcaagcgcc ccctgatcga
cggcccggca cccgaaccgg tgacccgccc catcgaccac gtcggtgtgc
agaagctcaa gaacggcctc aacgccgtgg gcgtcgcccc gatcgcgggt
cgcgtctcgg gcacgatcct gaccaaggtg gccgatctcg ccgaggccgc
cgggtccgac cggatccgct tcacgccgta ccagaagctg atcatcctcg
acgtgcccga cgacaagatc gacgaactgc gcgctggcct cgacgcgctc
ggactgccgt cgacgccgtc gcactggcgc cgcaacctca tggcgtgcac
gggtatcgag ttctgcaagc tgagcttcgc cgagacccgc aagcgtgccc
aggtgctggt tcccgagctg gagaaacggc tcgacgacat caacgcccag
ctcgacgtgc ccatcacggt caacatcaac ggctgcccca actcgtgcgc
ccgtatccag gtcgccgaca tcgggttcaa gggccagatg gtcgacgatg
gcaacggccc cgaggagggt ttccaggtgc atctgggcgg cagcctgggc
ctggacagcg ggttcggccg caagctgcgc cagcacaagg tgctctcgtc
cgagctcggc gactacatcg agcgcgtcgt gcgcaacttc gtgaaacaac
gcgaggacgg cgagcgtttc gcccagtggg ccgtgcgggc cgacgaagcg
gatttgaggt aggcaacgtg aaagcttggg

As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. This resulted in the following sequence for synthesis:

tacagaattc tagaccatgg gcctcgaaga cgagtacttc atgctgcgcg
tgcgctgcga tggtggcgcg ctgaccacta cagcgctgcg cacgctcggc
ggcatctcga ccgagttcgc gcgcgacacc gccgacatct ccgaccgcga
gaacgtccag taccactgga tccaggtcga gaacatgccc gagatctgga
agcgcctcga cgccgtcggc ctacagacca ccgaggcgtg cggcgactgc
ccgcgtgtgg tcctcggctc gccgctggcc ggtgagtccc tcgacgaggt
gatcgacggg acccccgcga tcgacgagat cgtgcgccgc tacatcggca
agcccgagta ctcgaacctg ccgcgcaagt tcaagaccgc gatctcgggg
cttcaggacg tggtccacga ggtcaacgac gtcgcgttca tcggcgtcaa
ccaccccgag cacggcccgg gcttcgacct gtgggtcggt ggcggcctgt
cgaccaaccc gatgctggcc cagcgcgtcg gggtgtgggt gccgctcgac
gaggtgcccg acgtctggga gggcgtcgtc agcatcttcc gcgactacgg
ttaccggcgt ctgcggtcga aggcgcggct gaagttcctg atcaaggact
ggggcgtcga aaagttcagg gaagtgctgg aaaccgagta cctcaagcgc
cccctgatcg acggcccggc acccgaaccg gtgacccgcc ccatcgacca
cgtcggtgtg cagaagctca agaacggcct caacgccgtg ggcgtcgccc
cgatcgcggg tcgcgtctcg ggcacgatcc tgaccaaggt ggccgatctc
gccgaggccg ccgggtccga ccggatccgc ttcacgccgt accagaagct
gatcatcctc gacgtgcccg acgacaagat cgacgaactg cgcgctggcc
tcgacgcgct cggactgccg tcgacgccgt cgcactggcg ccgcaacctc
atggcgtgca cgggtatcga gttctgcaag ctgagcttcg ccgagacccg
caagcgtgcc caggtgctgg ttcccgagct ggagaaacgg ctcgacgaca
tcaacgccca gctcgacgtg cccatcacgg tcaacatcaa cggctgcccc
aactcgtgcg cccgtatcca ggtcgccgac atcgggttca agggccagat
ggtcgacgat ggcaacggcc ccgaggaggg tttccaggtg catctgggcg
gcagcctggg cctggacagc gggttcggcc gcaagctgcg ccagcacaag
gtgctctcgt ccgagctcgg cgactacatc gagcgcgtcg tgcgcaactt
cgtgaaacaa cgcgaggacg gcgagcgttt cgcccagtgg gccgtgcggg
ccgacgaagc ggatttgagg taggcaacgt gaaagcctag gtactagtct
gcagtggg

Target

ASDF

Tuesday 11^th June

Design of FdrA genes for synthesis

FdrA

Mycobacterium tuberculosis
Reference: McLean et al. 2003. Kinetic, spectroscopic and thermodynamic characterization of the Mycobacterium tuberculosis adrenodoxin reductase homologue FprA. doi: 10.1042/BJ20021692
Primers:
MtbfdrA F TATGACTCATATGCGTCCCTATTACATCGCCATCG
MtbfdrA R ATCCGGGATCCTCAGCCGAGCCCAATCCGCAACAGC
The above primers were blasted to retrieve sequence of FprA from genebank resulting in the following sequence:

tatgactcat atgcgtccct attacatcgc catcgtgggc tccgggccgt
cggcgttctt cgccgcggca tccttgctga aggccgccga cacgaccgag
gacctcgaca tggccgtcga catgctggag atgttgccga ctccctgggg
gctggtgcgc tccggggtcg cgccggatca ccccaagatc aagtcgatca
gcaagcaatt cgaaaagacg gccgaggacc cccgcttccg cttcttcggc
aatgtggtcg tcggcgaaca cgtccagccc ggcgagctct ccgagcgcta
cgacgccgtg atctacgccg tcggcgcgca gtccgatcgc atgttgaaca
tccccggtga ggacctgccg ggcagtatcg ccgccgtcga tttcgtcggc
tggtacaacg cacatccaca cttcgagcag gtatcacccg atctgtcggg
cgcccgggcc gtagttatcg gcaatggaaa cgtcgcgcta gacgtggcac
ggattctgct caccgatccc gacgtgttgg cacgcaccga tatcgccgat
cacgctttgg aatcgctacg cccacgcggt atccaggagg tggtgatcgt
cgggcgccga ggtccgctgc aggccgcgtt caccacgttg gagttgcgcg
agctggccga cctcgacggg gttgacgtgg tgatcgatcc ggcggagctg
gacggcatta ccgacgagga cgcggccgcg gtgggcaagg tctgcaagca
gaacatcaag gtgctgcgtg gctatgcgga ccgcgaaccc cgcccgggac
accgccgcat ggtgttccgg ttcttgacct ctccgatcga gatcaagggc
aagcgcaaag tggagcggat cgtgctgggc cgcaacgagc tggtctccga
cggcagcggg cgagtggcgg ccaaggacac cggcgagcgc gaggagctgc
cagctcagct ggtcgtgcgg tcggtcggct accgcggggt gcccacgccc
gggctgccgt tcgacgacca gagcgggacc atccccaacg tcggcggccg
aatcaacggc agccccaacg aatacgtcgt cgggtggatc aagcgcgggc
cgaccggggt gatcgggacc aacaagaagg acgcccaaga caccgtcgac
accttgatca agaatcttgg caacgccaag gagggcgccg agtgcaagag
ctttccggaa gatcatgccg accaggtggc cgactggcta gcagcacgcc
agccgaagct ggtcacgtcg gcccactggc aggtgatcga cgctttcgag
cgggccgccg gcgagccgca cgggcgtccc cgggtcaagt tggccagcct
ggccgagctg ttgcggattg ggctcggctg aggatcccgg at

As previously, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. However, in the case of FdrA, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:

tatgaattct agatcatatg cgtccctatt acatcgccat cgtgggctcc
gggccgtcgg cgttcttcgc cgcggcatcc ttgctgaagg ccgccgacac
gaccgaggac ctcgacatgg ccgtcgacat gctggagatg ttgccgactc
cctgggggct ggtgcgctcc ggggtcgcgc cggatcaccc caagatcaag
tcgatcagca agcaattcga aaagacggcc gaggaccccc gcttccgctt
cttcggcaat gtggtcgtcg gcgaacacgt ccagcccggc gagctctccg
agcgctacga cgccgtgatc tacgccgtcg gcgcgcagtc cgatcgcatg
ttgaacatcc ccggtgagga cctgccgggc agtatcgccg ccgtcgattt
cgtcggctgg tacaacgcac atccacactt cgagcaggta tcacccgatc
tgtcgggcgc ccgggccgta gttatcggca atggaaacgt cgcgctagac
gtggcacgga ttctgctcac cgatcccgac gtgttggcac gcaccgatat
cgccgatcac gctttggaat cgctacgccc acgcggtatc caggaggtgg
tgatcgtcgg gcgccgaggt ccgcttcagg ccgcgttcac cacgttggag
ttgcgcgagc tggccgacct cgacggggtt gacgtggtga tcgatccggc
ggagctggac ggcattaccg acgaggacgc ggccgcggtg ggcaaggtct
gcaagcagaa catcaaggtg ctgcgtggct atgcggaccg cgaaccccgc
ccgggacacc gccgcatggt gttccggttc ttgacctctc cgatcgagat
caagggcaag cgcaaagtgg agcggatcgt gctgggccgc aacgagctgg
tctccgacgg cagcgggcga gtggcggcca aggacaccgg cgagcgcgag
gagctgccag ctcagctggt cgtgcggtcg gtcggctacc gcggggtgcc
cacgcccggg ctgccgttcg acgaccagag cgggaccatc cccaacgtcg
gcggccgaat caacggcagc cccaacgaat acgtcgtcgg gtggatcaag
cgcgggccga ccggggtgat cgggaccaac aagaaggacg cccaagacac
cgtcgacacc ttgatcaaga atcttggcaa cgccaaggag ggcgccgagt
gcaagagctt tccggaagat catgccgacc aggtggccga ctggctagca
gcacgccagc cgaagctggt cacgtcggcc cactggcagg tgatcgacgc
tttcgagcgg gccgccggcg agccgcacgg gcgtccccgg gtcaagttgg
ccagcctggc cgagctgttg cggattgggc tcggctgagg atccctagga
ctagtctgca gttacg

Mycobacterium smegmatis
We didn't find a reference of M. Smegmatis FprA being cloned into E. coli so we used the following sequenced data:

atgcgcccgt accacgtagc gatcgtcggc tcaggaccct ccggattctt
tgctgccgca tcgctgctga agtttgccga ctctcaaccc gaccgcgatg
tccgcgtgga catgctcgag atgctgccga ccccgtgggg tctggtgcgc
tccggcgtcg ctcccgacca tccgaagatc aagtcgatca gcgcccagtt
cgagaagacc gcggccgacc cccgcttccg gttcttcggc aacgtccggg
tcggtgagca cgtccaaccg ggcgaactcg ccgaacgcta cgacgccgtc
gtctacgcca ccggcgcaca gtccgaccgc gcgctgaaca tccccggcga
ggagctgccg ggcagcgtcg cggccgtcga cttcgtgggt tggtacaacg
cgcatccgca tttccgcgag atggcgcccg atctctccgg cgggcgcgcc
gtggtggtcg gcaacggcaa cgtcgcactc gatgtcgcac gcatcctggt
cagcgatccg aaggcgttgg ccaacaccga cattgccgac catgcgctgg
acaagctgga cacgcgcggt gtggacgagg tcgtggtgct cggccggcgt
ggtccgctgc aggcgacgtt caccacgctg gagttgcgtg aactcggcga
catggagggc ctcggcgacg tcgacgtgat cctggatccg gccgatttcg
ccgacatcac cgacgaggat ctcgaagccg cgggcaagac cgtcaagcag
aacatcaagg tgctgcgcgg ttacgccgag cgggaaccgc gaggcgccaa
gcggcgcatc gtgttccggt tcttcacctc accgatcgag ctgcgcggcg
aggaccgcgt ggaatcgatc gtgttgggac gcaacgaact cgtgcgcggc
gccgacggca ggatggtggc caaggacacc ggtgagcgcg aagaactgcc
ggcacagctg gtggtgcgtg cggtcggata ccgcggcgtg ccgactccag
gcctgccgtt cgacgagcgt tcgggcacca tcccgcacac cgacggccgc
gtcgagggca gcgccaacga gtacgtggtg ggctggatca agcgcggacc
gtccggcgtc atcggcagca acaagaagga ctcacaggac accgtcaaca
ccctgctcga cgacctcgcc gcggcccggc tgccccagcg cgggcccgac
cactccgaga agctcgcggc gtggttgctg gaacgtcagc ccaaggtggt
cacgggcgag cactggaagc tgatcgacga ctacgagcgc gccgcgggcg
aaccgaccgg ccgaccccgg gtgaagctgg cgagcgtggc tgaactgctg
cgcgtgggcc acggctga

As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. Again, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:

tatgaattct agatcatatg cgcccgtacc acgtagcgat cgtcggctca
ggaccctccg gattctttgc tgccgcatcg ctgctgaagt ttgccgactc
tcaacccgac cgcgatgtcc gcgtggacat gctcgagatg ctgccgaccc
cgtggggtct ggtgcgctcc ggcgtcgctc ccgaccatcc gaagatcaag
tcgatcagcg cccagttcga gaagaccgcg gccgaccccc gcttccggtt
cttcggcaac gtccgggtcg gtgagcacgt ccaaccgggc gaactcgccg
aacgctacga cgccgtcgtc tacgccaccg gcgcacagtc cgaccgcgcg
ctgaacatcc ccggcgagga gctgccgggc agcgtcgcgg ccgtcgactt
cgtgggttgg tacaacgcgc atccgcattt ccgcgagatg gcgcccgatc
tctccggcgg gcgcgccgtg gtggtcggca acggcaacgt cgcactcgat
gtcgcacgca tcctggtcag cgatccgaag gcgttggcca acaccgacat
tgccgaccat gcgctggaca agctggacac gcgcggtgtg gacgaggtcg
tggtgctcgg ccggcgtggt ccgcttcagg cgacgttcac cacgctggag
ttgcgtgaac tcggcgacat ggagggcctc ggcgacgtcg acgtgatcct
ggatccggcc gatttcgccg acatcaccga cgaggatctc gaagccgcgg
gcaagaccgt caagcagaac atcaaggtgc tgcgcggtta cgccgagcgg
gaaccgcgag gcgccaagcg gcgcatcgtg ttccggttct tcacctcacc
gatcgagctg cgcggcgagg accgcgtgga atcgatcgtg ttgggacgca
acgaactcgt gcgcggcgcc gacggcagga tggtggccaa ggacaccggt
gagcgcgaag aactgccggc acagctggtg gtgcgtgcgg tcggataccg
cggcgtgccg actccaggcc tgccgttcga cgagcgttcg ggcaccatcc
cgcacaccga cggccgcgtc gagggcagcg ccaacgagta cgtggtgggc
tggatcaagc gcggaccgtc cggcgtcatc ggcagcaaca agaaggactc
acaggacacc gtcaacaccc tgctcgacga cctcgccgcg gcccggctgc
cccagcgcgg gcccgaccac tccgagaagc tcgcggcgtg gttgctggaa
cgtcagccca aggtggtcac gggcgagcac tggaagctga tcgacgacta
cgagcgcgcc gcgggcgaac cgaccggccg accccgggtg aagctggcga
gcgtggctga actgctgcgc gtgggccacg gctgacctag gactagtctg
cagttacg

Target

ASDF

Wednesday 12^th June

Design of FdxC and FdxA genes for synthesis

FdxC

Mycobacterium tuberculosis
Reference: Cole, S.T. et al. 1998. Deciphering the biology of Mycobacterium tuber- culosis from the complete genome sequence. doi:10.1038/31159.
We couldn’t find a reference of FdxC being cloned into E. coli and so we took the sequence data from genbank which is as follows:

gtgacgtaca cgatcgccga accctgtgtc gacatcaagg acaaggcatg
cattgaggag tgcccggtcg attgcatcta cgagggcgcc cggatgctgt
atatccaccc cgacgaatgc gtcgactgtg gggcttgcga gccggtctgc
cccgttgaag ctatcttcta cgaagacgat gtgcccgaac agtggagcca
ttacacccag atcaacgccg atttcttcgc cgagctggga tcgccgggcg
gtgcggccaa ggttggcatg accgagaacg acccgcaagc ggtcaaggat
ctggcgccgc agagcgagga cgcctga

The Gtg was replaced with the NcoI cut site and a glycine codon (ccatgggc) and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:

cttagaattc tagaccatgg gcacgtacac gatcgccgaa ccctgtgtcg
acatcaagga caaggcatgc attgaggagt gcccggtcga ttgcatctac
gagggcgccc ggatgctgta tatccacccc gacgaatgcg tcgactgtgg
ggcttgcgag ccggtctgcc ccgttgaagc tatcttctac gaagacgatg
tgcccgaaca gtggagccat tacacccaga tcaacgccga tttcttcgcc
gagctgggat cgccgggcgg tgcggccaag gttggcatga ccgagaacga
cccgcaagcg gtcaaggatc tggcgccgca gagcgaggac gcctgaagct
tgactagtct gcagaaatg

FdxA

Mycobacterium smegmatis
Reference: Ricagno S. et al. 2008. The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis. http://dx.doi.org/10.1016/j.bbrc.2007.06.013 http://www.metacyc.org/MSME246196/NEW-IMAGE?type=GENE-IN-MAP&object=GJ4Y-1124
Sequence:

atgacatacg tgatcggccg gccgtgcgtg gacgtcaaag accgcgcatg
cgtggatgag tgcccggtcg actgcatcta cgagggcgcg cggatgctct
acatccaccc cgacgaatgt gtcgactgtg gcgcgtgtga acccgtgtgc
ccggtggagg cgatctacta cgaggacgac ctgcccgagg atctgcagcc
gtaccaggag gagaacgcga agttcttcac cgatgtcctg cccgggcgtg
cccaaccgct cggatcaccg ggcggtgccg cgaaactcgg tgtcgtggac
gccgatacgc ccatggttgc ggagctaccg ccgcaggggg attga

Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.

4 strains were received from Jake:

E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
E. coli: NEBTurbo zmSIR Chloramphenicol
E. coli: NEBTurbo zmFNR Spectinomycin
E. coli: NEBTurbo soFD, zmSIR Chloramphenicol

Media and Glycerol stock were prepared

Media Preparation

3 500ml bottles of LB broth and LB agar were prepared by standard methods.
12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.

Glycerol Stocks

Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.

Target

ASDF

Tuesday^2nd July

MiniPrep: Plasmids pD004, pD005 and pD006 were extracted from NEBturbo vectors

Plasmid Extraction
Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in protocol (). Lacking Resuspention solution we used some from a different mini prep upstairs. Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. More notes here tra la lalal

Target

ASDF

Wednesday 3^rd July

Chemically Competent Cells : BL21 (DE3) dCysI dFpr dydbk, NEBturbo stocks

Chemically Competent BL21 (DE3) Cells were made
We grew 5ml of sD001 cells overnight from a single colony. This 5ml was used to innoculate 500ml of LB broth.
Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
Cells were centrifuged again for 20 minutes at 4000xg.
Supernatant was removed and cells were resuspended in 12ml Buffer 2.
Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
Buffer 1: 50mM CaCl2
Buffer 2:

0.53ml 2M CaCl2
2.8ml 60% Glycerol
8.67ml sterile H2O

This is the correct Chemical Competent Cells protocol (Similar to Protocol 2) , that we should have used instead of the one above:

Take a single colony of E. coli cells and inoculate 5ml of LB broth.
Incubate over night at 37C and 200rpm and innoculate about 500ml to 1L sterile LB broth.
DO NOT ADD antibiotics since these cells do not have a plasmid in them.
Work as sterile as possible.
Inoculate about 300-400ml sterile LB broth with 500ul of preculture.
Grow the cells on a shaker at 37C until they reach an OD @ 600nm of 0.3 to 0.4 (1cm pathlength of the cuvette).
Centrifuge at 3000xg for 10 minutes at 4C. Ice down 100mM CaCl2 and 100mM MgCl2 solutions at this point.
Gently resuspend the bacteria pellet on ice in 50ml of ice cold 100mM MgCl2, taking 3-5 minutes for this procedure.
Centrifuge the cell suspension at 3000xg for 10 minutes at 4C.
Resuspend the bacteria pellet on ice 50ml of ice cold 100mM CaCl2, incubate the cells for 10 minutes on ice.
Centrifuge the cell suspension at 3000xg for 10 minutes at 4C and resuspend the cell pellet in 4ml of ice cold, sterile 100mM CaCl2 in 15%(w/v) glycerol.
Dispense in 50uL aliquots and freeze cells at -80C.

Chemically competent cells (NEB Turbo)
Prepared via iGEM chemically competent protocol with following changes.
500ul of preculture used to inoculate 500ml LB broth. Grown at 37C for 3h hours to an OD600 of 0.536.
Cells centrifuged at 3200 rpm on old centrifuge for 10m at 4C. Pellets resuspended in 80ml of CCMB80 buffer.
Incubated on ice for 20m. Centrifuged for 10m at 3200 rpm for 10m at 4C.
Pellets resuspended in 5ml of CCMB80 buffer. Aliquoted into Microcentrifuge tubes and frozen at -80C.

Target

ASDF

Thursday 4^th July

Heat Shock Transformation

Preparation of Agar Plates
LB Agar was melted; 100ml was used to make 8 ampicillin plates,
100ml was used to make 8 spectinomycin plates and the remaining was used to make 20 chloramphenicol plates.
Antibiotic concentrations are: Ampicillin 50ug/ml, Spectinomycin 50ug/ml, Chloramphenicol 34ug/ml.

Heat Shock Transformation
sD001: BL21 (DE3) with deletions, was transformed with the following plasmids and plasmid combinations:

sD001+pD004 ( FNR, Spectinomycin)
sD001+pD005 ( SIR, Fdx, Chloramphenicol)
sD001+pD006 (Sir, Chloramphenicol)

Transformation was done according to protocol 1 with the following specifications:
BL21 (DE3) chemically competent cells were thawed on Ice. 1ul of plasmid DNA was added to a tube of BL21 (DE3) cells.
Cells were incubated on ice for 30 minutes. Cells were transfered to heating block at 42C for 45s.
Cells were returned to ice for 2 minutes. 1ml of LB Broth was added to the cells and they were incubated at 37C for 1h.
Cells were then plated on agar with appropriate antibiotics (specified previously). These transformations worked; single colonies were lifted from plates, entered to catalog and stocked in glycerol stock (protocol 3).
Catalog names:

sD006= sD001+pD004 ( FNR, Spectinomycin)
sD007= sD001+pD005 ( SIR, Fdx, Chloramphenicol)
sD008= sD001+pD006 (Sir, Chloramphenicol)

Target

ASDF

Friday 5^th July

Planning transformations for the next week

We decided to partly reproduce Figure 3C from: http://www.jbioleng.org/content/5/1/7:

So, we would pursue to grow the following strains on a minimal media M9 plate, supplemented with all amino acids

aside from the sulfur containing ones, and sulfite ans the only sulfur source:

We already thought we have all of the strains we need, however, an overnight culture was launched of a few single colonies from this double plasmid strain (sD001+pD004+pD005, which supposedly had all 3 genes SIR FNR and Fdx) and it didn't grow.

This most likely occurred because the strains didn't have Spec antibiotics resistance, as the other spec resistant strain containing

the FNR gene (pD004), was found not to be resistant as well.

Illustration 1: Strains will be grown on a minimal media M9 plate, supplemented with all amino acids aside from the sulfur containing ones; plates will have increased glucose, and sulfite as the only sulfur source. Growth is expected only for WT and the strain containing all three alternative genes of sulfur reduction.

Therefore, we would re-make:

sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes.
sD001+pD004: E.coli:ΔcysI, Δfpr, ΔydbK:: zmFNR; Spectinomycin

and make

sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

These transformations will be done by using two strains of competent cells prepared using Protocol 2 :

sD001 competent cells were transformed with:
- pD004
- Double transformation: pD005 +pD004
sD007 (sD001+pD005) competent cells were transformed with:
- pD004

Thursday 18^th July

Heat shock Transformation

Transformations made:

sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

Transformations were made with protocol 1 with the following specifications:
BL21 (DE3) chemically competent cells were thawed on Ice.
2ul of plasmid DNA was added to 20ul of BL21 (DE3) cells. Cells were incubated on ice for 30 minutes.
Cells were transfered to heating block at 42C for 45s. Cells were returned to ice for 2 minutes.
200ul of LB Broth was added to the cells and they were incubated at 37C for 1h.
After incubations cells of each transformation were plated on two plates: one with 5 ul , and the other with 100 ul of the post recovery cells culture.

Target

ASDF

Friday 19^th July

TRANSFORMATIONS WORKED!!! cells were stocked and entered in catalog.

sD012/sD013=sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
sD016/sD017=sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
sD014/sD015=sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

Glycerol Stocks were made of the above mentioned strains
2 Single colonies from each agar plate of above mentioned strains were picked and used to inoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001+pD004, sD001+sD004+sD005, sD001+sD004+sD006;
one set was frozen at -20ºC and the other set was frozen at -80ºC.

Target

ASDF

Wednesday 24^th July

24/7/13

Made 500 ml of M9 Minimal Plates with Sulfur Dropout Powder accouding to the following recipe:

Recipe: M9 Minimal Plates with Sulfur Dropout Powder

These stock solutions can be pre-sterilized and stored indefinitely:

5x M9 Salts (from scratch)

Reagent	Quantity
Na2HPO4	17 g
KH2PO4	7.5 g
NaCl	1.25 g
(NH4)2SO4	3.0 g

Bring to a total volume of 500 ml.

Adjust pH to 7.4 with NaOH.

Sterilize by autoclaving or filtration

or

5x M9 Salts (from Difco Powder)

Reagent	Quantity
M9 Salts	28.2 g

Bring to a total volume of 500 mL.

Sterilize by autoclaving or filtration

2x Yeast Plate Agar

Reagent	Quantity
Agar	30 g

Bring to a total volume of 500 ml.

Sterilize by autoclaving

5x Amino Acid Dropout Powder

Reagent	Quantity
Sulfur dropout powder	0.5 g

Bring to a total volume of 200 ml.

Sterilize by autoclaving

Sulfur dropout powder is a rich supplement mix with cysteine and methionine omitted:

Amino acids		Nucleotide bases
Alanine	2.0 g	Leucine	10.0 g	Adenine	0.5 g
Arginine	2.0 g	Lysine	2.0 g	Uracil	2.0 g
Asparagine	2.0 g	Methionine	0.0 g
Aspartic acid	2.0 g	Phenylalanine	2.0 g	Vitamins
Cysteine	0.0 g	Proline	2.0 g	p-Aminobenzoic acid	0.2 g
Glutamic acid	2.0 g	Serine	2.0 g	Inositol	2.0 g
Histidine	2.0 g	Tyrosine	2.0 g
Isoleucine	2.0 g	Valine	2.0 g

Recipe: M9 Minimal Plates with Sulfur Dropout Powder

The plates can be made fresh from pre-sterilized stock solutions.

Reagent	Quantity
5x M9 Salts	200 mi
5x Amino Acid Dropout Powder	200 mi
1 M MgSO4	2 ml
20% Glucose	20 ml
1M CaCl2	0.1 ml

Bring to a total volume of 500 mL

Stir and warm on a hot plate to about 60 C (hot to the touch)

Melt 500 ml 2x Yeast Plate Agar in the microwave for ~8 minutes on high

Cool to about 60 C (hot to the touch)

This takes about 30 minutes on the bench or 5 minutes in a water bath.

Add the 2x Yeast Plate agar to the other reagents to make 1 L of media.

This recipe will prepare 20 plates at 25 ml / plate.

made 7 plates without antibiotics and 20 with Chloramphenicol and Spectinomycin - by mistake.

Used one plate without AB to plate the following strains:

sD007=sD001+pD005
sD008=sD001+pD006
sD013= sD001+pD005+ pD004
sD015= sD001+pD006+ pD004

Target

ASDF

Monday 5^thAugust

Confirmation of strains SD002 - SD018

Strains sd002-sd018 were grown overnight in 5ml LB.

Target

ASDF

Monday 5^thAugust

Confirmation of strains SD002 - SD018 using colony PCR

Fresh single colonies of strains SD002-SD018 were prepared for PCR using the colony pcr protocol. The primers used for were FD_F, FD_R, FNR_F, FNR_R and SirA_F and SirA_R for each strain.

Strains SD002-SD018 were confirmed.

Target

ASDF

Day Number^suffix Month

Place your twit here

Received FrpA and FdxA from IDT.
Started cloning strategy:
Ligated FdxA G block into pJET plasmid for stock purposes, using the following protocol:

1. Set up the blunting reaction on ice:

Component	Volume
2X Reaction Buffer	10 µl
Non-purified PCR product or purified PCR product/other sticky-end DNA fragment	1 µl 0.15 pmol ends
Water, nuclease-free	to 17 µl
DNA Blunting Enzyme	1 µl
Total volume	18 µl

Vortex briefly and centrifuge for 3-5 s.

2. Incubate the mixture at 70°C for 5 min. Chill on ice.

3. Set up the ligation reaction on ice. Add the following to the blunting reaction mixture:

Component	Volume
pJET1.2/blunt Cloning Vector (50 ng/µl)	1 µl (0.05 pmol ends)
T4 DNA Ligase	1 µl
Total volume	20 µl

Nano drop

Plasmid mini-prep of transformations
Nano dropped

pETDuet: 59.1ng/ul
pETDuet: 45.9ng/ul
pJET Fdx: 54.2ng/ul
pLS FRP: 19.7ng/ul

Digest pLS FrpA with NdeI and AvrII
Digest pETDuet with NdeI and AvrII
Digest FdxA gBlock with NcoI and HindIII
Digest pETDuet with NcoI and HindIII
Ligation of FprA with pETDuet
Ligation of FdxA with pETDuet
Transformation of pET FprA and pET FdxA into NEBTurbo
PCR of

FdxA gBlock with FdxA F/R
pLS FprA with FprA F/R
pET duet with MCSI F/R
pACYC duet with MCSI F/R

Target

ASDF

Friday 23^rd August

Patching

Patched colonies of pET FprA and colonies of pJET FdxA
Transformations of pET Fdx didn't work
Checking strains containing plasmids fpr to make sure genes are there.
Results from Thursdays PCR:

no band for fdxA
band for fprA
band for pET
no band for pACYC

Target

ASDF

Saturday 24^th August

Weekend warriors!

Nanodrop

FdxA 1 3.1ng/ul
FdxA 2 4.3ng/ul
pET Duet 6.2ng/ul
pET Duet 4.9ng/ul

Checking FdxA gBlock by PCR

1 ul Fdx F
1 ul Fdx R
1 ul Template
7 ul H20
10 ul dreamTaq 2x master mix

Target

ASDF

Sunday 25^th August

Ligations

For FprA and pET Duet:

Miniprep more plasmid
Digest plasmid and vector backbone
Check DNA concentration
Ligate

Target

ASDF

Monday 26^th August

P1 phage transduction

The p1 phage lysate was prepared as described in the P1 phage transduction protocol.
BL21 (DE3) ΔCysI Δfpr ΔydbK was grown in 5ml Lb.
One colony was discovered in transformed plate. This colony was re-streaked and grown overnight.
the ligation product from overnight ligation was used to transorm NEB cc cells by heatshock
5ul plate gave a few colonies
10ul plate gave many colonies

Target

ASDF

Tuesday 27^th August

Sequencing FdxA

pJET FdxA sent for sequecing

Confirmation of P1 phage transduction:

Colony PCR was used on patched colonies from the p1 phage transduction. The primers used for each colony were CysI F/R and KanR F/R.

PCR confirmed that CysI was deleted in BL21(AI) and replaced with a Kanomycin resistance gene.

Cloning gBlock FdxA and Biobricking FprA and SirA

FprA and SirA were PCRed with FprA BB F, FprA BB R, SirA BB F and SirA BB R primers respectfully. The PCR was run with an annealing temperature of 60C with an extension time of 1m40s using Phusion polymerase. The band of ~1400bp was cut out and cleaned up using a Quagen Gel Extraction Kit.

PCR Verification of vectors

Vectors (pET FprA FdxA, pSB1c3 SirA, and pSB1c3 FprA) were used for colony PCR using DreamTaq. Primers used were:

pET FprA FdxA: MCSI F/R, MCSII F/R, FprA F/R, FdxA F/R

pSB1c3 SirA: SB-prep-3P-1/SB-prep-2Ea, SirA F/R

pSB1c3 FprA: SB-prep-3P-1/SB-prep-2Ea, FprA F/R

Target

ASDF

Saturday 21^st September

Weekend Rush

Gibson assembly of pSB9S1, pSB10K1, and pSB3C7.

Digestion of sirA, fprA, fdxA and linearized backbone with XbaI and SpeI

Digestion of Linearized pSB1C3 with XbaI, SpeI, and DpnI

Ligation of sirA, fprA, and fdxA with pSB1C3

Heat Shock transformation of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA into NEBTurbo

Heat Shock transformation of pSB9S1, pSB10K1 and pSB3C7 into NEBTurbo

Target

ASDF

Sunday 22^nd September

Verifying shipment vectors

Growing Culture of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA.

Mini-prep of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA vectors

Colony PCR of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA with sirA F/R, fprA F/R, fdxA F/R, and biobrick verification primers F/R

Target

ASDF

Friday 27^th September

Growth Curves

IPTG Concentrations by column: 1 0nM, 2 10nM, 3 50nM, 4 100nM, 5 500nM, 6 1uM, 7 5uM, 8 10uM, 9 50uM, 10 100uM, 11 500uM, 12 1mM

Arabinose Concentrations by column: 1 0%, 2 0.01%, 3 0.02%, 4 0.03%, 5 0.04%, 6 0.05%, 7 0.06%, 8 0.07%, 9 0.08%, 10 0.09%, 11 0.1%, 12 0.2%

Row A: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row B: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row C: BL21 AI dcysI pACYC SirA pET FprA FdxA 2 Row D: BL21 AI dcysI pACYC SirA pET FprA FdxA 2

Row E: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row F: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row G: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 Row H: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Glucose, 5ul CaCl2, 27.5mL H2O

Target

ASDF

Saturday 28^th September

Growth Curves

Growth curves of BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA. Column 1: Positive control WT E. coli BL21 (DE3), 2: Negative Control BL21 AI dcysI, 3: BL21 AI dcysI pACYC SirA pET FprA FdxA 0 Arabinose 0 IPTG, 4: 0.1% Arabinose 10uM IPTG, 5: 0.05% Arabinose 50uM IPTG, 6: 0.01% Arabinose 100uM IPTG, 7: 0.2% Arabinose 1mM IPTG, 8: Negative Control BL21 (DE3) dcysI dfpr dydbf, 9: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 0 IPTG, 10: 50nM IPTG, 11: 1uM IPTG, 12: 50uM IPTG

Grown in M9 Media with Galactose.

10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Galactose, 5ul CaCl2, 27.5mL H2O

Target

ASDF

Sunday 29^th September

PCR's and more!

Colony PCR on new Backbones. RFP and Biobrick verification primers This is for pSB2C and pSB3K

Colony PCR on SirA, FprA, and FdxA Biobricked parts Using Biobrick primers and SirA, FprA and FdxA primers respectfully https://2013.igem.org/File:20130929_BioB.jpg https://2013.igem.org/File:20130929_RFP.jpg https://2013.igem.org/File:20190929_pSB3K.jpg

Phusion PCR on Duet vectors and pSB1C3 using standard cloning primers

Gel Clean up

Digestion with NcoI and AvrII

Standard cloning of new backbones (1h ligation at 16C)

Transform into NEBTurbo

Cutting Biobrick SirA, FprA, FdxA and Linearized backbone with EcoRI and SpeI

Standard clonging of Biobrick parts (1h ligation at 16C)

Transform into NEBTurbo

ASDF

Wednesday 2^nd October

Race to finish stuff

Grew up 5ml cultures of pSB3K3 and pSB1A3 E0240 from transformations

Plasmid mini preps of pSB3K3 and pSB1A3 E0240

Restriction Digest of CI promoter PCR product with XbaI and PstI

Restriction Digest of Linearized Backbone pSB1C3 with XbaI, PstI, and DpnI

Make new NEB Turbo Chemically Competent Cells: Modified protocol. 4mL of NEBTurbo into 2 x 2mL tubes. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of 100mM MgCl2 Ice cold. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of iGEM cc cell buffer Ice cold. Centrifige for 1 minute at 14000 rpm at 4C. resuspend in 100ul of iGEM cc cell buffer Ice cold.

Heat Shock Transformation of pSB1C3 SirA, pSB1C3 FprA, pSB1C3 FdxA into NEBTurbo (new chemically competent cells)

Ligation of CI promoter with pSB1C3 backbone.

Heat Shock Transformation of pSB1C3 CI into NEB Turbo

Target

ASDF

Thursday 3^rd October

Race to Finish stuff

Plated new SirA, FprA, and FdxA transformations on CHL

Picked pSB1C3 CI and grew in LB broth

Z Score of BL21 dCysI pD002 pD003 with Gentamicin as positive hit control

Analytical Digestions of New Vectors (pAD1S, pAD2C, pAD3K, pAD4A)

Digest pSB1C3 CI with EcoRI and SpeI

Digest pSB3K3 with EcoRI and PstI

Digest pSB1A3 E0240 with XbaI and PstI

Ligation of CI promoter with GFP reporter and pSB3K3 backbone

Heat Shock Transformation of pSB3K3 CI GRP into NEBTurbo

We did an analytical digest of pET 21b that we purified yesterday. We used Nedl and Xhol so our fragments should be: the backbone of the plasmid (around 5000 bp long) and the cloned MSMEG_1529 gene (around 600 bp long). On the following picture is our plasmid and we suppose that the MSMEG_1592 gene is cloned somewhere in between the two restriction sites that we have chosen. But we still don't really know that because we need the full sequence of the plasmid.

The protocol used for preparing the digestion:

Reagent	Volume	10x
Plasmid Miniprep	5µl
H2O	12 µl	120 µl
10x FastDigest Buffer	2 µl	20 µl
10x FastDigest Buffer	2 µl	20 µl
FastDigest Enzyme 1	0.5µl	5 µl
FastDigest Enzyme 2	0.5µl	5 µl
Total Volume	20.0 µl	200 µl

Digest for 1 h at 37 °C with shaking.

We repeated the time 6 measurement (the cultures were over diluted, so this time we did 10-5, 10-6 and 10-7). We also did the 24 h measurement (we used the 10-6, 10-7 and 10-8 dilutions). The final results are:

The growth curve for uninduced and induced bl21 (DE3), with antibiotics in the liquid culture:

Sabotage

ASDF

25^th July

choosing a nice colony and launching overnight culture 37° in LB

Sabotage

ASDF

28^th July

sRNA design

A description...

red sequences:

pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT

pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT

We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.

Sabotage

ASDF

2^nd July

Aude and Vincent

glycerol stock

from overnight culture of MG1655-6300 O/N : T001

Centrifuge 4000rpm, 10 minutes,
take out liquid
resuspend cells in 1mL glycerol, 2mL LB
separate in two cryotubes, one for the -80°C, one for the -20°C

Electroporation

- making MG1655-6300 competent (Aude’s protocol for electrocompetent cells & electroporation [ref needed])

- test of the competent cells (negative

-transforming with pCOLADuet-1 : Ec2 =>

-transforming with pACYCDuet-1 : Ec2 =>

- plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)

Sabotage

ASDF

3^rd July

Aude and Vincent

Transfo results :

negative controls are negative.
Transformed cells grew on plates

in the evening launch of 5mL Lb cultures from clones on the plates

Igem Buffer for chemical competent cells

Igem protocol for chemical competent cells

Launch overnight culture of NEB turbo

5mL LB inoculated with a clone from plate of drug team

Sabotage

ASDF

4^th July

Aude

Glycerols of the overnight cultures of the transformation
sT002 : MG1655 pCOLADuet-1
sT003 : MG1655 pACYCDuet-1

Aude and Clovis

Making stocks of electro competent NEB turbo

Prepare 10% glycerol solution

Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes

Cool down centrifuge to 4°C

Prepare a rack with 50 microtubes at -80°C

Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured
Check the OD until it reached 0,5
Put 500mL cultures in 10 50mL falcon tubes in ice
Wait for 20 minutes for the culture to cool down
Centrifuge at 3400 rpm 4°C for 10 minutes
Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube)
Centrifuge 10 minutes, 4°C , 3400 rpm
Take out liquid and resuspend in 25 mL ice cold water
Centrifuge 10 minutes, 4°C, 3400 rpm
Resuspend all the content of the tubes in 20mL ice cold glycerol
Centrifuge 10 minutes, 4°C, 3400rpm
Resuspend in 5mL ice cold 10°C glycerol solution
Aliquot in 50 tubes (100uL per microtubes)
Store at -80°C

Sabotage

ASDF

15^th July

Clovis and Anne

Primer Design

Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol

Geneious files in the dropbox: LacZ primers, KanR primers

Sabotage

ASDF

16^th July

Anne with Nico, Marguerite and Yonatan

Transformation of pUC18 (NEB, NEB CC, BL21)

1) Thaw competent cells on ice.

2) Place 20 ul of cells in a pre-chilled Eppendorf tube.

3) add o.5ul of plasmid to the cells

4) Mix gently by flicking the tube.

5) Chill on ice for 10 minutes.

4) Heat shock at 42 °C for 30 seconds.

5) Return to ice for 2 minutes.

6) Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)

7) Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)

8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Result: Colonies (around 10)

Vincent and Aude

In silico cloning: sRNA gBlocks into pUC18 and litmus28-GFP

Successful with both Gibson assembly and regular cloning.

See file: “in silico cloning trojan horse.geneious”

Vincent

streaking Ortiz’s strain ELS-41 and ELS-13 containing Litmus28i_J23115-B0032-GFP and M13K07, respectively.

Sabotage

ASDF

17^th July

Anne

Redsign of Primers

Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol

Geneious files in the dropbox: LacZ primers, KanR primers

Clovis and Anne

Liquid Cultures (for Miniprep)

7ml LB with proper antibiotics

adding: 1) NEB with pUC18 (AmpR)

2) sT002 : MG1655 pCOLADuet-1 (KanR)

3) sT003 : MG1655 pACYCDuet-1 (ChlaR)

Cultivate over night in the 37°C shaker

Vincent

Check: GFP expressed as expected in ELS-41

Lauching O/N of ELS-41 and ELS-13 with Amp and Kan, respectively.

Aude

Lauching O/N of MGZ1 (Glycerol from lab upstairs) with Spec (500X)

Sabotage

ASDF

18^th July

Vincent and Aude

Glycerol stock of ELS-41 and ELS-13 and MGZ1 now renamed sT004, sT005, sT006 respectively:

sT004: RP437, F+ Litmus28i_J23115-B0032-GFP AmpR

sT005: XL1-Blue, M13K07 KanR

Making electrocompetent cells from strain sT004, sT005 and MGZ1 => Bad old water => could not obtain competent cells.

Conjugation :

sT004: RP437, F+ Litmus28i_J23115-B0032-GFP + conjugate with MGZ1.

F+ comes from XL1 Blue (Ortiz paper) => F+ is tetR

Protocol :

From O/N cultures Dilute both strains 1/100 , in LB
Wait for OD to reach O,2
Prepare 4 tubes (in BD tubes) :

Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control
Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control
Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004

Incubate 2 hours at 37°C
Plate 100ul for controls, 100uL, 50ul, 20ul for mixed tubes on LB antiobiotics (here tet and spec)
Incubate overnight at 37°C

Aude

Miniprep pT005 (Litmus28i_J23115-B0032-GFP) pT006 (M13K07) (Thermo Scientific Miniprep Kit)

pT005 : 280 ng /uL

pT006 : 61 ng/ul

Aude Vincent Sebastian and Yonatan

Work on the model

Define the players, the processes in place (more in Modeling file)

A description...

Anne and Clovis

Miniprep (sT002, sT003, NEB+pUC18) using the Thermo Scientific Miniprep Kit

1) Pellet 5ml of liquid culture (max speed, 1 min)

2) Discard supernatant

3) resuspend the cells in 250ul of resuspension olution

4) add 250ul of lysis solution, mix by inverting 4-6 times

5) add 350ul of neutralization solution

4) centrifuge for 5 min

5) transfer supernatant to spin column

6) centrifuge for 1 min

7) discard flow through

8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)

9) centrifuge for 1 min to remove left over liquid

10) transfer the column on a 1.5ml tube

11) add 50ul of elution buffer and incubate for 2 min

12) centrifuge for 2 min

13) Nanodrop the concentration and freeze at -20°

pT.002: 53.9ng/ul -> redo with more liquid culture, it is only a low copy plasmid

pT.003: 53.8ng/ul -> redo with more liquid culture, it is only a low copy plasmid

pT.007: 214ng/ul

Sabotage

ASDF

19^th July

Conjugation results :: Controls => no colonies; Mix = tapis

Ie worked really well.
To be sure to start only with one clone => restreak some colonies on tet/spec plates

Transformation by electroporation : goal = get a phage factory.
We do it three different ways in order to see which one works (best).: Transform strain containing helper plasmid with phagemid; Transform strain containing helper plasmid with phagemid; Co Transform strain with both plasmids at the same time

From strain sT004, sT005, sT006: Transform sT004 with pT006; Transform sT005 with pT005; Co Transform sT006 with pT005 and pT006

Sabotage

ASDF

20^th July

Results of transformation

Controls : no colonies
Colonies on plates : every transformation worked

Put plates of conjugation and transformation in the fridge.

Sabotage

ASDF

22^th July

Place your twit here

Check Colonies of transformation under iLumina tools: colonies are fluorescent.

Launch culture.

Sabotage

ASDF

23^th July

Infectiveness characterization experiments

The night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
Centrifugate phagemid producing cells
Filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
Dilute 200x MGZ1, F+ from O/N
Wait until OD600 = 0.7
Immediately mix MGZ1 and the supernatant in different proportions

Here we tried 1/1 (vol supernatant/vol cells), 1/10 and 1/100

Plate 100uL of those dilutions on LB-agar, AMP, KAN, AMP+KAN
Incubate O/N
Count colonies
Interpretation: Colonies on AMP: infected by litmus28i
Colonies on KAN: infected by M13K07
Colonies on AMP+KAN: coinfected by litmus28i and M13K07 phagemid producing cells

Results

Conclusions:

Cells that were mixed with 1/1 supernatant didn't survive the excess of antibiotics that were present in the supernatant.
Even at low ratio like 1/100 the infection rate of litmus28i-GFP is about 100%. GFP detection confirmed this result: almost 100% of cells were fluorescent.
Co-infection did occur. It would be interesting to test if those colonies are indeed producing phages.

Start O/N culture of M13K07 Start O/N culture of MGZ1,F+

Sabotage

ASDF

24^th July

Glycerol stock:

sT008: MGZ1, F+
sT009: XL1-Blue Litmus28i

Infectiveness characterization experiments

Dilute 1/100 MGZ1, F+ O/N culture in 5mL LB => wait OD(600) = 0.7
Centrifuge M13K07 4000rpm, 10 minutes
Retrieve surnageant and filter it with 0.2 filter

Once OD 0.7 is reached, make 4 tubes
1. 1mL MGZ1,F+ + 100ul LB (not done, not enough cells left ofter OD test)
2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
3. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
4. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
Incube 37°C for 45 minutes
Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
- 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
Plate on LB (10^-6), Kan(10^-2 and 10^-3), Amp(10^-6), Kan and Amp(10^-2 and 10^-3)

Experiment fail due to manipulation error (wrong dilution of the supernageant and plating of wrong dilutions)

Start O/N culture of MGZ1,F+ (T008) + Tet 1/500
Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000

Sabotage

ASDF

25^th July

O/N culture of T007 didn't grow (100 ul instead of 10ul of antibiotics, Kan and Amp)
Start O/N culture of MGZ1,F+ (T008) + Tet 1/500
Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000

Sabotage

ASDF

26^th July

Infectiveness characterization experiments

Dilute 1/100 MGZ1, F+ O/N culture in 10mL LB => wait OD(600) = 0.7
Centrifuge M13K07 4000rpm, 10 minutes
Retrieve surnageant and filter it with 0.2 filter

Once OD 0.7 is reached, make 4 tubes
1. 1mL MGZ1,F+ + 100ul LB
2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
3. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
4. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
Incube 37°C for 45 minutes
Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
- 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

Plate on LB (10^-6), Kan(10^-2), Amp(10^-6), Kan and Amp(10^-3)

Sabotage

ASDF

Tuesday 30^th July

Transformed the bl21 (DE3) strain with the pET21b (plated the transformation culture on 2 amp plates).

Sabotage

ASDF

31^th July

Vincent and Aude

Conjugation MGZ1, F+ & MG1655:

Protocol :

From O/N cultures Dilute both strains 1/100 , in LB
Wait for OD to reach O,2
Prepare 4 tubes (in BD tubes) :

Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control
Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control
Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004

Incubate 2 hours at 37°C
Plate 50ul for controls, 50uL, 20ul, 10ul for mixed tubes on LB antiobiotics (here tet and spec)
Incubate overnight at 37°C

Vincent

Infectiveness characterization experiments

-the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

-centrifugate phagemid producing cells

-filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

-dilute 200x MGZ1, F+ from O/N

-wait until OD600 = 0.7

-immediately mix MGZ1 and the supernatant in different proportions

here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

Unfortunately the supernatant was dropped on the bench.

Sabotage

ASDF

1^st August

Aude & Vincent

Cloning Kanamycin resistance gene into pACYCDuet-1:

-PCR of Kanamycin resistance gene from pCOLADuet-1 with primer iT.0003 and iT.0004

-electrophoresis of PCR product: 1 band between 900 and 1000bp: coherent with KanR length

-cutting KanR bands:

-digestion with ECOR1 and Xho1:

PCR product digest for cloning

Reagent	Volume
Purified PCR Product	16 ul
H₂O	0 ul
10x FastDigest Buffer	2 ul
FastDigest Enzyme 1	1 ul
FastDigest Enzyme 2	1 ul
Total Volume	20.0 ul

Digest for 0.5 - 1 hours at 37 °C with shaking.

-digestion of pACYCDuet-1 with ECOR1 and Xho1:

Vector backbone digest for cloning

Reagent	Volume
Purified Plasmid	20 ul
H₂O	65 ul
10x FastDigest Buffer	10 ul
FastDigest Enzyme 1	2.5 ul
FastDigest Enzyme 2	2.5 ul
FastAP Phosphatase	0 ul
Total Volume	100.0 ul

Digest for 2 - 4 hours at 37 °C with shaking.

-electrophoresis of pACYCDuet-1 digestion products:

column 1: 1kb plus marker

column 2 & 3: digestion product

column 4: undigested pACYCDuet-1

nothing appear on gel after digestion, therefore we will miniprep pACYCDuet-1 and try again to digest it.

Sabotage

ASDF

12^th August

Clovis

Start 2 cultures of MG1655 pACYCDuet-1 strain (ST003), 5mL each for further miniprep

Phusion PCR of lacZalpha out of pUC18 (pT007)

with primers :

iT.0001 (Fw, added NcoI cut site) CCATGGCTGGCTTAACTATGCGG

iT.0002 (Rv, added BglII cutsite) AGATCTGTGAGTTAGCTCACTCATTAGG

Column 1; 100kb plus ladder

Column 2,3,4,5,6; PCR product

Gel purification of column 5 and 6 → 19,2 ng/ul

Sabotage

ASDF

13^th August

Clovis

Digestion of the PCR product (LacZalpha) with NcoI and BglII

PCR purification using Thermo Scintific Kit of the digestion → 6,2 ng/ul

Miniprep of pACYADuet-1 (pT002) using Thermo Scientific Kit → 132,7 ng/ul

Start O/N sT005 and sT010

Vincent

PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006

PCR Gradient of 8 tubes +-5°C around 54°C for both PCRs (pUC18 and Litmus18i-GFP)

Failure, no bands appear on the gel.

Infectiveness characterization experiments

-the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

-centrifugate phagemid producing cells

-filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

-dilute 200x MGZ1, F+ from O/N

-wait until OD600 = 0.7

-immediately mix MGZ1 and the supernatant in different proportions

here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

1mL MGZ1,F+ + 100ul LB
1mL MGZ1,F+ + 100ul surnageant diluted 1/100
1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
1mL MGZ1,F+ + 100ul surnageant diluted 1/1000

-incubate 45 minutes at 37°C for the protein to be expressed.

Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
1. 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
Plate on LB (10^-6), Kan( 10^-3), Amp(10^-5 - 10^-6), Kan and Amp(10^-2 - 10^-3)

Sabotage

ASDF

14^th August

PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006 (Aude):

Gel Purif (Aude)

Using QiaGen Kit

3 tubes (combined the band)

1 : 13,2 ng/uL

2 : 14 ng/uL

3 : 2O ng/uL

Digestions ( Aude )

Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)

Reagent	Volume
Purified Plasmid	10 ul
H₂O	75 ul
10x FastDigest Green Buffer	10 ul
EcoRI	2.5 ul
XhoI	2.5 ul
FastAP Phosphatase	0 ul
Total Volume	100.0 ul

Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)

Reagent	Volume
Purified Plasmid	15 ul
H₂O	75 ul
10x FastDigest Green Buffer	10 ul
EcoRI	2.5 ul
XhoI	2.5 ul
FastAP Phosphatase	0 ul
Total Volume	100.0 ul

=> 2h30 à 37°C

Run on a a gel.

only see a smear, Everything was digested ,
redigest but just 25 minutes as said on the thermoscientific protoc.

Digestions ( CLovis )

Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)

Reagent	Volume
Purified Plasmid	10 ul
H₂O	75 ul
10x FastDigest Green Buffer	10 ul
EcoRI	2.5 ul
XhoI	2.5 ul
FastAP Phosphatase	0 ul
Total Volume	100.0 ul

Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)

Reagent	Volume
Purified Plasmid	15 ul
H₂O	75 ul
10x FastDigest Green Buffer	10 ul
EcoRI	2.5 ul
XhoI	2.5 ul
FastAP Phosphatase	0 ul
Total Volume	100.0 ul

25 minutes at 37°C

It worked!

Gel purification (Clovis)

ACY Nco Dig : 6,3 ng/ul

ACY Xho Dig : 7,8 ng/uL

PCR Gradient of 8 tubes +10°C around 54°C for both PCRs (Litmus18i-GFP) but start not from the miniprep ut from a fresh culture of litmus GFp

Only see the primer => try again with new miniprep

Sabotage

ASDF

15^th August

Miniprep (Clovis)

pACY (pT002) : 109ng/uL

litmus (pT005) : 610 ng/Ul

Ligation (Aude, Clovis ,Vincent)

masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)

CHosen Vector mass = 50 ng

lacZ :

Digestion vector : 6,3 ng/ul

Digestion insert : 6,2

masse insert = 10*449/3770*50 = 59 ng

Protocol

Vector : 8 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Let incubate at 22°C for 30 min

Kan :

Digestion vector : 7,8 ng/ul

Digestion insert : 12ng/ul

Insert mass = 10*1052/3770*50 = 140 ng

Protocole Ligation

Vector : 7 uL

Insert : 11 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Transformation : (in chemical competent NEB turbo (made on the …) Aude Clovis

1) Thaw competent cells on ice.

These can be prepared using the CaCl2 protocol.

2) Add 5 ul of ligation product

4) Mix gently by flicking the tube.

5) Chill on ice for 30 minutes.

4) Heat shock at 42 °C for 30 seconds.

5) Return to ice for 2 minutes.

6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

7) Plate on selective media

Plate on :

Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm

Tube 3 : ligation Kan-pACY (5uL) Kan Cm

Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

PCR (litmus = Backbone) Vincent

8 tubes, gradient 10°C around 64°C , started from a new miniprep

We see the plasmid => too concentrated

PCR (litmus pour la gibbson) Clovis

sTOO5 primer 005 006 protocol phusion (gradient around 64 + or – 5 °C)

Elongaiton time 2min10. Started with the new miniprep diluted.

Infectiveness characterization experiments (Vincent)

-the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

After checking GFP fluorescence of sT007 and its negative result, we decided to make a new sT007 glycerol stock. We used a colony from the first successful Infectiveness characterization experiments that was both AMP+KAN resistant and expressed GFP.

The following experiment was conducted with this new sT007 (strain MGZ1).

-centrifugate phagemid producing cells

-filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

-This experiment was conducted both on MGZ1(F+) and MG1655(F+)

-dilute 200x MGZ1 and MG1655 from O/N

-wait until OD600 = 0.7

-immediately mix MGZ1 and the supernatant in different proportions

here we planned to try 1/10 (vol supernatant/vol cells)

1mL MGZ1,F+ + 100ul LB
1mL MGZ1,F+ + 100ul surnageant diluted 1/100

-incubate 45 minutes at 37°C for the protein to be expressed.

Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
1. 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

Plate on LB (10^-4 10^-5 10^-6), Kan(10^-1 10^-2 10^-3), Amp(10^-4 10^-5 - 10^-6), Kan and Amp(10^-1 10^-2 - 10^-3)

Sabotage

ASDF

16^th August

Results from Infectiveness characterization experiments (Vincent)

 See file “phage infectivness 15_08.xlsx”

Results

Transformations : (Aude)

Lac : “tapis” on all the plates even the negative control => plates were not done correctly, antibio added to early => do another transformation

Kan : Some colonies on the plates , but also colonies on the negative control => launch few colonies on liquid media (with Kan, Cm)

Phage infectiveness : (Vincent)

Run PCR (Litmus-Gibbson) (Aude)

Small point around 3000-3500bp

Run another gel with large holes to check if it is correct and purify => Not correct, nothing on the new gel

Transformation : (in chemical competent NEB turbo ) Aude Clovis

Rest of ligation product

1) Thaw competent cells on ice.

These can be prepared using the CaCl2 protocol.

2) Add 5 ul of ligation product

4) Mix gently by flicking the tube.

5) Chill on ice for 30 minutes.

4) Heat shock at 42 °C for 30 seconds.

5) Return to ice for 2 minutes.

6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

7) Plate on selective media

Plate on :

Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm

Tube 3 : ligation Kan-pACY (5uL) Kan Cm

Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

Gel from PCR litmus (Clovis)

1kB ladder / triple puit (3*50uL) from column 2,3,4 of PCR

50V

Infectiveness characterization experiments (Aude)

-the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

-centrifugate phagemid producing cells

-filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

-dilute 200x MG, F+ from O/N

-wait until OD600 = 0.7

-immediately mix MG and the supernatant in different proportions

here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

1mL MG,F+ + 100ul LB
1mL MG,F+ + 100ul surnageant diluted 1/10
1mL MG,F+ + 100ul surnageant diluted 1/100
1mL MG,F+ + 100ul surnageant diluted 1/1000
1mL MG,F+ + 100ul surnageant diluted 1/10000

-incubate 45 minutes at 37°C for the protein to be expressed.

Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5
1. 4 times 5 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

Plate on LB (10^-5), Kan( 10^-2), Amp(10^-5), Kan and Amp(10^-2)

Ligation (Vincent)

masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)

CHosen Vector mass = 50 ng

lacZ :

Digestion vector : 6,3 ng/ul

Digestion insert : 6,2

masse insert = 10*449/3770*50 = 59 ng

Protocol

Vector : 8 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Let incubate at 22°C for 30 min

Kan :

Digestion vector : 7,8 ng/ul

Digestion insert : 12ng/ul

Insert mass = 10*1052/3770*50 = 140 ng

Protocole Ligation

Vector : 7 uL

Insert : 11 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Transformation : (in chemical competent NEB turbo (made on the …) vincent

1) Thaw competent cells on ice.

These can be prepared using the CaCl2 protocol.

2) Add 5 ul of ligation product

4) Mix gently by flicking the tube.

5) Chill on ice for 30 minutes.

4) Heat shock at 42 °C for 30 seconds.

5) Return to ice for 2 minutes.

6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

7) Plate on selective media

Plate on :

Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

Tube 2 : ligation lacZ-pacy (10uL) Xgal /IPTG /Cm

Tube 3 : ligation Kan-pACY (10uL) Kan Cm

Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

PCR pUC18 (pT007)

5*50uL

34 H2O

10 Buffer 5x

1 dNTP

2.5 FW iT007

2.5 RV iT008

0.2 pUC18

0.5 phusion

50uL Tot

Tm = 55°C

te = 2min10

no bands

PCR Litmus (Clovis):

Trouble shooting : since the temperature does not help, that it was not the mini prer = but that we see homodimere between the primers => try with less primers

PCR litmus (pT005)

5*50ul

40 H2O

10 Buffer 5x

1 dNTP

0.5 FW iT005

0.5 RV iT006

0.2 litmus

0.5 phusion

50ul Tot

Tm = 64°C

te = 2min10

Sabotage

ASDF

17^th August

Results

Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.
Phage infectiveness : Experiment worked => results here

Repcr inserts / redigest vector

PCR KanR out of pCOLA (pT003)

5*50ul

34 H2O

10 Buffer 5x

1 dNTP

2.5 FW iT003

2.5 RV iT004

0.2 pCOLA

0.5 phusion

50ul Tot

Tm = 54°C

te = 45sec

PCR LacZ out of pUC18 (pT007)

5*50ul

34 H2O

10 Buffer 5x

1 dNTP

2.5 FW iT001

2.5 RV iT002

0.2 pUC18

0.5 phusion

50ul Tot

Tm = 54°C

te = 45sec

Gel of PCR Kan and LacZ

5 puits LacZ / 100bP+ / 5 puits Kan

Preparaiton of the vectors to clone the sRNA

PCR litmus (pT005)

5*50ul

40 H2O

10 Buffer 5x

1 dNTP

0.5 FW iT003

0.5 RV iT004

0.2 pCOLA (pT007)

0.5 phusion

50ul Tot

Tm = 64°C

te = 2min10

Results

Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.
Phage infectiveness : Experiment worked => results here

Repcr inserts / redigest vector

PCR KanR out of pCOLA (pT003)

5*50ul

34 H2O

10 Buffer 5x

1 dNTP

2.5 FW iT003

2.5 RV iT004

0.2 pCOLA

0.5 phusion

50ul Tot

Tm = 54°C

te = 45sec

PCR LacZ out of pUC18 (pT007)

5*50ul

34 H2O

10 Buffer 5x

1 dNTP

2.5 FW iT001

2.5 RV iT002

0.2 pUC18

0.5 phusion

50ul Tot

Tm = 54°C

te = 45sec

Gel of PCR Kan and LacZ

5 puits LacZ / 100bP+ / 5 puits Kan

-->img 622<--

Preparaiton of the vectors to clone the sRNA

PCR litmus (pT005)

5*50ul

40 H2O

10 Buffer 5x

1 dNTP

0.5 FW iT003

0.5 RV iT004

0.2 pCOLA (pT007)

0.5 phusion

50ul Tot

Tm = 64°C

te = 2min10

Sabotage

ASDF

19^th August

CLONING the target Plasmids (Kan and lacZ)

Gel purification of LacZ using Thermo Scientific Kit

lacZ : 83 ng/ul

Gel purification of Kan using Thermo Scientific Kit

Kan : 80ng/ul

Digestion of pACYC (pT002) with EcoRI and XhoI

10 H2O

2 Buffer

4 pACYC

2 EcoRI

2 XhoI

20uL Tot

37°C

20min

Digestion of pACYC (pT002) with BglII and NcoI

10 H2O

2 Buffer

4 pACYC

2 BglII

2 NcoI

20uL Tot

37°C

20min

Digestion of Kan insert with EcorI and XhoI

10 H2O

15 Kan insert

3 Buffer

1 EcoRI

1 XhoI

30uL Tot

37°C

20min

Digestion of LacZ insert with BglII and NcoI

10 H2O

15 LacZ insert

3 Buffer

1 BglII

1 NcoI

30uL Tot

37°C

20min

Gel of digestions

100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI

Colum purification of Kan insert digestions using Thermo Scientific Kit

Column purification of LacZ insert digestions using Thermo Scientific Kit

Colum purification of pACYC digestions using Thermo Scientific Kit

Heat inactivation of Kan digestion

65°C

20min

Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)

Digestion vector : 6.8 ng/ul

Digestion insert : 14

masse insert = 10*1052/3770*50 = 140 ng

Vector : 7.35 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Let incubate at 22°C for 30 min

Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)

Digestion vector : 6.8 ng/ul

Digestion insert : 40/2 = 20

masse insert = 10*1052/3770*50 = 140 ng

Vector : 7.35 uL

Insert : 7 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

H2O : 4 uL

Let incubate at 22°C for 30 min

Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)

Digestion vector : 10? ng/ul

Digestion insert : 33

masse insert = 10*449/3770*50 = 59 ng

Vector : 5 uL

Insert : 1.8 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

H2O : 11 uL

Let incubate at 22°C for 30 min

Chemical transformation in NEB turbo

Reference protocol

Recovery 1 hour.

Plate on

Tube 1 = negative control

Tube 2 : Kan (purif) Kan / Cm

Tube 3 : Kan (heat inactivated) Kan/ Cm

Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal

Cloning the Weapon (ie sRNA into Litmus and pUC 18)

Gel of litmus PCR

Gel purification of litmus PCR using Thermo Scientific Kit

PCR from mini Gene sRNA anti Kan

35 H2O

10 Buffer 5x

1 dNTP

2 FW iT009

2 RV iT0010

0.2 minigene-plasmid amp from IDT

0.5 phusion

PCR Phusion Gradient around 53 °C

Time : 30 secondes

Gibson Assembly

Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL

Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop = 26,7)

Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene (nanodrop = 26,7)

Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.

Regular cloning using biobricks

Digestion

Insert sRNA cut by XbaI & PstI

Vector Litmus cut by PstI & SpeI

Insert sRNA cut by EcoRI & SpeI

Vector Litmus cut by EcoRI & SpeI

Digestion of Vectors

10 H2O

2 Buffer

4 Vector

2 Enz 1

2 Enz 2

20uL Tot

37°C

20min

Digestion of Inserts

10 H2O

15 insert

3 Buffer

1 Enz 1

1 Enz 2

30uL Tot

37°C

20min

Heat inactivation before ligation

80°C for 20 minutes

Ligation

pUC= 40ng in 20 uL => 3ng/ul

litmus 340ng =>17ng /ul

insert 420 ng => 14 ng / uL

Litmus :

7uL vector

8 ul insert

2 uL Buffer

O,2 uLT4 DNA ligase

3ul Water

Vtot = 20 uL

pUC

20 uL vector

9 uL insert

4 uL Buffer

0,4 T4 DNA

7 uL water

Vtot = 40uL

Chemical transformation in NEB turbo

Tube 1 : negative control

Tube 2 lig litmus

Tube 3 lig pUC

plate everything on amp

Sabotage

ASDF

20^th August

CLONING the target Plasmids (Kan and lacZ)

Gel purification of LacZ using Thermo Scientific Kit

lacZ : 83 ng/ul

Gel purification of Kan using Thermo Scientific Kit

Kan : 80ng/ul

Digestion of pACYC (pT002) with EcoRI and XhoI

10 H2O

2 Buffer

4 pACYC

2 EcoRI

2 XhoI

20uL Tot

37°C

20min

Digestion of pACYC (pT002) with BglII and NcoI

10 H2O

2 Buffer

4 pACYC

2 BglII

2 NcoI

20uL Tot

37°C

20min

Digestion of Kan insert with EcorI and XhoI

10 H2O

15 Kan insert

3 Buffer

1 EcoRI

1 XhoI

30uL Tot

37°C

20min

Digestion of LacZ insert with BglII and NcoI

10 H2O

15 LacZ insert

3 Buffer

1 BglII

1 NcoI

30uL Tot

37°C

20min

Gel of digestions

100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI

Colum purification of Kan insert digestions using Thermo Scientific Kit

Column purification of LacZ insert digestions using Thermo Scientific Kit

Colum purification of pACYC digestions using Thermo Scientific Kit

Heat inactivation of Kan digestion

65°C

20min

Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)

Digestion vector : 6.8 ng/ul

Digestion insert : 14

masse insert = 10*1052/3770*50 = 140 ng

Vector : 7.35 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

Let incubate at 22°C for 30 min

Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)

Digestion vector : 6.8 ng/ul

Digestion insert : 40/2 = 20

masse insert = 10*1052/3770*50 = 140 ng

Vector : 7.35 uL

Insert : 7 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

H2O : 4 uL

Let incubate at 22°C for 30 min

Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)

Digestion vector : 10? ng/ul

Digestion insert : 33

masse insert = 10*449/3770*50 = 59 ng

Vector : 5 uL

Insert : 1.8 uL

Buffer : 2 uL

T4 DNA ligase : 0,2 uL

H2O : 11 uL

Let incubate at 22°C for 30 min

Chemical transformation in NEB turbo

Reference protocol

Recovery 1 hour.

Plate on

Tube 1 = negative control

Tube 2 : Kan (purif) Kan / Cm

Tube 3 : Kan (heat inactivated) Kan/ Cm

Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal

Cloning the Weapon (ie sRNA into Litmus and pUC 18)

Gel of litmus PCR

Gel purification of litmus PCR using Thermo Scientific Kit

PCR from mini Gene sRNA anti Kan

35 H2O

10 Buffer 5x

1 dNTP

2 FW iT009

2 RV iT0010

0.2 minigene-plasmid amp from IDT

0.5 phusion

PCR Phusion Gradient around 53 °C

Time : 30 secondes

Gibson Assembly

Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL

Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop = 26,7)

Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene (nanodrop = 26,7)

Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.

Regular cloning using biobricks

Digestion

Insert sRNA cut by XbaI & PstI

Vector Litmus cut by PstI & SpeI

Insert sRNA cut by EcoRI & SpeI

Vector Litmus cut by EcoRI & SpeI

Digestion of Vectors

10 H2O

2 Buffer

4 Vector

2 Enz 1

2 Enz 2

20uL Tot

37°C

20min

Digestion of Inserts

10 H2O

15 insert

3 Buffer

1 Enz 1

1 Enz 2

30uL Tot

37°C

20min

Heat inactivation before ligation

80°C for 20 minutes

Ligation

pUC= 40ng in 20 uL => 3ng/ul

litmus 340ng =>17ng /ul

insert 420 ng => 14 ng / uL

Litmus :

7uL vector

8 ul insert

2 uL Buffer

O,2 uLT4 DNA ligase

3ul Water

Vtot = 20 uL

pUC

20 uL vector

9 uL insert

4 uL Buffer

0,4 T4 DNA

7 uL water

Vtot = 40uL

Chemical transformation in NEB turbo

Tube 1 : negative control

Tube 2 lig litmus

Tube 3 lig pUC

plate everything on amp

Sabotage

ASDF

21^st August

Place your twit here

Results of assemblies (Colonies on the transformation plates):

sRNA –Kan into Litmus by Gibson: Success

sRNA – Kan into Litmus by biobrick assembly: Success

sRNA – Kan into pUC18 by Gibson: Failure

sRNA – Kan into pUC18 by biobrick assembly: Success

Colony PCR to check if sRNA-KAN is in our Litmus phagemid: positive band between 400 and 500: (expected length 419bp)

Check the design of primers to clone out Kan => problem => redesign them

Design of the primers to sequence all the cloning

Launch 3 colonies of each successful cloning

Glycerol and mini prep of all the launched colonies / need 3 before we have

Construction of target strain

Electroporation of pCOLA in MGZ1 F+

Construction of weapon strains

Electroporation of litmus-GFP-sRNA in XL1 Blue-M13KO7-Helper

Electroporation of Litmus-GFP-sRNA and M13K07 in MGZ1 F+

Chemical transformation of minigene+vector-sRNA anti Kan in NEB turbo

Sabotage

ASDF

22^nd August

Results :

All the transformation worked

Launch cultures (to do experiment)

mGZ1 F+ -Cola
MGZ1 F+ litmus + Helper

Launch overnigh culture to do glycerols.

exploring the parameters in play in the phage infectiveness of our new phagemid construct

-diluting 100x O/N of MGZ1, F+

-mix with 1/10 vol of supernatant containing phagemids with the cells with the following combination of parameters:

OD600 : 0.3 0.6 0.9

Plate at different time (min) after first contact with the supernatant: 2, 30, 60

Silencing experiments

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan

- At OD 0,7 : 4 tubes : Ctrl, P1, P2 ,P3. Put 1 mL of cells in each tube. Centrifuge. Take out supernatant, resuspend in 1mL of LB. Add in tubes respectively : nothing, 100uL phages of Miniprep 1, Miniprep 2, miniprep 3.

- Incubate 45 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 dilutions on Kan and LB and 100 ul of 10-2 and 10-3 dilution on Kan.

Sabotage

ASDF

23^th August

Results: failure: as much GFP+ colonies growing on Kan than on LB

PCR from mini Gene sRNA anti Cm

35 H2O

10 Buffer 5x

1 dNTP

2 FW iT009

2 RV iT0010

0.2 minigene-plasmid amp from IDT

0.5 phusion

PCR Phusion Gradient around 53 °C

Time : 30 secondes

Sabotage

ASDF

26^th August

Digestion of litmus miniprep (C=280ng/uL)with PstI and SpeI

13 H2O

3 litmus miniprep

2 Buffer

1 PstI

1 SpeI

20uL Tot

37°C

20min

Digestion of sRNA_Cm insert (C=31ng/uL) with XbaI and PstI

10 H2O

15 sRNA_Cm insert

3 Buffer

1 XbaI

1 PstI

30uL Tot

37°C

20min

PCR purification of litmus digestion using Thermo Scientific Kit

PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit

Ligation sRNA_Cm insert purif + litmus

Digestion vector : 13,3 ng/ul

Digestion insert : 10

masse insert = 10*376/3626*50 = 52 ng

Vector : 3.8 uL

Insert : 5.2 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 8 uL

Let incubate at 22°C for 30 min

Ligation control litmus

Vector : 3.8 uL

Insert : 0 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 13,2 uL

Let incubate at 22°C for 30 min

Digestion of pUC18 PCR (C=13ng/uL) with EcorI and SpeI

10 H2O

15 pUC18 PCR

3 Buffer

1 EcorI

1 SpeI

30uL Tot

37°C

20min

Digestion of sRNA_Cm insert (C=31ng/uL) with SpeI and EcorI

10 H2O

15 sRNA_Cm insert

3 Buffer

1 EcorI

1 SpeI

30uL Tot

37°C

20min

PCR purification of pUC18 digestion using Thermo Scientific Kit

PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit

Ligation sRNA_Cm insert purif + pUC18

Digestion vector : 4,3 ng/ul

Digestion insert : 9,4

masse insert = 10*362/2175*50 = 83 ng

Vector : 11,6 uL

Insert : 8,8 uL

Buffer : 3 uL

T4 DNA ligase : 1,5 uL

H2O : 7,1 uL

Let incubate at 22°C for 30 min

Ligation control pUC18

Vector : 11,6 uL

Insert : 0 uL

Buffer : 3 uL

T4 DNA ligase : 1,5 uL

H2O : 15,9 uL

Let incubate at 22°C for 30 min

Chemical transformation in NEB-Turbo only (control -)

Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + litmus

Chemical transformation in NEB-Turbo of ligation control litmus

Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + pUC18

Chemical transformation in NEB-Turbo of ligation control pUC18

Chemical transformation in NEB-Turbo of litmus (control +)

Plate all 5 on Amp

PCR from mini Gene sRNA anti LacZ

35 H2O

10 Buffer 5x

1 dNTP

2 FW iT009

2 RV iT0010

0.2 minigene-plasmid amp from IDT

0.5 phusion

PCR Phusion Gradient around 53 °C

Time : 30 secondes

Sabotage

ASDF

27^th August

Place your twit here

Building anti LacZ weapons:

Gibson assembly of litmus (sT005) and sRNA_LacZ

Digestion vector : 56 ng/ul

Digestion insert : 9,6

masse insert = 5*376/3626*50 = 26 ng

Vector : 1 uL

Insert : 3 uL

Master Mix : 5 uL

H2O : 1

Heat shock following Gibson assembly kit protocole.

Biobrick assembly of sRNA_LacZ in litmus-GFP and pUC18

Using digested vectors (litmus-GFP and pUC18) from 26/08

Digestion of sRNA_LacZ insert (C=48ng/uL) with XbaI and PstI

10 H2O

15 sRNA_LacZ insert

3 Buffer

1 PstI

1 XbaI

30uL Tot

37°C

20min

Digestion of sRNA_LacZ insert (C=45ng/uL) with SpeI and EcorI

10 H2O

15 sRNA_LacZ insert

3 Buffer

1 EcorI

1 SpeI

30uL Tot

37°C

20min

Purification on column

ligation:

Ligation sRNA_LacZ insert purif + pUC18

Digestion vector : 4,3 ng/ul

Digestion insert : 18

masse insert = 10*362/2175*50 = 83 ng

Vector : 11,6 uL

Insert : 4,6 uL

Buffer : 3 uL

T4 DNA ligase : 1,5 uL

H2O : 11 uL

Let incubate at 22°C for 30 min

Ligation sRNA_LacZ insert purif + litmus

Digestion vector : 13,3 ng/ul

Digestion insert : 11,4

masse insert = 10*376/3626*50 = 52 ng

Vector : 3.8 uL

Insert : 4,56 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 8,64 uL

Let incubate at 22°C for 30 min

Preparing experiments of LacZ silencing

Plating MGZ1, F+ ; MG1655, F+ ; NEB Turbo on IPTG+Xgal

Sabotage

ASDF

28^th August

as expected MGZ1 and MG1655 turn blue.

Result from assemblies:

Gibson sRNA LacZ in litmus-GFP: failure

Biobrick assembly sRNA LacZ in Litmus-GFP : success

Biobrick assembly sRNA LacZ in pUC18 : success

Miniprep of Litmus-GFP-sRNACm ,Litmus-GFP-sRNALacZ, pUC18-sRNACm , pUC18-sRNALacZ

Building phagemid weapon producing cells: Transformation of electrocompetent MGZ1, F+ with M13K07 + Litmus-GFP-sRNALacZ / Litmus-GFP-sRNACm

Transforming:

-1) negative control : 5,2

-2) IDT plasmid with sRNALacZ ( should form white colonies of MGZ1 on Xgal+IPTG):5,1

-3) Litmus-GFP-sRNALacZ1 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2

-4) Litmus-GFP-sRNALacZ3 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2

-5) Litmus-GFP-sRNACm1 (control XGal ) : 5,2

-6) Litmus-GFP-sRNACm1 + M13K07: 5,2

-7) Litmus-GFP-sRNACm2 + M13K07 : 5,2

-8) Litmus-GFP-sRNACm3 + M13K07: 5,2

-9) Litmus-GFP-sRNALacZ1 + M13K07 : 5,2

-10) Litmus-GFP-sRNALacZ3 + M13K07: 5,2

plate on AMP+IPTG+Xgal ( silencing of LacZ on MGZ1 strain) and KAN+AMP (phage factories cells)

Sabotage

ASDF

29^th August

Place your twit here

silencing of LacZ failed on MGZ1: the sequence of LacZ might have mutation compared to MG1655 for which the sRNA was designed or the test is not quantitative enough (one sRNA => several proteins). Try to find a way to get quantitative data about the silencing => Miller Assay

Sabotage

ASDF

30^th August

Place your twit here

attempt to silence LacZ on MG1655, F+ with litmusGFP-LacZ1 & litmusGFP-LacZ2

XXXXX

Silencing experiments (LacZ)

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan

- At OD 0,7 : 5 tubes. Put 1 mL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2, litmusGFP-Cm1 & litmusGFP-Cm2

litmusGFP-Cm1 & litmusGFP-Cm2 are used as negative control.

- Incubate 45 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 and 10-3 dilutions on IPTG+Xgal and LB and 100uL on AMP+IPTG+Xgal and LB.

Sabotage

ASDF

3^rd September

Silencing experiments (Cm)

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

- At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2, litmusGFP-Cm1 & litmusGFP-Cm2

litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.

- Incubate 45 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

	LB	Cm 25 ug/ul	Cm 250ug/ul	Cm 500 ug/ul
non infected	10^-4	10^-4	10^-4	10^-4
sRNA anti lacz	10^-4	10^-4	10^-3	10^-3
sRNA Cm1	10^-4	10^-4	10^-3	10^-3
sRNA Cm2	10^-4	10^-4	10^-3	10^-3
sRNA Cm3	10^-4	10^-4	10^-3	10^-3
sRNA Cm4	10^-4	10^-4	10^-3	10^-3

Sabotage

ASDF

4^th September

Results of silencing experiments

It works !

Miller assay

XXXXXX

Redo the silencing experiment

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

- At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 & litmusGFP-Cm2

litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.

- Incubate 45 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

	LB	Cm 25 ug/ul	Cm 125 ug/ul	Cm 250ug/ul	Cm 500 ug/ul
non infected	10^-4	10^-4	10^-4	10^-4	10^-4
sRNA anti lacz	10^-4	10^-4	10^-3	10^-3	10^-3
sRNA Cm1	10^-4	10^-4	10^-3	10^-3	10^-3
sRNA Cm2	10^-4	10^-4	10^-3	10^-3	10^-3
sRNA Cm3	10^-4	10^-4	10^-3	10^-3	10^-3
sRNA Cm4	10^-4	10^-4	10^-3	10^-3	10^-3

Sabotage

ASDF

5^th September

Confirmation of silencing (CmR)

Cloning biobricks : ie clone sRNAs (Cm, Kan, lacZ) in pB1C3

Reagent	Volume
Purified PCR Product	16 ul
H₂O	0 ul
10x FastDigest Buffer	2 ul
FastDigest Enzyme 1	1 ul
FastDigest Enzyme 2	1 ul
Total Volume	20.0 ul

Digest for 0.5 - 1 hours at 37 °C with shaking

Ligation sRNA into biobrick vector

masse insert = 10*419/2000*100 = 210 ng

Vector : 5 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 2uL

Let incubate at 22°C for 30 min

Transformation in NEB turbo chemical competent . Plate on Cm

Sabotage

ASDF

7^th September

Place your twit here

07/09/13

Results Transformation

Colonies on the different paltes (no colonies on the negative controls)

PCR Colonies

Primer from Phage sensor team : XXXXX

Gel :

XXXXX

Sabotage

ASDF

10^th September

Place your twit here

Experiment Silencing Cm (try to reduce the noise, aka the variability)

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

- At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 & litmusGFP-Cm2

-3 replicates for each condition. Plate each Dilution 2 times to limit the variability

Non infected cells (1,2,3)

Cells infected with anti lacZ (1,2,3)

Cells infected with anti CmA (1,2,3)

Cells infected with antiCmB (1,2,3

- Incubate 45 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

	LB	Cm 25 ug/ul	Cm 250ug/ul	Cm 500 ug/ul
non infected 1	10^-5/4	10^-5/4	10^-5/4	10^-5/4
non infected 2	10^-5/4	10^-5/4	10^-5/4	10^-5/4
non infected 3	10^-5/4	10^-5/4	10^-5/4	10^-5/4
sRNA lacZ 1	10^-4	10^-4	10^-4/2	10^-2/1
sRNA lacZ 2	10^-4	10^-4	10^-4/2	10^-2/1
sRNA lacZ 3	10^-4	10^-4	10^-4/2	10^-2/1
sRNA Cm A 1	10^-4/3	10^-4/3	10^-3	10^-2/1
sRNA Cm A 2	10^-4/3	10^-4/3	10^-3	10^-2/1
sRNA Cm A 3	10^-4/3	10^-4/3	10^-3	10^-2/1
sRNA Cm B 1	10^-4/3	10^-4/3	10^-3	10^-2/1
sRNA Cm B 2	10^-4/3	10^-4/3	10^-3	10^-2/1
sRNA Cm B 3	10^-4/3	10^-4/3	10^-3	10^-2/1

Sabotage

ASDF

11^th September

Results experiment Silencing

AT a concentration of 500mg/ul, we get 99,1% of killing (on 12 replicates) with a standard déviation of 1,19

When you try to understand why are the cells surviving, it is mainly due to the non silencing of the cells
This problem can be due to the necessity of the sRNA to match to the plasmid sequence perfectly (and therefore problemsof mutations, especially on phage).

Sabotage

ASDF

14^th September

Place your twit here

Cloning two sRNA on the same phagemid

P009 (litmus Kan) + sRNA Cm :

P027 (litmus Cm) + sRNA Kan :

Inserts

sRNA Cm : 35 ng/uL Final (16*35/20) = 28 ng/uL

sRNA Kan : 16 ng/uL Final (16*16/20) = 12,8 ng/uL

Reagent	Volume
Purified PCR Product	16 ul
H₂O	0 ul
10x FastDigest Buffer	2 ul
XbaI	1 ul
Pst1	1 ul
Total Volume	20.0 ul

Vectors

Litmus Kan : 350 ng /uL Final (3*350/20) = 52,5 75 ng/ul

Litmus Cm : 750 ng /ul Final (2*750/20) = 75 ng/uL

Reagent	Volume
Purified PCR Product	3
H₂O	13 ul
10x FastDigest Buffer	2 ul
Pst1	1 ul
SpeI	1 ul
Total Volume	20.0 ul

Ligation sRNA into biobrick vector

Litmus Kan + sRNA anti Cm

masse insert = 10*419/4000*100 = 110 ng

Vector : 3 uL

Insert : 4 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 10uL

Litmus Cm + sRNA anti Kan

masse insert = 10*419/4000*100 = 110 ng

Vector : 1,5 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 5,5uL

Let incubate at 22°C for 30 min

Launch cultures :

Glycerol of the different biobricks : sT040 ; sT041 ; sT042 sT043 ; sT044 ; sT045 ; sT046 ; sT047 on Cm

MG F+ + pCola sT027 on Kan :

MGZ1, F+ Litmus-GFP-sRNA antiKan + M13KO7 Helper col : sT022 sT023 sT024 on Kan Amp

Sabotage

ASDF

15^th September

Exp Silencing Kan

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)

- At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2

-2 replicates for each condition. Plate each Dilution 2 times to limit the variability

Non infected cells (1,2)

Cells infected with anti lacZ (1,2)

Cells infected with anti KanA (1,2)

Cells infected with anti KanB (1,2,)

- Incubate 70 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

	LB	Kan 25 ug/ul	Kan 250ug/ul	Kan 500 ug/ul
non infected 1	10^-5/4	10^-4/3	10^-4/3	10^-4/3
non infected 2	10^-5/4	10^-4/3	10^-4/3	10^-4/3
sRNA lacZ 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA lacZ 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan A 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan A 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan B 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan B 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2

Miniprep biobricks

Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2

Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector

Litmus Kan + sRNA anti Cm

masse insert = 10*419/4000*100 = 110 ng

Vector : 3 uL

Insert : 4 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 10uL

Litmus Cm + sRNA anti Kan

masse insert = 10*419/4000*100 = 110 ng

Vector : 1,5 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 5,5uL

Let incubate at 22°C for 30 min

Transformation in chemical competent 10G cells : plate on Amp;

Sabotage

ASDF

18^th September

Exp Silencing Kan

- Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

-diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)

- At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2

-2 replicates for each condition. Plate each Dilution 2 times to limit the variability

Non infected cells (1,2)

Cells infected with anti lacZ (1,2)

Cells infected with anti KanA (1,2)

Cells infected with anti KanB (1,2,)

- Incubate 70 minutes at 37°C

- Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

	LB	Kan 25 ug/ul	Kan 250ug/ul	Kan 500 ug/ul
non infected 1	10^-5/4	10^-4/3	10^-4/3	10^-4/3
non infected 2	10^-5/4	10^-4/3	10^-4/3	10^-4/3
sRNA lacZ 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA lacZ 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan A 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan A 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan B 1	10^-5/4	10^-4/3	10^-4/3	10^-3/2
sRNA Kan B 2	10^-5/4	10^-4/3	10^-4/3	10^-3/2

Miniprep biobricks

Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2

Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector

Litmus Kan + sRNA anti Cm

masse insert = 10*419/4000*100 = 110 ng

Vector : 3 uL

Insert : 4 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 10uL

Litmus Cm + sRNA anti Kan

masse insert = 10*419/4000*100 = 110 ng

Vector : 1,5 uL

Insert : 10 uL

Buffer : 2 uL

T4 DNA ligase : 1 uL

H2O : 5,5uL

Let incubate at 22°C for 30 min

Transformation in chemical competent 10G cells : plate on Amp;

Sabotage

ASDF

20^th September

results from sequencing:

Litmus-Anti LacZ: OK

Litmus-Anti Kan: OK

Litmus-Anti Cm: OK

@@ Line 111: / Line 111: @@
      .tbnote h3 {
      font-size:17px;
-     margin-top:-25px;
+     position:relative;
-     margin-bottom:10px;
+     bottom:10px;
+    left:65%;
      font-weight:normal;
      }

Team:Paris Bettencourt/Notebook

From 2013.igem.org

Revision as of 03:09, 28 October 2013

Detect

Saturday 13th August

Detect

Sunday 14th July

Detect

Monday 15th July

Detect

Tuesday 16th July

Detect

Wednesday 17th of July

Detect

Thursday 18th July

Detect

Monday 22nd July

Detect

Tuesday 23rd July

Detect

Monday 29th July

Detect

Tuesday 30th July

Detect

Wednesday 31st July

Detect

Thursday 1st August

Detect

Friday 2nd August

Detect

Monday 5th August

Detect

Tuesday 6th August

Detect

Wednesday 7th August

Detect

Thursday 8th August

Detect

Friday 9th August

Detect

Saturday 10th August

Detect

Sunday 11th August

Detect

Monday 12th August

Detect

Tuesday 13th August

Detect

Wednesday 14th August

Detect

Thursday 15th August

Detect

Friday 16th August

Detect

Monday 19th August

Detect

Tuesday 20th August

Detect

Wednesday 21st August

Detect

Thursday 22nd August

Detect

Friday 23rd August

Detect

Sunday 25th August

Detect

Monday 26th August

Detect

Tuesday 27th August

Detect

Wednesday 28th August

Detect

Friday 30th August

Detect

Day Numbersuffix Month

Detect

Wednesday 4th September

Detect

Thursday 5th September

Detect

Saturday 13^th August

Sunday 14^th July

Monday 15^th July

Tuesday 16^th July

Wednesday 17^th of July

Thursday 18^th July

Monday 22^nd July

Tuesday 23^rd July

Monday 29^th July

Tuesday 30^th July

Wednesday 31^st July

Thursday 1^st August

Friday 2^nd August

Monday 5^th August

Tuesday 6^th August

Wednesday 7^th August

Thursday 8^th August

Friday 9^th August

Saturday 10^th August

Sunday 11^th August

Monday 12^th August

Tuesday 13^th August

Wednesday 14^th August

Thursday 15^th August

Friday 16^th August

Monday 19^th August

Tuesday 20^th August

Wednesday 21^st August

Thursday 22^nd August

Friday 23^rd August

Sunday 25^th August

Monday 26^th August

Tuesday 27^th August

Wednesday 28^th August

Friday 30^th August

Day Number^suffix Month

Wednesday 4^th September

Thursday 5^th September

Friday 6^th September

Saturday 7^th September

Sunday 8^th September

Monday 16^th September

Tuesday 17^th September

Wednesday 16^th September

Sunday 22^nd September

Monday 23^rd September

Tuesday 24^th September

Wednesday 25^th September

Thursday 26^th September

Friday 27^th September

Saturday 28^th September

Monday 30^th September

Tuesday 1^st October

Wednesday 2^nd October

Wedsnesday 3^rd October

Monday 14^th October

Tuesday 15^th October

Wednesday 16^th October

Thursday 17^th October

Friday 18^th October

Saturday 19^th October

Tuesday 22^nd October

Thursday 24^th October

Friday 25^th October

Monday 10^th June

Tuesday 11^th June

Wednesday 12^th June

Tuesday 18^th June

24^th June

Monday 1^st July

Tuesday^2nd July

Wednesday 3^rd July