Team:UFMG Brazil/Notebook
From 2013.igem.org
(Difference between revisions)
Line 188: | Line 188: | ||
TGGTTTCGAACTGGAACTGCGTGGTGACGTTGAAATGAAAGGTAAAGGTAAAGTTCGTACCTACTGGC | TGGTTTCGAACTGGAACTGCGTGGTGACGTTGAAATGAAAGGTAAAGGTAAAGTTCGTACCTACTGGC | ||
TGCTGGGTGAACGTGGTTCTTCTACCCGTGGTTAATACTAGTAGCGGCCGCTGCAG – 3’ | TGCTGGGTGAACGTGGTTCTTCTACCCGTGGTTAATACTAGTAGCGGCCGCTGCAG – 3’ | ||
+ | |||
+ | |||
+ | ===What are this sequences?=== | ||
+ | |||
+ | '''PromTorCAD:''' | ||
+ | |||
+ | - Promoter indirectly sensitive to TMAO. | ||
+ | |||
+ | '''PromPDE5_OM:''' | ||
+ | |||
+ | - Promoter of PDE5 (phosphodiesterase 5), sensitive to cGMP. It was going to be used to indirectly detect BNP. | ||
+ | |||
+ | '''PromPDE5_OX:''' | ||
+ | |||
+ | - Promoter of PDE5 (phosphodiesterase 5), sensitive to cGMP. It was going to be used to indirectly detect BNP. | ||
+ | |||
+ | '''NPRA_1 to 7:''' | ||
+ | |||
+ | - Human receptor for BNP. The sequence was divided into 7 parts, called gBlocks, because it was too large to be synthesized as one sequence. The 7 parts were going to be united by using the kit Gibson Assembly Master Mix (NEB catalog #E2611), from New England Biolabs. | ||
+ | |||
+ | |||
+ | ==='''Huston, we have a problem!!!'''=== | ||
+ | |||
+ | - When the sales representant from Síntese Biotecnologia, Juliana Pimenta, tried to make the request of our sequences, IDT software refused 3 of them: | ||
+ | |||
+ | <html> | ||
+ | |||
+ | <img src='https://static.igem.org/mediawiki/2013/6/63/Idt1.jpg'> | ||
+ | <img src='https://static.igem.org/mediawiki/2013/9/93/Idt2.jpg'> | ||
+ | <img src='https://static.igem.org/mediawiki/2013/7/73/Idt3.jpg'> | ||
+ | |||
+ | |||
+ | </html> | ||
+ | |||
+ | ==='''Sad Decision...'''=== | ||
+ | |||
+ | * Since 2 of the refused sequences were of the promoters that we were going to use to detect BNP, and we couldn’t change these sequences, as they are not translated (no codon usage), we decided to give up BNP. If we had more time, we would have looked for other promoters that could be used. | ||
+ | |||
+ | * Hence, only the sequence PromTorCAD was synthesized. | ||
{{Team:UFMG Brazil/sponsor}} | {{Team:UFMG Brazil/sponsor}} |
Revision as of 02:53, 29 October 2013