"
Team:INSA Toulouse/contenu/lab practice/notebook/protocols/backbone
From 2013.igem.org
Mesnageclem (Talk | contribs) |
Mesnageclem (Talk | contribs) |
||
| Line 27: | Line 27: | ||
.texte{color:#5a6060; font-family:'Open Sans'; font-size:14px; margin:0 0 50px 0; line-height:24px; } | .texte{color:#5a6060; font-family:'Open Sans'; font-size:14px; margin:0 0 50px 0; line-height:24px; } | ||
| + | |||
| + | .textepre{color:#434343; font-family:'Open Sans'; font-size:12px; margin:0 0 20px 0; line-height:24px; } | ||
.texteleft{color:#5a6060; font-family:'Open Sans'; font-size:14px; display:block; float:left; width:340px; margin:0 30px 50px 0;} | .texteleft{color:#5a6060; font-family:'Open Sans'; font-size:14px; display:block; float:left; width:340px; margin:0 30px 50px 0;} | ||
| Line 34: | Line 36: | ||
.spantitle{color:#5a6060; font-family:'Open Sans'; font-weight:600; font-size:14px;} | .spantitle{color:#5a6060; font-family:'Open Sans'; font-weight:600; font-size:14px;} | ||
| - | .list{float:left; width: | + | .list{float:left; width:680px; margin:0 15px 50px 0;} |
.list ul{color:#5a6060; font-family:'Open Sans'; font-size:14px;} | .list ul{color:#5a6060; font-family:'Open Sans'; font-size:14px;} | ||
| Line 80: | Line 82: | ||
Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.</p> | Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.</p> | ||
| - | < | + | |
| - | < | + | <div class="list"> |
| + | |||
| + | <ul class="arrow"> | ||
| + | <li><span class="title3">Using the Linearized Plasmid Backbones</span></br> | ||
| + | The DNA Distribution should come with a set of linearized plasmid backbones: pSB1A3, pSB1C3, pSB1K3.m1, and pSB1T3. The linearized plasmid backbones (25ng/µl at 50µl) should be stored at 4°C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.</li> | ||
| + | </ul> | ||
| + | |||
| + | </div> | ||
<p class="texte"><span class="spantitle">Digest</span></br> | <p class="texte"><span class="spantitle">Digest</span></br> | ||
| Line 109: | Line 118: | ||
<i><b>Note</b>: For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of BBa_J04450 was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.</i></p> | <i><b>Note</b>: For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of BBa_J04450 was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.</i></p> | ||
| - | + | <div class="list"> | |
| + | |||
| + | <ul class="arrow"> | ||
| + | <li><span class="title3">Making Linearized Plasmid Backbones</span></li> | ||
| + | </ul> | ||
| + | </div> | ||
| + | |||
| + | <p class="texte"><span class="spantitle">Bulk Production</span></br> | ||
| + | The following is the protocol that we used to create the linearized plasmid backbones shipped with the Spring 2011 DNA Distribution. The protocol is in 96 well format, but may be scaled down to suit smaller batches.</p> | ||
| + | |||
| + | <p class="texte"><span class="spantitle">PCR mix</span></br> | ||
| + | <b>Primers</b></p> | ||
| + | |||
| + | <pre class="textepre">gccgctgcagtccggcaaaaaa,SB-prep-3P-1 | ||
| + | atgaattccagaaatcatccttagcg,SB-prep-2Ea | ||
| + | </pre> | ||
| + | |||
| + | |||
| + | <p class="texte">Diluted to 30 pmol/µl </br> | ||
| + | These primers have been tested with pSB1C3, pSB1A3, pSB1K3, and pSB1T3. | ||
| + | </p> | ||
| + | |||
| + | |||
</div> | </div> | ||
Revision as of 18:17, 5 September 2013
Notebook
Protocols
Plasmid Backbones
This protocol was developed by Tom Knight. Samples of standard Registry plasmid backbones prepared using this method are sent out in the DNA Distribution kits.
Why Linearized Plasmid Backbones?
Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.
- Using the Linearized Plasmid Backbones The DNA Distribution should come with a set of linearized plasmid backbones: pSB1A3, pSB1C3, pSB1K3.m1, and pSB1T3. The linearized plasmid backbones (25ng/µl at 50µl) should be stored at 4°C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.
Digest
· Enzyme Master Mix for Plasmid Backbone (25µl total, for 6 rxns)
➔ 5 µl NEB Buffer 2
➔ 0.5 µl BSA
➔ 0.5 µl EcoRI-HF
➔ 0.5 µl PstI
➔ 0.5 µl DpnI (Used to digest any template DNA from production)
➔ 18 µl dH20
· Digest Plasmid Backbone
➔ Add 4 µl linearized plasmid backbone (25ng/µl for 100ng total)
➔ Add 4 µl of Enzyme Master Mix
➔ Digest 37C/30 min, heat kill 80C/20 min
Ligation · Add 2µl of digested plasmid backbone (25 ng) · Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 µl) · Add equimolar amount of XbaI PstI digested fragment (< 3 µl) · Add 1 µl T4 DNA ligase buffer. Note: Do not use quick ligase · Add 0.5 µl T4 DNA ligase · Add water to 10 µl · Ligate 16C/30 min, heat kill 80C/20 min · Transform with 1-2 µl of product Note: For linearized plasmid backbones provided by iGEM HQ, a plasmid backbone with an insert of BBa_J04450 was used as template. As a result any red colonies that appear during your ligation may be due to the template as a background. Digesting with Dpn1 before use should reduce this occurrence.
- Making Linearized Plasmid Backbones
Bulk Production The following is the protocol that we used to create the linearized plasmid backbones shipped with the Spring 2011 DNA Distribution. The protocol is in 96 well format, but may be scaled down to suit smaller batches.
PCR mix Primers
gccgctgcagtccggcaaaaaa,SB-prep-3P-1 atgaattccagaaatcatccttagcg,SB-prep-2Ea
Diluted to 30 pmol/µl These primers have been tested with pSB1C3, pSB1A3, pSB1K3, and pSB1T3.
