Week 1: 17^th June - 23^rd June

Tuesday, 19th June

As a start for the labwork, we first decided to make competent cells. We grew from glycerol samples three E. coli strains in 2 mL of LB medium.
The chemically competent strains chosen are as follows:

BL21
DH5α
TOP10

In a 15 mL tube, add 2 mL of LB medium and inoculate cells from glycerol

Thursday, 20th June

We started to make 200 mL of BL21 and DH5α E. coli strains and 400 mL of TOP10 to make competent cells.

First prepare the following solutions required to make competent cells:
Solution for 1M Cacl2:
Add 14,30g of CaCl2 into 100 ml desalted water

Solution for 0,1M Cacl2:
Add 50 mL of CaCl2 1M solution into 450 ml of desalted water

Solution for 0,1M Cacl2 + 15% glycerol:
Add 50 mL of CaCl2 1M solution and 75 mL of glycerol 100% into 450 ml of desalted water

For 200 ml LB medium, add 400 µL of strain sample.
Let the bacteria grow until it reaches an OD between 0,3 and 0,35.
Once it reached the right OD, put the medium on ice for 30 minutes to slow down growth.
Split the 200 mL into 4x50 mL tubes then centrifuge at 3000 rpm for 5 minutes at 4°C and suppress supernatant afterwards.
Resuspend the cells with 5 mL of Cacl2 at 0,1M for each 50 mL tube.
Again, put the medium on ice for 30 minutes.
Centrifuge at 3000 rpm for 5 minutes at 4°C then suppress supernatant.
Resuspend the cells with 1 mL of Cacl2 at 0,1M + 15% glycerol for each 50 mL tube.
Split the total 4 mL into 40 tubes containing each 100 µL of concentrated cell solution. This step should be executed fast enough and on ice.

Friday, 21st June

To check the quality of our work, each strain has been plated on LB medium with ampicillin, kanamycin or chloramphenicol in order to evaluate if it contaminated or not. Furthermore, to evaluate wether our strains are competent or not, we also transformed our bacteria with a pSB1A3 plasmid (red colonies) and plated them on LB medium with ampicillin only.

For 100 µL of chemical competent cells, add 1 µL of plasmidic DNA.
Let 30 minutes on ice.
Let the cells at 42°C for exactly 50 seconds.
Let 5 minutes on ice.
Resuspend the cells with 1 mL of LB spread on a petri dish then let it at 37°C.

Week 2: 24^th June - 30^th June

Monday, June 24th

Our competents cells made on friday the 21st were plated and incubated the whole week-end at 30°C. Today, we analyzed the plates and came to the conclusion that the medium was contaminated due to poor protocol execution. As a consequence, we decided to make new LB medium and recalculate the antibiotic concentrations.

Add 20 g of LB broth into 1000 mL of desalted water and autoclave.

Kanamycin is used as an effective concentration of 10-50 µg/ml and at a storage concentration of 10 mg/ml
Carbenicillin is used as an effective concentration of 20-60 µg/ml and at a storage concentration of 50 mg/ml
Chloramphenicol is used as an effective concentration of 25-170 µg/ml and at a storage concentration of 34 mg/ml (ethanol)
Tetracyclin is used as an effective concentration of 10-50 and at a storage concentration of 5 mg/ml (ethanol)

Tuesday, June 25th

New competent cells have been made with the same bacterial strains (BL21, DH5α and TOP10). We thought that the contamination of our cells was due to the CaCl2 solution that may not have been sterile and/or incorrect manipulated. As a consequence, we prepared new CaCl2 solutions made sure to autoclave them before usage. We ran the same tests as monday the 24th to evaluate the quality of our work and check for potential contamination.

Wednesday, June 26th

The results of the competent cells protocol is as follows:
DH5α strain was not contaminated but competent
TOP10 strain was contaminated only on the Kanamycin plate but competent
BL21 strain was completely contaminated and, thus, not usable.

Thurdsay, June 27th

We finished designing are first two plasmids and constructed the primers to extract the natural promoters from the genomic DNA from E. coli and the different parts for Golden Gate assembly.

Friday, June 28th

We want to obtain reasonnable competent cells for our oncoming transformation for newt week. Thus, we decided to plate the three strains on LB-Agar medium in order to isolate one and only one colony for monday when we'll start over the whole competent process.

Week 3: 1^st July - 7^th July

Tuesday, July 2nd

We prepared the BL21 and BG1655 strains to be competent.

Wednesday, July 3rd

The two strains have been contaminated and are not usable.

Thursday, July 4th

Genomic DNA extraction of the BL21 and BG1655 strains have been done using two different methods. We received the primers we have ordered. They have been prepared to do a PCR. In order to get our genes of interest we did a PCR using as the DNA template the genomic DNA extracted from BL21 and BG1655.

Friday, July 5th

To ensure the amplification of our genes by PCR, we did a agarose gel electrophoresis. To do so, we first prepared a TAE 50X stock solution. By diluting it, we use a 1X TAE solution to do a 1% agarose gel. We obtain the following gel. That showed that only two of our genes have been amplificated by PCR. A new PCR will be made.

Week 4: 8^th July - 14^th July

Monday, July 8th

We prepared the BL21 and BG1655 strains to be competent.

Tuesday, July 9th

Both strain are not contaminated.

BL21 are highly competent, BG1655 are little competent.

Wednesday, July 10th

PCR procedure optimization

Aim: Define the number of matrix of optimal DNA to amplify a gene by PCR.

Data:

• [primer] = --- ng/µl
  
• size(primer) = --- nt
  

For PCR we chose to use … ng of primer (V=…µL). As we know the size of our primers, we could define the number of primers that we have to use to begin the reaction. We define the number of recquired matrix DNA in terms of concentration of sample with the following formula:

AJOUTER LA FORMULE

Analysis of Agarose gel's results:

AJOUTER LA PHOTO LEGENDEE

Extraction of natural promoter sequence

Aim: We want to have sequences genes' promoters' sequences under the control of FUR (Ferric Uptake Regulation)transcription factor.

We remake PCR samples that failed the previous week.

• Fec A
• Ent C
• Fec C
• Ace B

PCR products are placed on gel and purificate. After, PCR products are tested with nanodrop.

Fec A (BG1655) [c] = 23.7 ng/µl 260/280 = 1.90

Fec A (BL21) [c] = 53.1 ng/µl 260/280 = 1.73

Ent C (BG1655) [c] = 52.4 ng/µl 260/280 = 1.71

Ent C (BL21) [c] = 50.0 ng/µl 260/280 = 1.94

Ace B (BG1655) [c] = 46.5 ng/µl 260/280 = 1.89

Fec C (BG1655) [c] = 34.2 ng/µl 260/280 = 1.91

Tris-HCl solution preparation(1M) : Stock solution 100X

Aim: Tris-HCl solution will be use in a final concentration of 10 mM to resuspend our primers.

Preparation of the stock solution (1 M, pH 7.5) for a volume of 50 mL:

1. Disolve 4,6g of Trisbase in 30 mL of distilled water.
2. Adjust pH with concentrated HCl(~4 mL) until pH=7,5.
3. Add distilled water until 50 mL then put in autoclave.

Note: If the solution has a yellow coloration, do the preparation again with better Trisbase.

Preparation of the solution (10mM, pH 7.5) for a volume of 50 mL.
Take 50µL of the stock solution at 1M and add 49.5 mL of water for the dilution.

Kanamycin preparation

Preparation of 3 tubes of 1.5 mL of Kanamycin.

Thursday, July 11

Preparation of primers solution:

1. Centrifugate tubes at 8000 rpm, begin 30 seconds.
2. Add 250 µL of Tris HCl (10 mM); [Primer] = 100µM

We prepare a diluted solution at 5 µM from to the stock solution, for PCR reactions.
Dilution at 1/20: We take 5 µL of the stock solution (100 µM) and we diluate in 95 µL of tris-HCl (10 mM).

Transformation of BL21:

Chemical transformation of BL21 with Cyrille's samples:

• Terminator (T)
• Promotor (P)
• Plasmid 1K3
• Plasmid 1C3
• sfGFP

These transformations allow us to do glycerols of these constrctions.

PCR on E.coli genom (BG1655 strain)

• Fep A (Primers P021 and P022)
• Fes (Primers P023 and P024)
• sdh C (Primers P025 and P026)
• ybi L (Primers P027 and P028)
• ync E (Primers P029 and P030)

Friday, July 12

Transformations test

• Terminator (T) = OK
• Promotor (P) = OK
• Plasmid 1K3 = OK
• Plasmid 1C3 = OK
• sfGFP = OK

Note : The negative control was suspect.

Petri dishes are le on the bench at room temperature during the week-end, colonies will be reisolate next week.

Migration of samples of PCR extraction.

The promoter sequence of genes Fep A, Fes, Sdh C, ybi L and ync E were extracted successfully.
Samples were purified and, after, tested with nanodrop.

Fep A (BG1655) [c] = 38.3 ng/µl 260/280 = 1.93

Fes (BG1655) [c] = 45.5 ng/µl 260/280 = 1.89

Sdh C (BG1655) [c] = 28.5 ng/µl 260/280 = 1.86

ybi L (BG1655) [c] = 31.0 ng/µl 260/280 = 2.09

ync E (BG1655) [c] = 25.1 ng/µl 260/280 = 1.93

Voir s'il ne faut pas faire le tableau recap des extractions

Week 5: 15^th July - 21^st July

Monday, July 15th

Tuesday, July 16th

Wednesday, July 17th

We prepared the TOP10 to be competent.

We launch our first Golden Gates.

Thursday, July 18th

Friday, July 19th

Week 6: 22^nd July - 28^th July

Monday, July 22nd

We did a PCR on the seven products of golden gate 1 using the VR and VF2 primers. We mixed :

• 10 uL of One Taq Buffer 10X
• 1 uL of 10 mM dNTPs
• 1 uL of each VF2 and VR primers
• 35,5 uL of H2O
• 1 uL of the One Taq enzyme
• 1 uL of the golden gate products

We used the following PCR program :

1. 95°C for 3 min
2. 95°C for 15 sec
3. 55°C for 30 sec
4. 68°C for 2 min
5. 68°C for 10 min

Note: We repeated step 2, 3 and 4 29 times.

The gel migration didn't reveal any band. We supposed that it hadn't worked due to the annealing temperature we used. Indeed, with the help of the New England BioLabs Tm Calculator website, we have found that the optimal annealing temperature for those primers was 53°C.

Tuesday, July 23rd

In order to test the best annealing temperature for our following PCRs, we did a PCR on our 5 first golden gate products with two different annealing temperature : 53 or 51°C. We also prepared two positiv controls for each conditions with either bacteria transformed by empty PSB1A3 plasmid or 1 uL of the miniprep plasmid. This was realised in order to verify if the problem of our first PCR was due to a bad lysis of our bacteria. What is more, we prepared one negativ control with an annealing temperature of 55°C.

(Mettre photo gel)

According to our results, we can assume that our first PCR was badly realised due to a handling error and not because of the annealing temperature we used.

In the meantime, we did the Golden Gate 1 again in order to obtain better ligation results. We transformed TOP 10 E. coli with the golden gate products and plated them on LB-Agar with carbenicillin antibiotic. The petri dishes have been let overnight at 37°C.

Wednesday, July 24th

We did a colony PCR from colony obtained on the petri dishes plated with golden gate 2 products transformed bacteria. We chose one white colony of each of the first ten different FUR BS constructions. The positiv control was prepared by using the PSB1A3 plasmid. The same PCR program was used but we were out of One Taq so we utilize Dream Taq.

We re isolate colony of bacteria transformed with our golden gate 1 products.

Thursday, July 25th

We did a 1% gel in order to migrate our PCR products. It revealed that our PCR hadn't work. We then realised that we hadn't changed the elongation temperature of our PCR program. Indeed, the dream taq functions at 72°C.

We did a PCR colony with the white colony obtained after we plated our golden gate 1 products transformed bacteria.

We used the following PCR program :

1. 95°C for 3 min
2. 95°C for 15 sec
3. 55°C for 30 sec
4. 72°C for 2 min
5. 72°C for 10 min

(mettre photo gel)

Considering our gel, we can reasonably think that our golden gate had worked properly. We then did miniprep.

Friday, July 26th

We used nanodrop to measure the concentration of plasmid of our minipreps. The concentrations obtained were extremely low. We decided to do it again, but we got the same low results.

Week 7: 29^th July - 4^th August

Construction of plasmid N°1

We make an electrophoresis with 5 µL of plamsid to check the plasmid purification made on the last friday.

Mettre l'image légendée ici

There is not the 3 bandes that we sould see, so to check another time, we make a digestion with Pst I and EcoR I:

• NEB Buffer 10X 5 µL
• BSA 10X 5 µL
• DNA 2 µg
• PstI 2 µL
• EcoRI 2 µL
• Water 50 µL

After another electrophoresis, we obtain no band.

Sequencing preparation

Name	Clone	Concentration	260/280	260/230	Sequencing
AceB Fur Binding Site (with sfGFP)	1	166.1 ng/µL	1.86	1.76	Good
	2	192.0 ng/µL	1.62	1.02	Good
	3	123.5 ng/µL	1.87	1.75	Good
	4	128.0 ng/µL	1.82	1.66	Good
FepA Fur Binding Site (with sfGFP)	1	21.1 ng/µL	2.06	-	Good
	2	22.4 ng/µL	1.96	-	Good
	3	55.4 ng/µL	1.87	1.58	Good
	4	68.5 ng/µL	1.89	1.67	Good
Fes Fur Binding Site (with sfGFP)	1	39.9 ng/µL	1.87	1.80	Good
	2	40.6 ng/µL	1.74	-	No sequencing
	3	68.4 ng/µL	1.87	1.63	Good
	4	20.8 ng/µL	2.05	-	No sequencing
ybiL Fur Binding Site (with sfGFP)	1	58.2 ng/µL	1.87	1.73	Good
	2	16.3 ng/µL	1.95	-	No sequencing
	3	18.8 ng/µL	1.95	-	No sequencing
	4	45.5 ng/µL	1.90	1.81	Good
FecA Fur Binding Site (with sfGFP)	1	20.0 ng/µL	1.96	-	Good
	2	27.5 ng/µL	1.77	-	No sequencing
	3	31.5 ng/µL	1.94	1.81	Good
	4	57.0 ng/µL	1.89	1.64	Good
yncE Fur Binding Site (with sfGFP)	1	92.4 ng/µL	1.90	1.75	Good
	2	64.7 ng/µL	1.89	1.66	Good
	3	38.6 ng/µL	1.91	1.80	Good

Construction of plasmid N°2

Our plasmid N°2 is building with a synthetic promote sequence which is composed of:

• Andersen's promotor
• Fur Binding Site (15 different)
• RBS
• sfGFP
• Terminator

Golden Gate

In order to associate these sequences we performed a golden gate, using for each sample :

• 80 ng of Andersen's promotor
• 80 ng of Fur Binding Site
• 80 ng of RBS
• 80 ng of sfGFP
• 80 ng of Terminator
• 1.5 µL of T4 buffer (10X)
• 15 Unit of T4 ligase
• 2.5 Unit of Bsa I

The Golden Gate products are chemically transformed into E. coli Top 10 strains. After the transformation process, bacteria are plated into LB medium with carbenicillin and icubated overnigth at 37°C.

Golden Gates plates are composed at 98% of red colonies. The problem was probably on the equimolarity ratio between our different part which were not totally respected. We isolated white colonies (4 maximum by each sample) on LB medium with carbenicillin and we incubated them overnight at 37°c.

We made pre culture (V = 10 mL), using bacterial colonies isolated from our plates of Golden Gate transformation. Then minipreps and glycerol conservation were made using these pre cultures.

Fur Binding Site	Sequence	Clone	Concentration
Fur BS 1	ATTATTGATAACTATTTG	Clone n°1	80.8 ng/µL
		Clone n°2	83.8 ng/µL
		Clone n°4	90.3 ng/µL
Fur BS 2	GATAACTATTTGCATTTGCA	Clone n°1	68.6 ng/µL
		Clone n°2	77.4 ng/µL
		Clone n°3	68.0 ng/µL
Fur BS 3	CAAATGCAAATAGTTATCCA	Clone n°1	79.4 ng/µL
		Clone n°2	110.5 ng/µL
		Clone n°3	457.4 ng/µL
Fur BS 4	CAAATAGTTATCAATAATCA	Clone n°1	73.2 ng/µL
		Clone n°2	66.2 ng/µL
Fur BS 5	GTAAATTAATATTATTTACA	Clone n°1	57.2 ng/µL
Fur BS 6	AATAATGCTTCTCATTTTCA	Clone n°1	63.8 ng/µL
Fur BS 7	ATAAATGATAATCATTATCA	Clone n°1	70.6 ng/µL
Fur BS 8	GAAAATAATTCTTATTTCCA	Clone n°1	75.6 ng/µL
		Clone n°2	87.2 ng/µL
		Clone n°3	48.8 ng/µL
		Clone n°4	57.8 ng/µL
Fur BS 9	AGCACTTATTATTATTTTCA	Clone n°1	58.6 ng/µL
Fur BS 10	GATAATTGTTATCGTTTGCA	No Clone	-
Fur BS 11	GATAATGCTTATCAAAATCA	Clone n°2	75.6 ng/µL
		Clone n°3	398.0 ng/µL
		Clone n°4	57.4 ng/µL
Fur BS 12	CAAAATTATTATCACTTTCA	Clone n°1	50.0 ng/µL
Fur BS 13	AATAATGATTACCATTCCCA	Clone n°2	70.7 ng/µL
Fur BS 14	GAAATTGTTTTTGATTTTCA	Clone n°1	42.7 ng/µL
		Clone n°2	32.8 ng/µL
		Clone n°3	37.8 ng/µL
		Clone n°4	45.7 ng/µL
Fur BS 15	GTTAATTGTAATGATTTTCA	Clone n°1	37.0 ng/µL
		Clone n°2	53.2 ng/µL
		Clone n°3	196.0 ng/µL

Construction of plasmid N°3

29/07/13

We received the primers ordered on friday the 26th of July and started to dilute them into TrisCL at 10 mM. Secondly, we diluted the previous stock solution at a rate of 1/20th to obtain a final concentration of 5 µM for our intermediate solution.

Then, for our plasmid three construction, we need to first extract the 6 enterobactin gene (EntA, EntB, EntC, EntD, EntE and EntF). The ordered primers from friday will theoretically extract them in the appropriate Golden Gate format with their own RBS upstream (designed from Salis RBS). This will allow us to construct our two N°3 plasmids, one containing EntA, EntD and EntF, and the other one EntB, EntC and EntE. The genes are spread like this to obtain two equivalent plasmids xxx

We proceeded to a genomic extraction of the 6 genes of interest and migrated to PCR products on a 1% gel. We successfully extracted 5 out of the 6.

30/07/13

We annealled the oligonucleotides of the PL-LacO part in the golden gate format. Also, we extracted the sfGFP with the RBS upstream which will allow us to construct the control positive plasmid 3 for future TECAN experiments.

31/07/13

We started by purifying our 6 succesful PCR extraction from the 29/07 and 30/07. So we managed to extract EntA, EntB, EntC, EntD and EntF from E. coli's genomic DNA and sfGFP in the golden gate format with a RBS (plasmid 3 construction) from plasmidic DNA.

Additionnaly, we optimized our PCR to extract our missing gene, EntE. We obtained a smear +/- a double band. As a consequence, we adjusted the annealing temperature with a range from 54°C to 66°C. This will allow us to try extracting the missing gene (EntE) in the appropriate conditions.

01/08/13

We made a PCR for the EntE gene with a gradient of temperature to know at which temperature the PCR result were the best.
We made 8 (ou mettre 6 ?) tubes with the same composition:

• Water
• Taq Buffer 5
• dNTPs
• Rev EntE 2,5
• For EntE 2,5
• DNA 0,5
• Taq polymerase 0,5

We also made positive and negative controles (with Rev EntC and For EntC instead of EntE).
After electrophoresis, we obtain the best band at .. °C.
However our experiment have been made with Taq polymerase (and Taq Buffer) instead of Q5 (and Q5 buffer) that we use usually. Then, we have to repeat this experiment with Q5 and Q5 buffer.
The did a gradient PCR and migrated on a gel our samples. On the gel, we notice that both the smear and the double band disappear when the annealing temperature increases. So to conclude, we run tonight a PCR with Q5 polymerase with increasing temperature starting from 56 degrees. The absolute annealing temperature will be determined for the Q5 (not extrapolable from a OneTaq PCR).

Also, we made a golden gate for the construction of plasmid 3. For analysis purposes, only a GFP was added downstream of the PL LacO promoter. Also, the EntE gene is still to be extracted from the genome. Also, we runned 3 extras golden gate for the construction of plasmid 2. In fact, we corrected our calculations because we initially we used mass concentrations instead of molar concentrations.

02/08/13

The transformations of the golden gate 2 and 3 are successful and we managed to invert the rate of red colonies versus white colonies (red = false positive with mRFP, white = positive), thus meaning we have a lot of white ones! We conserved the plates for future isolation on coming monday.

Additionnaly, we migrated the PCR products of 01/08. The gel is empty, but the positive controls are there, meaning we made a mistake in the primers (the master mix is the one used for the positive control).

Week 8: 5^th August - 11^th August

Week 9: 12^th August - 18^th August

Week 10: 19^th August - 25^th August

Week 11: 26^th August - 1^st September

Week 12: 2^nd September - 8^th September

Week 13: 9^th September - 15^th September

Week 14: 16^th September - 22^nd September

Week 15: 23^rd September - 29^th September

Week 16: 30^th September - 6^th October

Week 17: 7^th October - 13^th October

Week 18: 14^th October - 20^th October

Week 19: 21^st October - 27^th October

Week 20: 28^th October - 3^rd November

Site developped by Gabriel Guillocheau