From 2013.igem.org

(Difference between revisions)

Revision as of 14:31, 27 September 2013

The Problem

CardBio: The Project

Figure 1 - Comparison of leading causes of death over the past decade, 2000 and 2011 (modified

Acute coronary syndrome (ACS) refers to any group of clinical symptoms compatible with acute myocardial ischemia and includes unstable angina, non—ST-segment elevation myocardial infarction, and ST-segment elevation myocardial infarction (Kumar and Cannon, 2009). These high-risk manifestations of coronary atherosclerosis are important causes of the use of emergency medical care and hospitalization in the United States, where in 2004, approximately 200.000 people died by heart attack, and in 2009, about 1.190.000 patients were diagnosed with ACS (Acute Coronary Syndrome) (Heart Disease and Stroke Statistics--2012 Update : A Report From the American Heart Association).

Figure 2. The 10 leading causes of death in the world at 2011 (modified)

It is observed in ACS that plaque formation and its development release several substances in the patient blood that have a big potential to be explored as possible biomarkers for diagnosis of ACS even if it remains a challenge in contemporary emergency medicine. A blood-borne biomarker is an attractive alternative to cardiac imaging or stress testing as it would be cheaper and logistically faster to obtain. Several biomarkers can be associated to assess Acute Myocardial Infarction as shown in the Figure 2

Figure 3 - Biomarkers associated with various pathophysiological processes associated with acute myocardial infarction[5]

Figure 2 - Biomarkers associated with various pathophysiological processes associated with acute myocardial infarction Given these information, Brazil_UFMG team chose to develop a Genetically Modified Organism (GMO) able to measure blood serum concentrations of specific molecules with potential to be ACS biomarkers, to be used as an efficient method of prognostic test. References: [1]. Kumar A., Cannon, C. P.,(2009) ”Acute Coronary Syndromes: Diagnosis and Management, Part I” Mayo Clinic Proceedings, vol 84, Issue 10, pages 917–938 Symposium on Cardiovascular Diseases. [2] Danne, O. and M. Mockel (2010). "Choline in acute coronary syndrome: an emerging biomarker with implications for the integrated assessment of plaque vulnerability." Expert Rev Mol Diagn 10(2): pages 159-171. [3] Heart Disease and Stroke Statistics - 2012 Update : A Report From the American Heart Association. [4] SeC. Muller and M. Mockel (2010). "Biomarkers in acute coronary syndrome and petaneous coronary intervention." Minerva Cardioangiol. [5] Daniel Chan and Leong L. Ng., “Biomarkers in acute myocardial infarction”, BMC Med. 2010; 8: 34. Published online 2010 June 7, doi:10.1186/1741-7015-8-34 [6] World Health Organization

Our Design

After an extensive research on the biomarkers used for prognosis of Acute Coronary Syndrome (ACS), we elected three that we could work on to somehow make our bacteria detect: IMA TMAO and BNP.

IMA, which means Ischemia Modified Albumin, was a tricky one. Our studies indicated that, although a good marker for ischemia, IMA could be better used for ACS prognostic as a negative predictor than a positive one. Because of that, we assigned YFP to its detection: its presence doesn’t really say much, it’s a “warning”. We found out that a clinical test for IMA was available, based on the detection of cobalt added to a patient’s blood serum (the reason being that IMA binds less cobalt than normal human serum albumin); so, we decided to incorporate this method by using a cobalt-inducible promoter, Rcna (BBa_K540001) associated with the YFP translational unit (BBa_E0430). With this construction, if cobalt is added to a medium containing our chassis and a patient’s blood, and it remains unbinded due to the presence of IMA, it will activate the promoter, which will lead to the production of YFP. TMAO is a biomarker that was recently linked to heart diseases, and one that our literature research showed that could activate an inducible bacterial promoter, part of the TorCAD operon. Since this promoter was not deposited in the Parts Registry, we ordered it to be synthesized, with modifications to its structure to enhance its activity [1]. The sequence of the promoter we ordered was:

5’ – CGAACGAATTCGCGGCCGCTTCTAGAGATTCTGTTCATATCTGTTCATATTCCGTTCATCCT

GACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCATACTAGTAGCGGCCGCTGCAG – 3’

We decided to assign RFP to this biomarker, and thus our construction for this became the TorCAD promoter we had synthesized followed by the RFP translational unit (BBa_J06702).

Our last target is BNP (Brain Natriuretic Peptide), a major prognostic biomarker for ACS. To detect it, we tried to synthesize a biobrick containing the coding region of NPRA, a receptor capable of detecting BNP and respond unleashing an intracellular cGMP cascade. And to detect the cGMP produced by the receptor, we also ordered the synthesis of another promoter, belonging to PDE5 (phosphodiesterase 5), which is positively regulated by this molecule. Putting it all together, the plan was to create a plasmid containing two constructions: 1) a constitutive promoter associated with the translation unit of NPRA, to make our bacteria detect BNP and respond producing cGMP, and 2) PDE5 promoter associated with the translational unit of another fluorescent protein, like CFP, to make our bacteria produce a signal when the biomarker was detected. However, we were unable to proceed with the detection of BNP, due to the high content of CG pairs on both the NPRA receptor and PDE5 promoter, which rendered their synthesis impossible.

Thus, by inserting all of these inside our Escherichia coli, we’d have in our hands our heart vigilant bacteria, ready to save some lives!

References 1 - Ansaldi M, Simon G, Lepelletier M, Mejean V (2000). "The TorR high-affinity binding site plays a key role in both torR autoregulation and torCAD operon expression in Escherichia coli." J Bacteriol 2000;182(4);961-6. PMID: 10648521

Biomarkers

TMAO

IMA

BNP

BNP (Brain Natriuretic Peptide) is synthesized mainly by the ventricles, and their circulatory concentrations are significantly elevated in congestive heart failure (CHF).

The plasma concentration of BNP has been used to assist in the accurate diagnosis of heart failure in patients admitted with symptoms of decompensated heart failure (Abassi et al., 2004).

In humans, BNP is produced from proBNP , which contains 108 amino acids and, after proteolytic processing, releases a mature molecule and a 32 aminoacid N-terminal fragment in the circulation. BNP was originally cloned from brain but is now considered a blood hormone produced mainly in the heart ventricles (Ogawa et al. 1991). It is now known that these peptides have effects such as diuresis, natriuresis, vasodilation, and act as a circulating hormone in the inhibition of aldosterone synthesis and renin secretion. Thus, BNPs seems to play an important role in the regulation of blood pressure and blood volume (Nishikimi et al., 2006).

BNP is released by injured heart in very expressive proportions. Therefore, physicians have become very interested in measuring the plasma levels of BNP as a diagnostic tool in cardiology. In fact, several studies have shown that the measurement of circulating BNP can discriminate between patients with decompensated congestive heart failure and patients with dyspnea due to noncardiac etiology (Lemos et al., 2001). However, evaluation of BNP levels should not be used as an independent test but its high sensitivity and negative predictive value may be useful to add other information to the physician in making a diagnosis of heart failure. The main strength of BNP is the excellent negative predictive value with regard to left ventricular dysfunction and heart failure, but other specific diagnostic tools are required to define the actual abnormality (Vuolteenaho et al., 2005).

The Cardbio project chose to use BNP in its construction because it is a biomarker already used with diagnostic purposes, with several commercial assays already developed for its quantitative immunodetection. These assays could be used as controls, to validate our construction. In addition to this, since BNP is a small, unstable molecule that can be underestimated by immunoassays relying on antibody recognition (Tamm et al., 2008), a synthetic biology approach could improve the heart failure diagnosis based on this biomarker.

References

Vuolteenaho O, Ala-Kopsala M, Ruskoaho H. BNP as a biomarker in heart disease. Adv Clin Chem. 2005;40:1-36.
Lemos, J. A., Morrow, D. A., Bentley, J. H., Omland, T., Sabatine, M. S., McCabe, C. H., Hall, C., Cannon, C. P., & Braunwald, E. (2001). “The prognosis value of B-type natriuretic peptide in patients with acute coronary syndromes.” N Engl J Med 345, 1014–1021.
Toshio Nishikimi, Nobuyo Maeda, Hiroaki Matsuoka (2006). “The role of natriuretic peptides in cardioprotection.” Elsevier Cardiovascular Research 69 (2006) 318 – 328
Zaid Abassi, Tony Karram, Samer Ellaham, Joseph Winaver, Aaron Hoffman (2004).”Implications of the natriuretic peptide system in the pathogenesis of heart failure: diagnostic and therapeutic importance.” Elsevier Pharmacology & Therapeutics 102 (2004) 223– 241
Natalia N. Tamm, Karina R. Seferian, Alexander G. Semenov, Kadriya S. Mukharyamova, Ekaterina V. Koshkina, Mihail I. Krasnoselsky, Alexander B. Postnikov, Daria V. Serebryanaya, Fred S. Apple, MaryAnn M. Murakami, and Alexey G. Katrukha. Novel Immunoassay for Quantification of Brain Natriuretic Peptide and Its Precursor in Human Blood. Clinical Chemistry 54:9 1511–1518 (2008)

Our Sponsors

@@ Line 66: / Line 66: @@
 *Zaid Abassi, Tony Karram, Samer Ellaham, Joseph Winaver, Aaron Hoffman (2004).”Implications of the natriuretic peptide system in the pathogenesis of heart failure: diagnostic and therapeutic importance.” Elsevier Pharmacology & Therapeutics 102 (2004) 223– 241
 *Natalia N. Tamm, Karina R. Seferian, Alexander G. Semenov, Kadriya S. Mukharyamova, Ekaterina V. Koshkina, Mihail I. Krasnoselsky,  Alexander B. Postnikov, Daria V. Serebryanaya, Fred S. Apple,  MaryAnn M. Murakami, and Alexey G. Katrukha. Novel Immunoassay for Quantification of Brain Natriuretic Peptide and Its Precursor in Human Blood. Clinical Chemistry 54:9 1511–1518 (2008)
 {{Team:UFMG Brazil/sponsor}}

Team:UFMG Brazil/Cardbio