|
|
| Line 429: |
Line 429: |
| | <div class="row"> | | <div class="row"> |
| | <div class="nine columns"><p id="3"></p> | | <div class="nine columns"><p id="3"></p> |
| - | <h3>Submission of BioBricks</h3> | + | <h3>Linkage to project</h3> |
| - | The MLS was cloned from a commercial plasmid, pCMV/myc/mito (Invitrogen) by PCR. For the MLS BioBrick, we have submitted the MLS BioBrick in RFC 10 and RFC 25, the Freiburg format which allows protein fusion, to facilitate other team to fuse the MLS with other protein for purpose of introducing other protein into mitochondria.
| + | In our project, we introduced bacterial enzymes to mammalian cell to modify metabolic pathway. However, unlike bacteria, citric acid cycle in mammalian cells is compartmentalized in mitochondria. The ACE proteins should be targeted to mitochondria for their functionality. To do so, we fused ACE enzymes with Mitochondrial Leader Sequence (MLS). |
| | <br><br> | | <br><br> |
| - | For characterization, MLS and green fluorescence protein was fused with constitutive mammalian CMV promoter. The promoter was cloned from pEGFP-N1 (Clonetech) in RFC10 format, since such part could not be found in partsregistry. The CMV cloned for our characterization construct was also submitted. The two construct for characterization, the CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 and CMV promoter – mitochondria leader sequence – green fluorescence protein – polyadenylation sequence – pSB1C3 composite parts are also submitted. <a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Parts">Click here to see our submitted parts.</a>
| |
| - | </div>
| |
| - | </div>
| |
| - | <div class="row">
| |
| - | <div class="nine columns"><p id="4"></p>
| |
| - | <h3>Characterization</h3>
| |
| - | In order to characterize mitochondria that it can translocate protein into mitochondria in standard BioBrick, we constructed CMV promoter – mitochondria leader sequence – green fluorescent protein – polyadenylation sequence – pSB1C3. We use pCMV/myc/mito.GFP (Invitrogen) as positive control, which include MLS with GFP reporter, and we built negative control, CMV promoter – green fluorescent protein – polyadenylation sequence – pSB1C3 for response without MLS. Characterization was conducted on HEK 293FT cell. If the result shows that GFP is localized in mitochondria while the negative control is scatter all around cell, we can conclude that MLS is targeting GFP into mitochondria in HEK 293FT Cell.
| |
| - | <br><br>
| |
| - | Since we could not find a constitutive promoter BioBrick allow expression in mammalian cell, we amplified pCMV from pEGFP-N1 (Clonetech). To characterize this CMV promoter, we used CMV promoter – green fluorescent protein – polyadenylation sequence construct with pEGFP-N1 as positive control and GFP-PolyA in pSB1C3 as negative control. If the result shows that GFP is expressed and scatter around in cell, while negative control shows no GFP signal in cell, we can conclude that CMV is functioning.
| |
| - | <br>
| |
| - | <h5><b>Characterization for MLS</b></h5>
| |
| - | There are three constructs made:<br><br>
| |
| - | <p style="font-size:13px;"><b>1. CMV-MLS-GFP-PolyA in pSB1C3</b></p>
| |
| - | <p id="construct"><b>Promoter</b> CMV mammalian promoter to allow expressing the construct in mammalian cell.<br>Forward primer:<br><center>
| |
| - | [TTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGCTGTGGATAACCGTATTACCGCCATGC]</center><br>
| |
| - | <p id="construct">Reverse primer:<br><center>[CCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAACCAGCTCTGC]</center><br><p id="construct">These primers were used to amplify CMV from pEGFP-N1 (Clonetech) in RFC 10 format. Since not enough length is kept after the transcription start site, future user may need to put spacer between the CMV promoter and the part need to be transcribed.
| |
| - | <br><br>
| |
| - | <b>Mitochondria Leader Sequence</b> MLS was cloned from pCMV/myc/mito (Invitrogen) using forward primer: <br><center>[GATCATGAATTCGCGGCCGCTTCTAGATGGCCGGCATGTCCGTCCTGACGCCGC]</center><br> <p id="construct">and reverse primer:<br> <center>GATCATCTGCAGCGGCCGCTACTAGTATTAACCGGTCAACGAATGGATCTTGGCGCG]</center><br> <p id="construct">The MLS was cloned with RFC 25 Freiburg standard prefix and suffix to allow doing fusion protein with MLS, to allow trafficking of reporter into mitochondria.<br><br>
| |
| - | <b>Reporter</b> We use <a href="http://parts.igem.org/Part:BBa_K648013">BBa_K648013</a>, the GFP in Freiburg standard as a reporter for MLS, since it allow doing fusion protein by using RFC 25 assembly.
| |
| - | <br>
| |
| - | <b>Terminator</b> We use hGH polyadenylation sequence, <a href="http://parts.igem.org/Part:BBa_K404108">BBa_K404108</a>, as the terminator.</p><br>
| |
| - |
| |
| - | <p style="font-size:13px;"><b>2. CMV-GFP-PolyA in pSB1C3</b></p><p id="construct">Construct without MLS for comparing response brought by MLS.</p>
| |
| - |
| |
| - | <p style="font-size:13px;"><b>3. pCMV/myc/mito.GFP</b></p><p id="construct">Construct of MLS fused with GFP, provided by manufacturer to serve as positive control for MLS.</p>
| |
| - |
| |
| - | <h5><b>Characterization for CMV</b></h5>
| |
| - | There are three consructs made:
| |
| - | <br><br>
| |
| - | <p style="font-size:13px;"><b>1. CMV-GFP-PolyA in pSB1C3</b></p><p id="construct">This construct is for testing CMV functionality by expressing GFP</p>
| |
| - | <p style="font-size:13px;"><b>2. pEGFP-N1</b></p><p id="construct">Construct for expressing GFP in cell, serve as positive control for GFP expression.</p>
| |
| - | <p style="font-size:13px;"><b>3. GFP-Poly in pSB1C3</b></p><p id="construct">Construct without CMV for comparing response brought by CMV.</p>
| |
| - | <br>
| |
| - |
| |
| - | </div>
| |
| - | </div>
| |
| | <div class="row"> | | <div class="row"> |
| | <div class="nine columns"><p id="5"></p> | | <div class="nine columns"><p id="5"></p> |
| - | <h3>Staining</h3> | + | <h3>Reference</h3> |
| - | All of the constructs were transfected into HEK 293FT cell. We stained mitochondria with Mitotracking dye and fixed the cell. Under fluorescence microscope, we could see the position of the mitochondria and the GFP. By merging the image together, we could determine whether MLS is targeting GFP into mitochondria.<br><br>
| + | Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (2010). Essential cell biology. (3rd ed., p. 505). UK: Garland Science.<br><br> |
| - | | + | |
| - | Transfected cell was stained with MitoTracker® Red CMXRos (Invitrogen), a rosamine-based stain, to stain the mitochondria. When they entered live mitochondria, they would be oxidized and bind with peptide to give a fixable fluorescent complex, which can be observed under fluorescence microscope and be retained after fixation.<br><br>
| + | |
| - | | + | |
| - | The manufacturer’s standard protocol was used with staining solution of final working concentration 200nM, and was incubated for 20 minutes under a humidified atmosphere, containing 5% CO2 at 37 °C during staining.<br>
| + | |
| | | | |
| | </div> | | </div> |
| | </div> | | </div> |
| | </div> | | </div> |
| - | </div>
| + | |
| | </body> | | </body> |
| | </html> | | </html> |
"
