"

From 2013.igem.org

iGEM Home

Contents 1 Combinatorial Assembly of CRISPR Repeat-Spacer-Repeat arrays from oligonucleotides 1.1 Oligonucleotide design 1.1.1 Common sequences 1.1.2 Spacer-specific sequences 1.2 Anneal and ligate Oligonucleotides 1.3 Select and amplify assembled sequences 1.4 Gel purify amplified sequences

Combinatorial Assembly of CRISPR Repeat-Spacer-Repeat arrays from oligonucleotides

Oligonucleotide design

Common sequences

The following common sequences are required (all sequences are 5’ – 3’):
BB Prefix-Repeat: GTTTCTTCGAATTCGCGGCCGCTTCTAGAG GTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC
Repeat-BB Suffix: /5Phos/TTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC TACTAGTAGCGGCCGCTGCAGGAAGAAAC
Repeat: /5Phos/GTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC
PCR Assembly F: GTTTCTTCGAATTCGCGGCCGCTTCTAGAG
PCR Assembly R: GTTTCTTCCTGCAGCGGCCGCTACTAGTA

Spacer-specific sequences

Each spacer requires 3 oligonucleotides:
Spacer sequence: The 30 base sequence upstream of the PAM recognition site. e.g. /5Phos/ctcgtcacatggaagtatttgcaactctta
Front splint: 10 bases complementary to the 5’ end of the spacer with 11 bases complementary to the 3’ end of the repeat. E.g. atgtgacgagGTTTTGGAACC
Back splint: 12 bases complementary to the 3’ end of the repeat with 10 bases complementary to the 3’ end of the spacer. E.g. CAGCTCTAAAACtaagagttgcaa

Note if the Repeat-BB Suffix, Repeat and Spacer sequences were not chemically phosphorylated during synthesis, enzymatically phosphorylate them before annealing and ligation.

Anneal and ligate Oligonucleotides

Assemble the annealing/ligation buffer: 1× T4 Ligation Buffer, 50 % PEG-8000, 0.1 % Tween-20, and add each oligonucleotide to a final concentration of 10 nM. Heat to 95 °C for 3 minutes and slowly cool to 25 °C at 2 °C per minute. Note that several spacer/split combinations can be mixed into the same reaction to assemble larger, diverse arrays. Add T4 DNA ligase (to 8 U/µL final concentration), and incubate at 25 °C for 2 hours. Heat inactivate at 65 °C for 10 minutes.

Select and amplify assembled sequences

Assemble a PCR reaction to select and amplify correctly assembled sequences: 1× Phusion HF Buffer, 0.1 % Tween-20, 0.25 mM each dNTP, 3 % DMSO, 500 nM each forward and reverse primer, 0.05 U/µL Phusion Polymerase and ligation product at a final concentration of 1/100 ×. Cycle the reaction at 98 °C for 30s, then 25 cycles of 98 °C for 15s, 72 °C for 60 s, then hold at 72 °C for 5 minutes.

Gel purify amplified sequences

As it is possible to assemble several different sequences (one spacer, two spacers, etc.) it is necessary to gel purify species before cutting and transformation. Run samples on a mini 10 % TBE-PAGE gel at 100 V for 1.5 hours (until bromophenol blue marker runs off of the gel). Stain the gel in 1 × SYBR-SAFE in running buffer for 10 minutes. Excise and purify the desired spacer-repeat lengths.