BBa_J176171

BBa_J176171 was planned to be used as a mammalian vector backbone for the promoters. After running PCR (Polymerase Chain Reaction) to amplify the FABP1 promoter and ligated it with GFP and the backbone, we did mutagenesis for the vector. Based on the gel photo, we concluded that the vector was easy to get degraded. Finally we figured out that BBa_J176171 was heat unstable and changed our plan.

Liver Fatty Acid Binding Protein 1 (FABP1) Promoter

This promoter was cloned from human genomic DNA (gDNA) (see gDNA extraction and PCR protocols) with engineered RFC10 prefix and suffix for BioBrick submission. The promoter was then ligated with enhanced green fluorescence protein (EGFP) from pEGFP-N1 (Addgene), and cloned into BBa_J176171 mammalian backbone. The promoter and EGFP were successfully cloned into BBa_J176171 by digestion and ligation.

The confirmed construct was transfected into two mammalian cells, HEK293FT and HepG2 cell lines. GFP signal of the construct was compared with pEGF-N1 plasmid that contains constitutive CMV promoter. However, no GFP signal could be detected.

Since FABP1 promoter contained illegal restriction sites for BioBrick submission, we conducted multi site-directed mutagenesis to elimitate EcoRI and PstI from the coding sequence. (see Mutagenesis protocol 1,2 and 3).

The FABP1 promoter was to be characterized by over-expression of EGFP reporter in the presence of high fatty acid concentration in the medium1. However, no EGFP signal could be detected.

After several attempts of site-mutagenesis of promoter in FABP1 – EGFP – BBa_J176171 construct, we found that the plasmid degrades at a high temperature. We tested heat sensitivity of the plasmid BBa_J176171 and found that the plasmid degrades at denaturation step (95 °C) of polymerase chain reaction. Then, we took an alternative experiment by cloning FABP1 promoter into pBlueScript KS(+). Due to time constrain, two mutagenesis attempts were taken but both of them were not successful.

Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter

We planned to clone PPAR-alpha promoter from human genomic DNA using polymerase chain reaction. We designed three sets of primers in upstream and downstream of promoter sequence, for different polymerases and referencing on Pineda Torra team’s experiment2. In addition, polymerase chain reaction was conducted at different temperatures, primer concentrations and buffers. However, none of the primers could successfully clone the PPAR-alpha promoter.

Primers used to extract PPAR-alpha promoter from gDNA:

Forward GATCATATTAATGAATTCGCGGCCGCTTCTAGAGTTCCCTCACCAAACACAACAGGATGA

Reverse GATCATGGATCCTACTAGTAGCGGCCGCTGCAGCGCAAGAGTCCTCGGTGT

Forward GATCAT ATTAATGAATTCGCGGCCGCTTCTAGAGGGTATGCCAGGTAATGTCTT

Reverse GATCATGGATCCCTGCAGCGGCCGCTACTAGTACAAGAGTCCTCGGTGTGT

Forward from reference paper +RFC10 and prefix GATCAT ATTAAT GAATTCGCGGCCGCTTCTAGAGGAGCGTCACGGCCCGAACAAAGC

Reverse from reference papers +RFC10 and suffix GATCATGGATCCCTGCAGCGGCCGCTACTAGTAAGTCCTCGGTGTGTGTCCTCGCTCCTC

Since the PPAR-alpha promoter coding sequence could not be obtained from human genomic DNA, further experiment could not be preceded.

Glucose Regulated Protein (GRP78) Promoter

The commercial plasmid pDRIVE_hGRP78 (InvivoGen) was treated following manufacturer instructions (see manufacturer protocol). GRP78 promoter was extracted out by polymerase chain reaction with engineered RFC10 prefix, suffix, AseI upstream of prefix and XhoI in downstream of suffix to facilitate cloning into pEGFP-N1 backbone (Addgene). pEGFP-N1 is a mammalian vector that contains constitutive CMV promoter and enhanced green fluorescence protein (EGFP) as a reporter. We replaced CMV promoter with inducible GFP78 promoter by digestion and ligation. Since GRP78 promoter contained illegal restriction sites, two kinds of mutagenesis were conducted (see Mutagenesis protocol 2 and 3) for the elimination of XbaI. Due to time constrain, promoter activity in mammalian cell could not be characterized.

Fatty Acid Metabolism Regulator Protein (FadR) and pFadBA Promoter

The FadR (BBa_K817001) and pFadBA (BBa_K817002) DNA were obtained from 2013 distribution kit, submitted by NTU-Taida 2012 team. For expression in mammalian cells, pFadBA was cloned into mammalian vector (BBa_J176171) with an enhanced green fluorescence protein (EGFP) as reporter. After successful construct of pFadBA – EGFP – BBa_J176171, the plasmid was transfected into HEK293FT cell.

For the promoter regulation, we cloned FadR into BBa_J176171 backbone, with Kozak sequence and Nuclear Leading Sequence (NLS) for transcription and translation efficiency in mammalian cell.

After confirmation of the construct, Kozak Sequence – FadR coding sequence – NLS was cloned into pEGFP-N1 that contains mammalian constitutive CMV promoter. The pFadBA promoter and FadR protein constructs were to be co-transfected in HEK293FT cell and selected using different drug selection markers – Puromycin for BBa_J176171 and Neomycin for pEGFP-N1.

After co-transfection of two constructs to HEK cell, no EGFP signal could be detected from fadBA promoter construct. We believed that even though we have introduced Kozak and nuclear leader sequences to protein coding sequence, difference in prokaryotic and eukaryotic transcription mechanism gives fadR protein low possibility to be expressed in mammalian cell.

After transfecting to mammalian cells, these promoters will be induced by Fatty Acids or its oxidation products, leading to expression of EGFP. By comparing the image of the intensity of EGFP using Fluorescent microscopy, we will be able to quantify their expression and determine the desired sensing mechanism which is most efficient for Glyoxylate genes expression.