Team:Paris Bettencourt/Notebook

Team:Paris Bettencourt/Notebook

Week 01: 3^th - 9^th June

Week 02: 10^th - 16^th June

Week 03: 17^th - 23^th June

Week 04: 24^th - 30^th June

Week 05: 1^st - 7^th July

Week 06: 8^th - 14^th July

Week 07: 15^th - 21^th July

Week 08: 22^th - 28^th July

Week 09: 29^th July - 4^th August

Week 10: 5^th - 11^th August

Week 11: 12^th - 18^th August

Week 12: 19^th - 25^th August

Week 13: 26^th August - 1^st September

Week 14: 2^nd - 8^th September

Week 15: 9^th - 15^th September

Week 16: 16^th - 22^th September

Week 17: 23^th - 29^th September

Week 18: 30^th September - 6^th October

Week 19: 7^th - 13^th October

Week 20: 14^th - 20^th October

Week 21: 21^th - 27^th October

Week 22: 28^th October - 3^th November

Contents

Week 01: 3th - 9th June

Week 02: 10th - 16th June

Week 03: 17th - 23th June

Week 04: 24th - 30th June

Week 05: 1st - 7th July

Week 06: 8th - 14th July

Week 01: 3^th - 9^th June

Week 02: 10^th - 16^th June

Week 03: 17^th - 23^th June

Week 04: 24^th - 30^th June

Week 05: 1^st - 7^th July

Week 06: 8^th - 14^th July

Week 07: 15^th - 21^th July

From 2013.igem.org

Monday 3^th June

Tuesday 4^th June

Wednesday 5^th June

Thursday 6^th June

Friday 7^th June

Monday 10^th June

Tuesday 11^th June

Wednesday 12^th June

Thursday 13^th June

Friday 14^th June

Monday 17^th June

Tuesday 18^th June

Wednesday 19^th June

Thursday 20^th June

Friday 21^th June

Monday 24^th June

Tuesday 25^th June

Wednesday 26^th June

Thursday 27^th June

Friday 28^th June

Monday 01^st July

Tuesday 02^st July

Wednesday 03^st July

Thursday 04^st July

Friday 04^st July

Monday 8^th July

Tuesday 9^th July

Wednesday 10^th July

Thursday 11^th July

Friday 12^th July

Monday 15^th July

Tuesday 16^th July

Wednesday 17^th July

Thursday 18^th July

Friday 19^th July

Monday 22^th July

Tuesday 23^th July

Wednesday 24^th July

Thursday 25^th July

Friday 26^th July

From 2013.igem.org

Monday 3th June

Tuesday 4th June

Wednesday 5th June

Thursday 6th June

Friday 7th June

Monday 10th June

Tuesday 11th June

Wednesday 12th June

Thursday 13th June

Friday 14th June

Monday 17th June

Tuesday 18th June

Wednesday 19th June

Thursday 20th June

Friday 21th June

Monday 24th June

Tuesday 25th June

Wednesday 26th June

Thursday 27th June

Friday 28th June

Monday 01st July

Tuesday 02st July

Wednesday 03st July

Thursday 04st July

Friday 04st July

Monday 8th July

Monday 3^th June

Tuesday 4^th June

Wednesday 5^th June

Thursday 6^th June

Friday 7^th June

Monday 10^th June

Tuesday 11^th June

Wednesday 12^th June

Thursday 13^th June

Friday 14^th June

Monday 17^th June

Tuesday 18^th June

Wednesday 19^th June

Thursday 20^th June

Friday 21^th June

Monday 24^th June

Tuesday 25^th June

Wednesday 26^th June

Thursday 27^th June

Friday 28^th June

Monday 01^st July

Tuesday 02^st July

Wednesday 03^st July

Thursday 04^st July

Friday 04^st July

Monday 8^th July

Tuesday 9^th July

Wednesday 10^th July

Thursday 11^th July

Friday 12^th July

Monday 15^th July

Tuesday 16^th July

Wednesday 17^th July

Thursday 18^th July

Friday 19^th July

Trojan Horse

Trojan Horse

Trojan Horse

Trojan Horse

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Trojan Horse

Trojan Horse

Trojan Horse

Trojan Horse

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Human Practices

Modeling

Drug Screening

Phage Sensor

Trojan Horse

TB-ception

Attempting to the SB6.

Attempting to the SB6.

Attempting to the SB6.

Attempting to NightScience.

Primer Design

Attempting to the SB6.

Media Preparation

Glycerol Stocks

Plasmid Extraction

Glycerol stock

Electroporation

Transformation results

Media Preparation

Glycerol Stocks

Plasmid Extraction

Glycerol stock

Electroporation

Transformation results

Revision as of 16:12, 23 July 2013 by ClovisB (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

PROJECT
- OVERVIEW
- DETECT
- TARGET
- INFILTRATE
- SABOTAGE
ACHIEVEMENTS
HUMAN PRACTICE
SAFETY
COLLABORATION
- COLLABORATION
- SENSIGEM
NOTEBOOK
TEAM

@iGEM_Paris

<body>

Notebook

1 Week 01: 3^th - 9^th June
- 1.1 Monday 3^th June
- 1.2 Tuesday 4^th June
- 1.3 Wednesday 5^th June
- 1.4 Thursday 6^th June
- 1.5 Friday 7^th June
2 Week 02: 10^th - 16^th June
- 2.1 Monday 10^th June
- 2.2 Tuesday 11^th June
- 2.3 Wednesday 12^th June
- 2.4 Thursday 13^th June
- 2.5 Friday 14^th June
3 Week 03: 17^th - 23^th June
- 3.1 Monday 17^th June
- 3.2 Tuesday 18^th June
- 3.3 Wednesday 19^th June
- 3.4 Thursday 20^th June
- 3.5 Friday 21^th June
4 Week 04: 24^th - 30^th June
- 4.1 Monday 24^th June
  - 4.1.1 Trojan Horse
- 4.2 Tuesday 25^th June
  - 4.2.1 Trojan Horse
- 4.3 Wednesday 26^th June
- 4.4 Thursday 27^th June
  - 4.4.1 Trojan Horse
- 4.5 Friday 28^th June
  - 4.5.1 Trojan Horse
5 Week 05: 1^st - 7^th July
- 5.1 Monday 01^st July
- 5.2 Tuesday 02^st July
- 5.3 Wednesday 03^st July
- 5.4 Thursday 04^st July
- 5.5 Friday 04^st July
6 Week 06: 8^th - 14^th July
- 6.1 Monday 8^th July
- 6.2 Tuesday 9^th July
- 6.3 Wednesday 10^th July
- 6.4 Thursday 11^th July
- 6.5 Friday 12^th July
7 Week 07: 15^th - 21^th July
- 7.1 Monday 15^th July
- 7.2 Tuesday 16^th July
- 7.3 Wednesday 17^th July
- 7.4 Thursday 18^th July
- 7.5 Friday 19^th July
8 Week 08: 22^th - 28^th July
- 8.1 Monday 22^th July
- 8.2 Tuesday 23^th July
- 8.3 Wednesday 24^th July
- 8.4 Thursday 25^th July
- 8.5 Friday 26^th July
9 Week 09: 29^th July - 4^th August
10 Week 10: 5^th - 11^th August
11 Week 11: 12^th - 18^th August
12 Week 12: 19^th - 25^th August
13 Week 13: 26^th August - 1^st September
14 Week 14: 2^nd - 8^th September
15 Week 15: 9^th - 15^th September
16 Week 16: 16^th - 22^th September
17 Week 17: 23^th - 29^th September
18 Week 18: 30^th September - 6^th October
19 Week 19: 7^th - 13^th October
20 Week 20: 14^th - 20^th October
21 Week 21: 21^th - 27^th October
22 Week 22: 28^th October - 3^th November

Add here your twit

Starting bacterial culture of MG1655-6300 (Chantal’s glycerol).
Streaking 2 Agar plate with it.

Add here your twit

Choosing a nice colony and launching overnight culture 37° in LB.

Add here your twit

Making MG1655-6300 competent (edit 28/06: failure).

Add here your twit

sRNA design

PICTURE OF THE DESIGN

Red sequences:

pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT
pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT

We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.

Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.

4 strains were received from Jake:

E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
E. coli: NEBTurbo zmSIR Chloramphenicol
E. coli: NEBTurbo zmFNR Spectinomycin
E. coli: NEBTurbo soFD, zmSIR Chloramphenicol

Media and Glycerol stock were prepared:

3 500ml bottles of LB broth and LB agar were prepared by standard methods.
12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.

Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.
750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Plasmids were extracted from strains sD002, sD003, sD004

Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in the protocol (available on google drive).
Lacking Resuspention solution we used some from a different mini prep upstairs.
Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. Plasmids were included in catalog.

Add here your twit

Add here the documentation of your day

Glycerol stock was made and cells were transformed.

From overnight culture of MG1655-6300 O/N : T001
Centrifuge 4000rpm, 10 minutes,
Take out liquid
Resuspend cells in 1mL glycerol, 2mL LB
Separate in two cryotubes, one for the -80°C, one for the -20°C

Making MG1655-6300 competent using Electroporation protocol
Test of the competent cells (negative
Transforming with pCOLADuet-1
Transforming with pACYCDuet-1
Plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Competent Cells : BL21 (DE3) dCysI dFpr dydbk

We grew 5ml of sD001 cells overnight from a single colony.
This 5ml was used to innoculate 500ml of LB broth.
Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
Cells were centrifuged again for 20 minutes at 4000xg.
Supernatant was removed and cells were resuspended in 12ml Buffer 2.
Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.

Buffer 1: 50mM CaCl2
Buffer 2: 0.53ml 2M CaCl2 2.8ml 60% Glycerol 8.67ml sterile H2O

Add here your twit

Add here the documentation of your day

Add here your twit

Negative controls are negative.
Transformed cells grew on plates.
In the evening launch of 5mL Lb cultures from clones on the plates.

Igem Buffer for chemical competent cells.
Igem protocol for chemical competent cells.

Launch overnight culture of NEB turbo.
5mL LB inoculated with a clone from plate of drug team.

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Glycerols of the overnight cultures of the transformation.

sT002 : MG1655 pCOLADuet-1
sT003 : MG1655 pACYCDuet-1

Making stocks of electro competent NEB turbo: Prepare 10% glycerol solution; Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes; Cool down centrifuge to 4°C; Prepare a rack with 50 microtubes at -80°C

Making electroconpetent cells stock: Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured; Check the OD until it reached 0,5; Put 500mL cultures in 10 50mL falcon tubes in ice; Wait for 20 minutes for the culture to cool down; Centrifuge at 3400 rpm 4°C for 10 minutes; Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube); Centrifuge 10 minutes, 4°C , 3400 rpm; Take out liquid and resuspend in 25 mL ice cold water; Centrifuge 10 minutes, 4°C, 3400 rpm; Resuspend all the content of the tubes in 20mL ice cold glycerol; Centrifuge 10 minutes, 4°C, 3400rpm; Resuspend in 5mL ice cold 10°C glycerol solution; Aliquot in 50 tubes (100uL per microtubes); Store at -80°C

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol.

Geneious files in the dropbox: LacZ primers, KanR primers.

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Transformation of pUC18 (NEB, NEB CC, BL21)

Thaw competent cells on ice.
Place 20 ul of cells in a pre-chilled Eppendorf tube.
add o.5ul of plasmid to the cells
Mix gently by flicking the tube.
Chill on ice for 10 minutes.
Heat shock at 42 °C for 30 seconds.
Return to ice for 2 minutes.
Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)
Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)
Incubate at 37 °C. Transformants should appear within 12 hrs.

Result: Colonies (around 10)

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Add here your twit

Add here the documentation of your day

Centre for Research and Interdisciplinarity (CRI)
Faculty of Medicine Cochin Port-Royal, South wing, 2nd floor
Paris Descartes University
24, rue du Faubourg Saint Jacques
75014 Paris, France

+33 1 44 41 25 22/25

team2013@igem-paris.org

July 2013
Mo	Tu	We	Th	Fr	Sa	Su
	1	2	3	4	5	6
7	8	9	10	11	12	13
14	15	16	17	18	19	20
21	22	23	24	25	26	27
28	29	30	31

August 2013
Mo	Tu	We	Th	Fr	Sa	Su
			1	2	3	4
5	6	7	8	9	10	11
12	13	14	15	16	17	18
19	20	21	22	23	24	25
26	27	28	29	30	31

October 2013
Mo	Tu	We	Th	Fr	Sa	Su
	1	2	3	4	5	6
7	8	9	10	11	12	13
14	15	16	17	18	19	20
21	22	23	24	25	26	27
28	29	30	31	1	2	3

June 2013