Team:Freiburg/Project/crrna
From 2013.igem.org
Targeting
crRNA design tool
This tool helps you to design a crRNA-insert for dCas9 RNA plasmid: "uniCAS RNAimer" (BBa_K1150034).
Using this tool you do not have to do this on your own. Just insert the desired target sequence and you get all different oligo possibilities and their positions. The oligos contain overhangs which fit to this plasmid's BbsI-overhangs and are ready to use.
The two different target possibilities are the coding and non-coding strand, depending on the desired target sequence.
a) For repression of gene transcription by targeting the coding strand the oligos must be designed as follows:
- Search at your desired target sequence for a CCN (reverse complement of the PAM sequence) at the coding strand.
- Extract the following (3') 30 nucleotides.
- Extract the reverse complement.
- Add AAAC at the 5' end and GT at the 3' end. This will be your fist oligo.
- Take the sequence from step 2 and add TAAAAC at the 5' end. This will be your second oligo.
b) For repression of gene transcription by targeting the non-coding strand the oligos must be designed as follows:
- Search at your desired target sequence for a NGG (the PAM sequence) at the coding strand.
- Extract the 30 nucleotides before (5') the PAM sequence.
- Extract the reverse complement.
- Add TAAAAC at the 5' end. This will be your second oligo.
- Take the sequence from step 2 and add AAAC at the 5' end and GT at the 3' end. This will be your first oligo.
(the oligos are designed analog to: Cong L, Ran FA, Cox D, Lin S, Barretto R,Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex (2013 Jan 3). Genome Engineering using CRISPR/Cas Systems. Science. DOI: 10.1126/science.1231143 )
Technical Information
view source codeRNAimer - targeting dCas9 to its destination
Introduction
One of the biggest advantages of the CRISPR/Cas9 system compared to other transcription activators (e.g. Zn fingers, TALEs) is that only one protein is required for targeting several DNA sites: For a new target there has to be just another crRNA. We designed an RNA plasmid containing the tracrRNA, where the crRNA can be introduced easily by digesting with BbsI and inserting two previous annealed oligos. Two of these RNA plasmids (with different crRNAs) can be fused using the iGEM biobrick system. This way it is possible to get two or more crRNAs on one plasmid.
Fig. 1: RNAimer (BBa_K1150034) |
As it is important that the RNAs are not being marked for protein expression the RNA polymerase III is required for transcription. RNA polymerase III mainly synthesize small non-coding RNAs (e.g. tRNAs or rRNAs) whereas the commonly used polymerase II is responsible for transcription of mainly mRNAs [1,2] . We chose the human U6- and H1-promoter to drive the RNAs as they are exclusively recognized by polymerase III [2] .
With this RNA plasmid and another plasmid containing the Cas9-effector fusion protein it is possible to target several DNA sites at once by transfecting only two plasmids. This could mean the simultaneous regulation of different genes or a stricter controlling of one gene by bringing more effector domains to this gene.
RNAimer - the multiple RNA plasmid
In order to reduce the amount of plasmids for transfection when intending to target several genes or target sites at once, we wanted to join the required crRNAs on one RNA plasmid. This was easily manageable by using the iGEM standard assembly: We inserted the oligos seperately into BBa_K1150034 by digesting with BbsI and ligation. Afterwards the whole inserts can be combined by using the restriction enzymes of the prefix and suffix (Fig. 6). Figure 6: Assembly and function of the RNAimer For each desired crRNA one 'RNA plasmid' (=containing after ligation the crRNA) has to be opened by digesting with BbsI. There the annealed crRNA oligos will be inserted. After that the different RNA inserts can be assembled using the idempotent iGEM cloning strategy. So three different crRNAs will be transcribed. |
Figure 7: RNAimer in comparison to two RNA plasmids SEAP activity was divided through luminescence intensity of Renilla luciferase. The bars represent the mean of biological triplicates with standard deviation. All samples were transfected with CMV:dCas9-VP16 in pSB1C3 and with two (left) or one RNA plasmid (right), each time coding for the same crRNAs. T3+4: RNAimer with T3 and T4 crRNA; T3 & T4 two different RNA plasmids with T3 and T4 crRNA. |
Discussion
With our toolkit it is possible to induce a gene by transfecting only two plasmids (dCas9 with effector and RNAimer) that can be combinied with no effort in accordance to the experimental setup.
For future application researchers will be able to render gene expression by transfecting even only plasmids containing the crRNA: when dCas9 will be stable integrated into the genome of cells or model organisms, as recently done by Gilbert et al. [4].
References
Multiple targeting
Results
Activation of different genes at once
In order to test the simultaneously activation of several genes we assembled 3 plasmids containing different fluorescent proteins. Every protein is fused to a different signal for intracellular localization. Thus, we were able to distinguish better between the different fluorescent proteins, because there will be no interference of the emitted light. Fig. 2: Plasmids encoding the fluorescent proteins Each fluorescent protein is driven by a CMV minimal promoter, that can be switched on by binding of TetR-VP16 to the TetO sequence. Between TetO and CMVmin there is a target site for Cas9 binding, a different on each plasmid. The fluorescent were fused to signal sequences for subcellular localization, so mCherry will be in the nucleus, GFP in the Golgi apparatus and BFP at the membrane. T: terminator. |
Fig. 3: Microscopy pictures of fluorescent proteins expressed in HeLa cells Fluorescence pictures were taken of fixed HeLa cells transfected with Golgi-GFP and mCherry-NLS. Channels of GFP and mCherry were merged. All pictures have the same scale. |
Fig. 4: Activation of expression of different fluorescent proteins The fluorescence intensity of each cell was analysed by flow cytometry. The mean fluorescence intensity was calculated with the intensities of the cells which were brighter than untransfected cells. The bars represent the mean with standard deviation of these mean fluorescences of three different cell populations. blue: only the plasmid containing the fluorescent proteins with minimal promoter were transfected; green: the minimal promoter driven fluorescent proteins were cotransfected with TetR-VP16; yellow: the minimal promoter driven fluorescent proteins were cotransfected with dCas9-VP16. |
Stricter gene regulation by targeting different loci simultaneously
As we wanted to improve the efficiency of our gene regulation toolkit, we tried to target several loci upstream of the reporter gene's promoter at once. Thus, we ordered crRNAs that are complementary to sequences on the SEAP reporter plasmid with different distances to the promoter (Tab. 1).
HEK cells were transfected with the SEAP reporter plasmid, dCas9-VP16 (iGEM standard), one or two RNA plasmids and a plasmid coding for Renilla luciferase for an internal standard (to eliminate variabilities of different cell numbers or expression levels). The total amount of RNA plasmids was always the same, so it can be exclude that an increase of SEAP expression is due to more available crRNA. When combining the targets EMX1 and T2 there could be observed a higher SEAP activation than the sum of the single targets (Fig. 5).
Fig. 5: Effects of different target numbers SEAP activity was divided through luminescence intensity of Renilla luciferase. The bars represent the mean of biological triplicates with standard deviation. All samples were transfected with CMV:dCas9-VP16 in pSB1C3 and with no (left), one (middle) or two RNA plasmids (right). |
Targets
Introduction
After our first experiments we recognized that different target loci cause different effects. Thus, we cloned 5 different target sites 26 bp upstream of the CMVmin promoter of a SEAP reporter plasmid. Additionally we designed crRNAs in various distances upstream of this promoter. This target site were evaluated by activating SEAP expression with dCas9-VP16.
Table 1: Different target sites The VEGF and EMX1 target sites were cloned into the SEAP reporter plasmid. T2 till T4 are original sequences of this plasmid. All target loci are upstream of the CMVmin promoter. VEGF and EMX1 are parts of the sequence upstream of the human VEGF or EMX1 gene, respectively. |
|||
Name | Distance to promoter | Sequence | GC content [%] |
---|---|---|---|
VEGF VZ-573 | | GTGTGCAGACGGCAGTCACTAGGGGGCGCT | |
VEGF VZ-475 | | GTGAGTGTGTGCGTGTGGGGTTGAGGGCGT | |
VEGF VZ-8 | | TTAAAAGTCGGCTGGTAGCGGGGAGGATCG | |
VEGF VZ+434 | | GACCTGCTTTTGGGGGTGACCGCCGGAGCG | |
EMX1 | | GGAAGGGCCTGAGTCCGAGCAGAAGAAGAA | |
T2 | | AAGCATTTATCAGGGTTATTGTCTCATGAG | |
T3 | | AATGCCGCAAAAAAGGGAATAAGGGCGACA | |
T4 | | GACCGAGTTGCTCTTGCCCGGCGTCAATAC | |
To target the dCas9 and the fusion proteins need two small RNAs to be targeted to their destination locus. To do so, we used seperate plasmids, that contain the needed genes that code for both RNAs. This plasmid is called the RNAimer and allows a highly flexible, easy-to-use tool for single and multiple targeting.
For simplicity the plasmid that codes for the RNAs will be called RNA-plasmid. All RNA plasmids are derivates of the RNAimer.
Results
At first we tested different target sequences at the same loci. For that we had to insert the target sequences into the SEAP reporter plasmid.HEK cells were transfected with one of these SEAP plasmids and a plasmid containing CAG:dCas9-VP16, the tracrRNA and the appropriate crRNA. The results show different activation efficiencies (Fig. 1): from no activation at all (VEGF VZ -573 and +434) to a 5 fold increase of SEAP activation. With the tested target sequences that have a GC content of 70 % there was no activation, whereas it was possible to induce SEAP expression with the target sequences with a GC content of about 60 % (compare Tab. 1).
Figure 1: Targets with different sequences The light green bars represent the SEAP activity of HEK cells transfected with CAG:dCas9-VP16 but no crRNA normalized to one. The dark green bars show fold induction of SEAP activity by tansfecting CAG:dCas9-VP16 with crRNA in comparison to the appropriate control without crRNA. All values are means of three biological replicates with standard deviation. |
HEK cells were transfected with the SEAP plasmid that contains EMX1, CMV:dCas9-VP16 and the RNA plasmid. The results show a very high increase in SEAP expression when EMX1, which is the nearest target site to the promoter, is targeted (Fig. 2). Activation becomes weaker, the bigger the distance between promotor and target sites gets(compare Tab. 1).
Figure 2: Targets with different distances to the promoter The light green bar represents the SEAP activity of HEK cells transfected with CMV:dCas9-VP16 but no crRNA normalized to one. The dark green bars show fold induction of SEAP activity by tansfecting CAG:dCas9-VP16 with crRNA in comparison to the control without crRNA. All values are means of three biological replicates with standard deviation. |
Discussion
From the few target sites we evaluated we could draw the conclusion that a target should be chosen like this:- The nearer to the promoter the better.
- Target sites with a low GC content should be preferred.
Moreover there may be other parameters that influence the effects of dCas9-VP16 on SEAP (e.g. the secondary structure of the crRNA). But for the distance to the promoter Mali et al. [1] had the same result: Only the target site that was nearest to the promoter showed a high increase of activation.
References