Team:UFMG Brazil/Cardbio

From 2013.igem.org

Revision as of 08:02, 27 September 2013 by Lucasfrib (Talk | contribs)

Contents

The Problem

CardBio: The Project

Figure 1 - Comparison of leading causes of death over the past decade, 2000 and 2011 (modified
Acute coronary syndrome (ACS) refers to any group of clinical symptoms compatible with acute myocardial ischemia and includes unstable angina, non—ST-segment elevation myocardial infarction, and ST-segment elevation myocardial infarction (Kumar and Cannon, 2009). These high-risk manifestations of coronary atherosclerosis are important causes of the use of emergency medical care and hospitalization in the United States, where in 2004, approximately 200.000 people died by heart attack, and in 2009, about 1.190.000 patients were diagnosed with ACS (Acute Coronary Syndrome) (Heart Disease and Stroke Statistics--2012 Update : A Report From the American Heart Association).
Figure 2. The 10 leading causes of death in the world at 2011 (modified)

It is observed in ACS that plaque formation and its development release several substances in the patient blood that have a big potential to be explored as possible biomarkers for diagnosis of ACS even if it remains a challenge in contemporary emergency medicine. A blood-borne biomarker is an attractive alternative to cardiac imaging or stress testing as it would be cheaper and logistically faster to obtain. Several biomarkers can be associated to assess Acute Myocardial Infarction as shown in the Figure 2

Figure 3 - Biomarkers associated with various pathophysiological processes associated with acute myocardial infarction[5]

Figure 2 - Biomarkers associated with various pathophysiological processes associated with acute myocardial infarction Given these information, Brazil_UFMG team chose to develop a Genetically Modified Organism (GMO) able to measure blood serum concentrations of specific molecules with potential to be ACS biomarkers, to be used as an efficient method of prognostic test. References: [1]. Kumar A., Cannon, C. P.,(2009) ”Acute Coronary Syndromes: Diagnosis and Management, Part I” Mayo Clinic Proceedings, vol 84, Issue 10, pages 917–938 Symposium on Cardiovascular Diseases. [2] Danne, O. and M. Mockel (2010). "Choline in acute coronary syndrome: an emerging biomarker with implications for the integrated assessment of plaque vulnerability." Expert Rev Mol Diagn 10(2): pages 159-171. [3] Heart Disease and Stroke Statistics - 2012 Update : A Report From the American Heart Association. [4] SeC. Muller and M. Mockel (2010). "Biomarkers in acute coronary syndrome and petaneous coronary intervention." Minerva Cardioangiol. [5] Daniel Chan and Leong L. Ng., “Biomarkers in acute myocardial infarction”, BMC Med. 2010; 8: 34. Published online 2010 June 7, doi:10.1186/1741-7015-8-34 [6] World Health Organization

Our Design

Cardbio design.jpg After an extensive research on the biomarkers used for prognosis of Acute Coronary Syndrome (ACS), we elected three that we could work on to somehow make our bacteria detect: TMAO, IMA and BNP. Our bacteria was to work as a traffic light: it should make GFP constitutively (meaning “all green, no problem detected”), until something was detected. To do that, we decided to use the 454CI-regulated promoter (BBa_R0052) with the GFP translation unit (BBa_E0840). IMA, which means Ischemia Modified Albumin, was a tricky one. Our studies indicated that, although a good marker for ischemia, IMA could be better used for ACS prognostic as a negative predictor than a positive one. Because of that, we assigned YFP to its detection: its presence doesn’t really say much, it’s a warning, but its absence does means that everything is still green. We found out that a clinical test for IMA was available, based on the detection of cobalt added to a patient’s blood serum (the reason being that IMA binds less cobalt than normal human serum albumin); so, we decided to incorporate this method by using a cobalt-inducible promoter, Rcna (BBa_K540001) associated to the 454CI repressor translation unit (BBa_S0104) and the YFP translation unit (BBa_E0430). With this construction, if cobalt is added to a medium containing our chassis and a patient’s blood, and it remains unbinded due to the presence of IMA, it will activate the promoter, which will both repress the synthesis of GFP (through the 454CI protein) and lead to the production of YFP. TMAO is a biomarker that was recently linked to heart diseases, and one that our literature research showed that could activate an inducible bacterial promoter, part of the TorCAD operon. Since this promoter was not deposited in the Parts Registry, we ordered it to be synthesized, with modifications to its structure to enhance its activity [1]. The sequence of the promoter we ordered was:

5’ – CGAACGAATTCGCGGCCGCTTCTAGAGATTCTGTTCATATCTGTTCATATTCCGTTCATCCT

GACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCATACTAGTAGCGGCCGCTGCAG – 3’

We decided to assign RFP to this biomarker, and thus our construction for this became the TorCAD promoter we had synthesized, the 454CI repressor translation unit and the RFP translation unit (BBa_J06702). Our last target is BNP (Brain Natriuretic Peptide), a major prognostic biomarker for ACS. To detect it, we tried to synthesize a biobrick containing the coding region of NPRA, a receptor capable of detecting BNP and respond unleashing an intracellular cGMP cascade. And to detect the cGMP produced by the receptor, we also ordered the synthesis of another promoter, belonging to PDE5 (phosphodiesterase 5), which is positively regulated by this molecule. Putting it all together, the plan was to create a plasmid containing two constructions: 1) a constitutive promoter associated with the translation unit of NPRA, to make our bacteria detect BNP and respond producing cGMP, and 2) PDE5 promoter associated with the 454CI repressor and another fluorescent protein, like CFP, to make our bacteria produce a signal when the biomarker was detected. However, we were unable to proceed with the detection of BNP, due to the high content of CG pairs on both the NPRA receptor and PDE5 promoter, which rendered their synthesis impossible. Thus, with all of this constructions, we’d be able to create our traffic light, heart vigilant bacteria. References 1 - Ansaldi M, Simon G, Lepelletier M, Mejean V (2000). "The TorR high-affinity binding site plays a key role in both torR autoregulation and torCAD operon expression in Escherichia coli." J Bacteriol 2000;182(4);961-6. PMID: 10648521

Biomarkers

TMAO

IMA

Our Sponsors

Reitoria-de-pesquisa-UFMG.jpg Reitoria-de-posgraduacao-UFMG.jpg Icb ufmg.jpg Bioquimica.jpg Bioinformatica.jpg INCT.jpg Inctv.jpg Nanobiofar.jpg Fapemig.jpg Sintesebiotecnologia.jpg