Team:Freiburg/Project/toolkit

Non inducible uniCAS Activator (Cas9-VP16 device)

You have chosen to activate a gene using a non inducible Cas9-VP16 device. Therefore you have to order the following plasmids from the iGEM parts registry . After receiving our plasmids, you will have to clone your target sequence into our crRNA plasmid (protocol see below).

Note:
All plasmids are optimized for expression in mammalian systems. The devices are also available containing an SV40 instead of an CMV promotor (have a look at our parts side). This system was tested mainly in CHO-K1, HEK-293T and HeLa cells.

Design of the crRNA plasmid:

Use our crRNA design tool to design the crRNAs that are needed to target your gene of interest. It will generate possible target sites and the appropriate oligos. Order the oligos by the company of your choice. We recommend to test several different loci to target your gene of interest because the efficiency of different crRNA-loci can differ.

1. Oligo annealing: Anneal forward and reverse oligo to get the desired crRNA. Therefore mix 10 µl of 100 µM forward Oligo, 10 µl of 100 µM reverse Oligo and 80 µl of ddH2O. Heat the solution to 95° C for 5 minutes. Then turn off the heat block and let the solution cool down.
2. Digest plasmid BBa_K1150034 with Bbs1: The restriction enzyme Bbs1 should always be stored at -80° C. Mix about 500 ng of BBa_K1150034 with 1 µl of Bbs1, appropriate amount of buffer and fill up to 50 µl with ddH2O. Digest for exact 3 hours at 37° C.
3. Ligate crRNAs (step 1) into Bbs1 cut backbone: The insert (crRNAs) should be ligated into the backbone in 3 molar insert excess. Therefore use this formular: Required Volume of Insert = 3 x Volume(Backbone) x length(Insert) x concentration (Backbone) / [ length(Backbone) x concentration(Insert) ]. Use about 50 ng Bacbbone. The length of insert is always 30 basepairs. The length of the backbone is 2900 basepairs. You have to mix the appropriate amount of Backbone and the appropriate amount of Insert with 1 µl of T4 Ligase and 2 µl of 10xT4 ligase buffer. Then fill up to 20 µl with ddH2O. This mix should incubate for 30 minutes at room temperature.
4. Transform 3-5 µl of the mix following standard protocol. Pick clones, miniprep the plasmids and sequence it with pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).

Now that you have created the desired crRNA plasmids it is possible to use them indiviually or fuse different crRNA loci together into one crRNA plasmid (recommended).

Design of a multiple target crRNA plasmid:

It is shown that multiple targeting of one gene of interest increases the efficiency of regulation. If you want to fuse different crRNA loci together into one plasmid use the following protocol:

1. Digest first crRNA plasmid with XXX and XXX. This is your backbone. Therefore mix about 500 ng Backbone with 1 µl Enzyme 1 and 1 µl Enzyme 2, add an appropriate amount of compatible buffer and fill up to approximate 30-50 µl. Incubate mix at 37° C for 2 hours.
2. Digest second crRNA plasmid with XXX and XXX. This is your insert (procedure see above).
3. Ligate the insert in 3 molar excess into the backbone (formular see paragraph above).
4. Transform 3-5 µl of the mix following standard protocol. Pick clones, miniprep the plasmids and sequence it with pSB1C3 forward sequencing primer (sequence: GAGTGCCACCTGACGTCTAAGAAAC) and pSB1C3 reverse sequencing primer (sequence: CGCCTTTGAGTGAGCTGATACCGC).

Experimental design (recommendation for mammalian cell culture):

1. Transfect BBa_K1150020 with all desired crRNA plasmids (seperate crRNA plasmid and/or multiple crRNAs plasmid)
2. Non-effector control: Transfect the appropriate crRNA - plasmid togehter with BBa_K1150017 that has no effector.
3. Off target control: Transfect BBa_K1150020 without any crRNA plasmid.