Team:Imperial College/Waste Degradation: SRF

From 2013.igem.org

Revision as of 21:56, 2 October 2013 by Mc1110 (Talk | contribs)

Module 1: Resourceful Waste

Module 1 summary.jpg


Non-recyclable waste is sourced from a recycling centre, placed in a bioreactor with our M.A.P.L.E system which degrades the waste and synthesises the bioplastic P(3HB). Click the tabs to find out more

  • Overview

  • Specifications

  • Design

  • Modelling

  • Assembly

  • Testing & results

  • Future work

Mixed waste is one of the major challenges facing waste management as the materials cannot be recovered by recycling processes dedicated to individual materials. As a result the many things made of mixed materials and others that end up this way when disposed of are not properly utilised. We wanted to create a way to recover these materials and produce something useful and valuable from them. We have designed this module to leverage the ability for organisms to work together to carry out complex tasks; in this case breaking down a common mixed waste to release a the valuable platform chemical ethylene glycol and turning the remaining material into the bioplastic poly-3-hydroxybutyrate.

The mixed waste we have chosen is produced in recycling centres as a byproduct of the separation of valuable items from commercial and industrial waste. It is currently disposed of by incineration, causing harm to the environment and human health. It also wastes the resources present, many of which are non-renewable. We are upcycling this waste into new commodities.

To do this we will break down the petrochemical polyurethane to recoup the valuable and finite feedstocks which produced it. We have chosen to break down PUR as we want to expand the range of major petrochemical plastics that can be broken down by the parts registry so that novel functions braking down a range of plastics such as this can be pursued with biobricks.

In order to do this we will secrete polyurethane degrading enzymes, often called PUR esterases, which have the ability to break polyurethane down. These genes are found naturally in organisms which must degrade tough substrates, particularly lignin. This makes them useful in breaking down plastics as these too are resistant polymers. We have tested five of these PUR esterases to find the most effective. One of the products of polyurethane breakdown is the toxic compound ethylene glycol and we have modeled the maximum rate of degradation which will still allow E.coli MG1655 to survive and continue to produce esterases as this is significant for whether this technique could be used to produce industrially relevant levels.

After the oil derived plastics are removed from the mixed waste there is energy rich organic matter left over. This is what the bacteria will feed on to produce the bioplastic P3HB. P3HB is produced inside the cells of bacteria containing the phaCAB operon which is found in Ralstonis eutropha and other soil living bacteria. The ability of some bacteria to produce poly hydroxyalkanoates (the family of polyesters of which P3HB is a member) has been known sice the 1920's. P3HB is produced industrially inside bacteria grown with sucrose and other sugars from crops such as corn. Another possibility is to grow it inside genetically engineered plants but this is much less efficient. P3HB is still currently much more expensive than

Specification

1. The bacteria should survive and grow in mixed waste

In order for the bacteria to produce bioplastic from the mixed waste they first need to be able to use it as a carbon source

2. The bacteria should secrete a functional polyurethane esterase

To recover the resources from polyurethane in the mixed waste, the enzymes should secrete in an active form.

3. Our Bacteria should be able to tolerate mixed waste degradation products, such as Ethylene Glycol

The products of Polyurethane degradation are toxic and so any bacteria growing with them must be able to survive to a concentration which will allow economical production of ethylene glycol. We have chosen a strain of E.coli-MG1655, which is resistant to ethylene glycol toxicity.

4. The bacteria should produce P3HB

5. The bacteria should produce P3HB from the mixed waste

Design

Petrochemical Plastic degradation

testing

It is known from previous research that some lignin degrading microbial enzymes to be so tough that they can even deal with more difficult polymers: plastics. Some previous iGEM teams have exploited this and worked on enzymatic degradation of various kinds of plastic. We would like to build on this work and extend the plastic degradation capabilities of the synthetic biology community by improving PUR degradation in particular as this has not been successfully achieved before. We have identified 5 PUR-esterase enzymes from the literature that are capable of catalyzing the below reaction.

PUR molecular degradation
We have synthesised all of the genes in the below table and are testing them for expression in E.coli, secretion, activity and PUR degradetion capabilities. Our ultimate design is to be able to control the relative levels of different enzymes in waste degrading bio-reactor in order to adjust it to the composition of waste. Therefore we designed the expression constructs accordingly. Our models predict the degradation rate of PUR at the bioreactor scale.

BioBrick Designs

enzyme source organism biobrick reference
EstCS2 uncultured unknown bacterium (GU256649.1) BBa_K1149002 Kang et.al 2011
pueA Pseudomonas chlororaphis BBa_K1149003 Stern et al., 2000
pueB Pseudomonas chlororaphis BBa_K1149004 Howard et al., 2001
pudA Comamonas acidovorans BBa_K1149005 Allen et al. 1999
pulA Pseudomonas fluorescens BBa_K1149006 Vega et al., 1999
testing

Bioplastic Synthesis

Poly-3-hydroxybutyrate(P3HB) is a bioplastic which is naturally produced inside bacteria such as Ralstonia eutropha, where it accumulates as globules inside the cell. In its native bacteria it is produced as an energy store(1) but it is as a plastic that it interests researchers and industrialists.

We have made P3HB in E.coli, transferring three genes, naturally found in Ralstonia eutropha into E.coli MG1655. These encode the three enzymes necessary for P3HB production; polyhydroxyalkanoate synthase(phaC), 3-ketothiolase(phaA) and acetoacetyl coenzyme A reductase(phaB). These are encoded by the phaCAB operon. We have altered the expression of these three genes to maximise the production of P3HB as high yields are required for it to be economically viable.

testing

Secretion

E.coli is commonly used as a chassis in innovative iGEM project that aim to prove the concept and make the case for a novel function in a biologically engineered machine. In our case, we aim to degrade and synthesise plastic and the degradation part of our system needs to be extracellular. There are not only such biotechnological but also many other reasons for the extracellular targeting of a protein: It can be a product with a medical function, like the [http://www.2009.igem.org/Team:METU-Gene/EGF_Transportation EGF hormone in a previous iGEM project] or be important in bioremediation such as in Dundee Team’s toximop system and much more. There are many strategies for secretion. On the following page, you can read about these and find out why we chose the pelB tag for all our degradation enzymes and how we improved the ESTCS2 esterase by changing the phoA outer-membrane anchoring tag in the original Biobrick to pelB. Our story will help you to choose a secretion strategy best suited to your project and also give you guidance with the technical details of using it.

Alternative strategies for protein secretion in E.coli:

N terminal secretion-signal peptides are recognised by the sec pathway . The pathway transports to the periplasm and additional mechanism are usually necessary to further export the protein to the extracellular space. An approach for using this pathway is the addition of an N terminal signal peptide to the target protein which can obtain as high as 90% efficiency in secretion to the extracellular space. Such signals are pelB and phoA tags which are available as biobricks. PelB can get cleaved off by pelB peptidase in the periplasm but phoA will anchor your protein to this localisation.

Fusion partners are endogenous proteins that naturally get secreted in E.coli and can be fused to the target protein. Some such proteins were demonstrated to be a powerful carriers of medically relevant human proteins in E.coli. The yebF and ompF proteins exit the cell via the sec pathway and use additional mechanism for leaving the periplasm where they interact with outer-membrane porins for extracellular secretion. The osmY is available as a Biobrick and we have submitted ompF this year.

The porin proteins such as ompF and ompA, can be used as fusion partners too and anchor proteins to the outer surface of E.coli.

ABC transporters use ATP for transport of specific proteins across the bacterial membrane. The ABC transporter of Erwinia chrysanthemi can be expressed in E.coli and export proteins that contain the LARD1 domain as a C terminal fusion. The system is biobricked in two separate plasmids (transporter, LARD1) with different antibiotic resistance and it is important to use both at the same time.


The [http://parts.igem.org/Protein_domains/Localization page] in the registry that lists localisation tags] is incomplete and contains eukaryotic and prokaryotic localisation signals mixed together. We have therefore put together the tables below for you to help choose an E.coli secretion strategy that is suitable for your project. </p>

Extracellular Secretion in E.coli:

Description Biobrick Team
pelB type II secretion signal peptide, cleaved off in periplasm BBa_K208004 BBa_K1149022 BBa_K208004 BBa_J32015 lots eg. Imperial 2013
yebF large fusion-protein, Sec-pathway and additional mechanism BBa_K1149001 Imperial 2013
osmY large fusion-protein, Sec-pathway and additional mechanism BBa_K892008 Washington 2012
LARD 1 Lipase ABC transporter recognition domain BBa_K258001 METU-GEne 2009

Outer Membrane Anchors and Periplasmic Expression in E.coli:

Description Biobrick Team
ompF porin protein that can be fused to a protein, anchors to outer membrane BBa_K864204 Uppsala 2012
ompA porin protein that can be fused to a protein, anchors to outer membrane BBa_K103006 Wasraw 2008
INP short domain,anchors in periplasm BBa_K523013 (INP-YFP) BBa_K632002 (INP-Silicatein) Minnesota 2011 Edinburgh 2011
torA anchors in periplasm Dundee 2013
phoA tag for sec pathway, anchors to OM BBa_K808028 Darmstadt 2011

Our choice is to use the pelB secretion tag as it has been demonstrated to work in many cases with sometimes as high as 90% transport efficiency. The pelB has been used in iGEM project for many years and is part of 50+ constructs. The UC-Davis team last year used it to secrete LC-Cutinase, a PET plastic degrading enzyme ( BBa_K936013) successfully which is somewhat similar to our plastic degradation enzymes.

Assembly methods and toolkit:

An advantage of the pelB is that it is relatively short (only 66 BP) and we could get our gene synthesised with the tag. A problem with standard biobrick assembly is that the scar site contains a STOP codon and therefore [http://parts.igem.org/Protein_domains alternative strategies are needed]. One of the ways around this is to use Infusion/Gibson assembly which we also had a go with and you can find instructions under our protocols section. We have constructed a biobrick where LARD1 is after a constitutive promoter and RBS in order to facilitate quicker cloning with less assembly steps, [http://parts.igem.org/Part:BBa_K1149021 BBa_K1149021].

Unfortunately, the pelB tag did not prove to be the best strategy for secreting our degradation enzymes in the MG1655 strain. Therefore, we are changing the strategy to use osmY.

References

  1. Economou A. Following the leader: bacterial protein export through the Sec pathway. Trends in microbiology 1999;7(8) 315-320.
  2. Thanassi DG, Hultgren SJ. Multiple pathways allow protein secretion across the bacterial outer membrane. Current opinion in cell biology 2000;12(4) 420-430.
  3. Sletta H, Tondervik A, Hakvag S, Aune TEV, Nedal A, Aune R, et al. The presence of N-terminal secretion signal sequences leads to strong stimulation of the total expression levels of three tested medically important proteins during high-cell-density cultivations of E.coli. Applied and Environmental Microbiology 2007;73(3) 906-912.
  4. Qian Z, Xia X, Choi JH, Lee SY. Proteome-based identification of fusion partner for high-level extracellular production of recombinant proteins in E.coli. Biotechnology and bioengineering 2008;101(3) 587-601.
  5. Prehna G, Zhang G, Gong X, Duszyk M, Okon M, McIntosh LP, et al. A Protein Export Pathway Involving Escherichia coil Porins. Structure 2012;20(7) 1154-1166.
  6. Binet R, Letoffe S, Ghigo JM, Delepelaire P, Wandersman C. Protein secretion by Gram-negative bacterial ABC exporters - A review. Gene 1997;192(1) 7-11.
  7. Chung CW, You J, Kim K, Moon Y, Kim H, Ahn JH. Export of recombinant proteins in E.coli using ABC transporter with an attached lipase ABC transporter recognition domain (LARD). Microbial Cell Factories 2009;8 11.
  8. Francetic O, Pugsley AP. Towards the identification of type II secretion signals in a nonacylated variant of pullulanase from Klebsiella oxytoca. Journal of Bacteriology 2005;187(20) 7045-7055.
  9. Fu LL, Xu ZR, Li WF, Shuai JB, Lu P, hu CXH. Protein secretion pathways in Bacillus subtilis: Implication for optimization of heterologous protein secretion. Biotechnology Advances 2007;25(1) 1-12.
  10. Cho HY, Yukawa H, Inui M, Doi RH, Wong SL. Production of minicellulosomes from Clostridium cellulovorans in Bacillus subtilis WB800. Applied and Environmental Microbiology 2004;70(9) 5704-5707.
  11. Zhang XZ, Cui ZL, Hong Q, Li SP. High-level expression and secretion of methyl parathion hydrolase in Bacillus subtilis WB800. Applied and Environmental Microbiology 2005;71(7) 4101-4103.

Tolerance to waste

We chose the MG1655 E.coli strain as chassis because it constitutively expresses genes that make it resistant to the potentially toxic molecule. The [http://parts.igem.org/Part:BBa_K892010 AldA] and [http://parts.igem.org/Part:BBa_K892009 FucO] genes have an important role in decreasing the toxic effects of Ethylene-glycol by converting it into Glycolaldehyde which is a link to the cell`s central metabloism. We have received these genes from the registry and future work could be to express these in Bacillus or cellulose degrading organisms to make them tolerant as well.

PHB synthesis Design

We will first use the phaCAB biobrick [http://parts.igem.org/Part:BBa_K934001 BBa_K934001] to produce P3HB. Our aim is the industrial production of P3HB and this require high yields to be economically viable. The results from the metabolic model suggest that to do this the amount of phaB should be increased. To do this we designed constructs with stronger promoters to upregulate the expression of the operon.

The operon was original under the native promoter from Ralstonia eutropha. We designed two promoters to increase transcription. The first uses the constitutive promoter [http://parts.igem.org/Part:BBa_J23104 J23104]. The second was designed as a hybrid promoter incorporating BBa_J23104 and the original promoter due to recent results of high expression from a hybrid promoter[http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0056321]. PhaCAB_all_kinfds_of_parts.jpg

Safety

Bacteria strains

We used E. coli K-12 strains MG1655, NEB 10 beta, NEB 5 alpha and TOP10 (similar to E. coli K-12 DH 10 beta that fall under Risk Group 1 for the experiments, but eventually only MG1655 strain will be used in the bioreactors. This strain rarely survives outside laboratories, although minor symptoms may show if infected. Meanwhile, the parts we designed are specialised for degrading PUR and they should not harm human health.

Chemical reagents

Some of the reagents we used were slightly toxic to human. In order to reduce the risks of using toxic reagents, we always wear gloves and labcoats. For some toxic reagents, we performed in fume cupboard. Click on the reagents to see the MSDS.

1. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=W222305&brand=ALDRICH&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Faldrich%2Fw222305%3Flang%3Den Tributyrin]

2. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=458392&brand=ALDRICH&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Faldrich%2F458392%3Flang%3Den Poly(diethylene glycol adipate)].

3. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=19123&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2F19123%3Flang%3Den Nile red].

4. [http://www.sigmaaldrich.com/MSDS/MSDS/PleaseWaitMSDSPage.do?language=&country=GB&brand=SIGMA&productNumber=A3256&PageToGoToURL=http://www.sigmaaldrich.com/catalog/product/sigma/a3256?lang=en&region=GB Arabinose].

5. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=N9876&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fn9876%3Flang%3Den 4-Nitrophenyl butyrate].

6. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=N8130&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fn8130%3Flang%3Den 4-Nitrophenyl acetate].

7. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=S8511&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fs8511%3Flang%3Den N-Succinyl-Ala-Ala-Pro-Leu p-nitroanilide].

8. [http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?country=GB&language=en&productNumber=L3126&brand=SIGMA&PageToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog%2Fproduct%2Fsigma%2Fl3126%3Flang%3Den Lipase from porcine pancreas].

Bioreactor safety

We have come up with a few strategies to prevent release of our bacteria into the environment. Firstly, the bioreactor containing bacteria will have a kill switch that kills bacteria if the bioreactor is opened when operating. We also lyse the cells at the end of reactions to harvest our product P3HB, ensuring that no living bacteria escape the bioreactors.

1 P(3HB) synthesis

This section is about modelling the plastic-synthesising E.coli developed in our project. The plastic that this module synthesises is the bioplastic poly-3-hydroxybutyrate, also known as P(3HB). The content below shows the process of building, designing and optimisation of the model. Also, the considerations, assumptions and limitations will be discussed.

1.1 Specifications for the model

[click to expand]


  • Input = monomer (3HB)
  • Output = polymer (P(3HB))

1.2 Deterministic model

The model was built and simulated in Simbiology, a Matlab package designed for modelling biological systems. In our model we have a compartment (labelled "E.coli_1") that represents our engineered cell. The compartment contains the reactions and species that interact with the polymer synthesis pathway.

The pathways on the right half of the cell are genetic expressions of the 3 enzymes involved in the plastic synthesis pathway. The pathways on the left represent the actual P(3HB) production pathway.

Imperial College Circuit.JPG Imperial College Circuit key.JPG

1.3 Ordinary Differential Equations

Genetic regulations and expressions

BDH2 (3-hydroxybutyrate dehydrogenase)
Alt text
Schematic of the gene expression of BDH2 as seen in the model diagram
Imperial College BDH2 gene.JPG
PhaB (Acetoacetyl-CoA reductase)and PhaC (P(3HB) synthase)
Alt text
Schematic of the gene expression of PhaB and PhaC as seen in the model diagram
Imperial College PhaBC gene.JPG

Values, sources and assumptions

Parameter Description Value Units Sources Assumptions
β maximum rate of transcription 0.032 mM/min Please see derivation 1 below. Please see derivation 1 below.
n Hill coefficient 2.0 dimensionless [http://parts.igem.org/Part:pSB1C3?title=Part:pSB1C3] Rounded to 2.0 from 2.26 as Simbiology wouldn't allow a non-integer value for such parameter.
K Activation coefficient 0.0031 mM [http://parts.igem.org/Part:BBa_K206000:Characterization] Taking the "switch point" as the activation coefficient
dmRNA mRNA degradation rate 0.10 1/min [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC420366/pdf/07X.pdf] Taking the value of mRNA half-life in E.coli strain MG1655 as 6.8min. rate = ln2/half-life = ln2/6.8 = 0.10
dprotein Protein degradation rate 0.050 1/min [http://jb.asm.org/content/189/23/8746.full] There is no active degradation pathway and that dilution is the dominant way by which the protein level decreases in a cell. Rate = 1/doubling time, where doubling time = 20min. Assuming steady-state growth in LB broth as presented in paper.
k2 Protein production rate (BDH2) 4.7 1/min Please see derivation 2 below. Please see derivation 2 below.
k3 Protein production rate (PhaCB) 0.58 mM/min Please see derivation 3 below. Please see derivation 3 below.
[Arabinose] Concentration of arabinose Initial: 0.008 mM
[mRNA] Concentration of mRNA - mM - -
[BDH2] Concentration of BDH2 - mM - -
[PhaB] Concentration of PhaB - mM - -
[PhaC] Concentration of PhaB - mM - -

Derivations
1.Derivation of the maximal expression rate,β

  • Average molecular weight (Mw) of a base pair = 660g/mol[http://www.geneinfinity.org/sp/sp_dnaprop.html][http://www.lifetechnologies.com/uk/en/home/references/ambion-tech-support/rna-tools-and-calculators/dna-and-rna-molecular-weights-and-conversions.html]
  • Average mass of a base pair = 660g/mol x 1.66x10-24 = 1.1x10-21g
  • Volume of an E.coli cell = 1µm3[http://kirschner.med.harvard.edu/files/bionumbers/fundamentalBioNumbersHandout.pdf] = 1x10-15L
    • ∴Mass concentration = Imperial College Mass conc cal beta.JPG
    • ∴Molar concentration of 1 base pair in the volume of E.coli = Imperial College Molar conc cal beta.JPG = 1.66x10-6 mM
  • BioBrick assembly plasmid pSB1C3 is a high copy number plasmid (100-300 copies per cell)[http://parts.igem.org/Part:pSB1C3?title=Part:pSB1C3]
    • assume 200 copies per cell
  • ∴ concentration of the gene per cell = N x 200 x 1.66x10-6mM, where N = number of base pairs
    • ∴ concentration of the gene BDH2 (N = 768) in the volume of an E.coli cell is = 0.25mM
  • Transcription rate in E.coli= 80bp/s[http://kirschner.med.harvard.edu/files/bionumbers/fundamentalBioNumbersHandout.pdf] = 80 x 1.66x10-6mM/s = 80 x 1.66x10-6 x 60mM/min = 7.97x10-3mM/min
  • ∴ Rate of mRNA_BDH2 production under the control of pBAD = 7.97x10-3 ÷ 0.25 = 0.032/min

2.Protein production rate of BDH2, k2

  • Average molecular weight(Mw) of an amino acid(aa)= 110g/mol[http://www.genscript.com/conversion.html][http://www.promega.com/~/media/Files/Resources/Technical%20References/Amino%20Acid%20Abbreviations%20and%20Molecular%20Weights.pdf]
  • Average mass of an amino acid = 110g/mol x 1.66x10-24=1.83x10-22g/L
    • ∴Mass concentration of one aa in the volume of an E.coli = Imperial College Mass conc cal beta aa.JPG = 1.83x10-6g/L
    • ∴Molar concentration of one aa = Imperial College Molar conc cal aa.JPG = 1.66x10-5mM
  • Translation rate = 20aa/s = (20 x 1.66x10-5 x 60)mM/min = 0.020mM/min
  • BDH2 comprises of 256aa[http://www.uniprot.org/uniprot/Q2PEN2&format=html]
    • ∴concentration of BDH2's aa in the volume of an E.coli= 1.66x10-5mM x 256 = 4.25x10-3mM
  • ∴ Rate of protein production = 0.020 ÷ 4.25x10-3 = 4.7/min

3.Protein production rate for PhaB and PhaC, k3

  • Relative promoter strengths: J23104 = 1.3RPU, J23101 = 1.0RPU.
    • ∴ 104 is 1.3x stronger than 101.
  • In absolute units: take GFP synthesis rate (molecules per min per cell) and approximate that as a generic protein synthesis rate for the promoter.
    • GFP synthesis rate of 101 = 2232 molecules per min per cell.
    • ∴ GFP synthesis rate of 104 = 1.3 x 2232 = 2902 molecules per min per cell
  • Assume 1 molecule in an E.coli cell gives a concentration of 1nM.
    • ∴ GFP synthesis rate of 104 = 2902 x 1nM = 2.9x10-6nM/min per cell
  • Plasmid copy number assumed as 200 (as in derivation 1)
    • ∴ GFP synthesis rate of 104 in our E.coli = 200 x 2.9x10-6 = 0.00058nM/min = 0.58mM/min

1.4 Enzyme kinetics

BDH2 (3-hydroxybutyrate dehydrogenase)

Reaction R1: Imperial College R1.JPG

Reaction R1r: Imperial College R1r.JPG

Values, sources and assumptions
Parameter Description Value Units Sources Assumptions
kcat,BDH2_f Turnover number of BDH2 in forward reaction 22200 1/min [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
kcat,BDH2_r Turnover number of BDH2 in reverse reaction 7200 1/min [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
Ki,NAD+ Inhibition constant of BDH2 with NAD+ 2.5 mM
Ki,NADH Inhibition constant of BDH2 with NADH 1.1 mM
Km,AcAc Michaelis constant for AcAc 0.37 mM [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
Km,NAD+ Michaelis constant for NAD+ 0.24 mM [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
Km,NADH Michaelis constant for NADH 0.010 mM [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
Km,3HB Michaelis constant for 3HB 0.80 mM [http://jb.oxfordjournals.org/content/early/2009/01/03/jb.mvn186.full.pdf]
[BDH2] Concentration of BDH2 - mM
[NAD+] Concentration of NAD+ 1.6x10-13 mM
[3HB] Concentration of 3HB initial: 0.0010 mM
[AcAc] Concentration of AcAc 1.0x10-13 mM
[NADH] Concentration of NADH 2.5x10-14 mM

atoAD (Acetyl-CoA:acetoacetyl-CoA transferase (α and β subunits))

Reaction R2: Imperial College R2.JPG

Reaction R2r: Imperial College R2r.JPG

Values, sources and assumptions
Parameter Description Value Units Sources Assumptions
Vmax,atoAD_f Maximum rate of atoAD in forward reaction 0.00244 mM/min [http://www.sciencedirect.com/science/article/pii/000398617590003X]
Vmax,atoAD_r Maximum rate of atoAD in reverse reaction 0.0108 mM/min [http://www.sciencedirect.com/science/article/pii/000398617590003X]
Km,AcAc Michaelis constant for AcAc 1.86 mM
Km,Ac-CoA Michaelis constant for Ac-CoA 0.26 mM
Km,Acetate Michaelis constant for Acetate 53.1 mM
Km,AcAc-CoA Michaelis constant for AcAc-CoA 0.035 mM
[AcAc] Concentration of AcAc 1.0x10-13 mM
[Acetate] Concentration of Acetate 1.0x10-13 mM
[AcAc-CoA] Concentration of AcAc-CoA 1.0x10-13 mM

phaB (Acetoacetyl-CoA reductase)

Reaction R3: Imperial College R3.JPG

Reaction R3r:Imperial College R3r.JPG

Values, sources and assumptions
Parameter Description Value Units Sources Assumptions
kcat,PhaB_f Turnover number of PhaB in forward reaction 6120 1/min [http://www.ncbi.nlm.nih.gov/pubmed/23913421]
kcat,PhaB_r Turnover number of PhaB in reverse reaction 3600 1/min [http://www.ncbi.nlm.nih.gov/pubmed/3286259]
Km,NADPH Michaelis constant for NADPH 0.15 mM
Km,AcAc-CoA Michaelis constant for AcAc-CoA 0.0057 mM
Km,NADP+ Michaelis constant for NADP+ 0.0060 mM
Km,3HB-CoA Michaelis constant for 3HB-CoA 0.026 mM
[PhaB] Concentration of PhaB - mM
[AcAc-CoA] Concentration of AcAc-CoA 1.0x10-13 mM
[NADPH] Concentration of NADPH 3.8x10-14 mM
[NADP+] Concentration of NADP+ 1.5x10-13 mM
[3HB-CoA] Concentration of 3HB-CoA - mM

phaC (P(3HB) synthase)

Reaction R4: Imperial College R4.JPG

Values, sources and assumptions
Parameter Description Value Units Sources Assumptions
kcat,PhaC Turnover number of PhaC 1680 1/min [http://ac.els-cdn.com/S0003986101925226/1-s2.0-S0003986101925226-]
Km,PhaC Michaelis constant of PhaC with 3HB-CoA 0.14 mM
[PhaC] Concentration of PhaC - mM
[3HB-CoA] Concentration of 3HB-CoA - mM

atoB (acetyl-CoA acetyltransferase)

Reaction R5: Imperial College R5.JPG

Reaction R5r:Imperial College R5r.JPG

Values, sources and assumptions
Parameter Description Value Units Sources Assumptions
Vmax,atoB_f Maximum rate of atoB in forward reaction 3.8x10-5 mM/min [http://www.ncbi.nlm.nih.gov/pubmed/9904]
Vmax,atoB_r Maximum rate of atoB in reverse reaction 8.5x10-4 mM/min [http://www.ncbi.nlm.nih.gov/pubmed/9904]
Km,atoB Michaelis constant of atoB with Ac-CoA 0.47 mM
Km,AcAc-CoA Michaelis constant for AcAc-CoA 0.47 mM
Km,CoA Michaelis constant for CoA 0.25 mM
[Ac-CoA] Concentration of Ac-CoA 1.0x10-13 mM
[AcAc-CoA] Concentration of AcAc-CoA 1.0x10-13 mM
[CoA] Concentration of CoA 5.5x10-13 mM

Derivations

blablabla

1.5 Simulation results

P(3HB) production

1.6 Model-guided design and optimisation

Sensitivity analysis: species concentrations

What is sensitivity analysis and why do it?

In order to look at how we could increase the production of P(3HB) we decided to run a sensitivity analysis (also in Simbiology) to identify what species in the model P(3HB) is sensitive to, given the specific conditions with which we set the model. In other words, we calculated the time-dependent sensitivity of P(3HB) with respect to the initial conditions of other species (species formed along the synthesis pathway and enzymes involved).[http://www.mathworks.co.uk/help/simbio/ug/calculating-sensitivities.html#brbumlr|ref]

For a species x, whose concentration depends on time, it can be expressed as x(t). To calculate the sensitivity of x(t) with respect to another species y(t), the sensitivity with normalisation relative to the numerator x(t) can be calculated as:

Imperial College Sensitivity halfnorm.JPG


Therefore, the underlying algorithm for this sensitivity analysis of P(3HB) is:

Imperial College Sensitivity halfnorm custom.JPG

Imperial College Half-normalised species.JPG

Scan with different levels of PhaB

The plot below is to show that increasing PhaB concentration within the engineered organism would have a positive effect on the concentration of the P(3HB) synthesised. As so many parameters within the model were taken from different sources, it would be difficult to give a simulation plot that is accurate quantitatively. It was decided to show the single cell simulation for this because the scans were carried out up to the doubling time of 20mins, hence avoided the issue of scaling-up which would have otherwise subjected the simulation to more errors. Therefore, this plot should be interpreted from a qualitative perspective and the trend should be observed.

Imperial College PhaB scan Single cellmM.JPG

Difference between promoter expressions after optimisation

1.7 Metabolic considerations

In our Module 1: Resourceful Plastic, we uses glucose as the product from degradation to feed in the system where P3HB is produced. The synthetic pathway needs to be reconsidered if we are using glucose as a solo input to the system. Here, 3HB monomer is no longer the source so BDH2 should be removed from the pathway. Acetyl-coA becomes the key resource to produce P3HB. A metabolic model is needed to show the production of Acetyl-coA from glucose. Furthermore, our synthetic pathway involved several key metabolites from the pathway such as NADPH, NADP+, NADH and NAD+. The initial concentration of those metabolites can be determined from the metabolic model by assuming they are in their steady states. More features and results of the metabolic model can be found in our Module 2.

Initial concentrations of metabolites

The metabolic model involves two pathways, Glycolysis pathway and TCA cycle. Where glucose is used as the single source of carbon. The reason is that Glucose is directly taken by Glycolysis pathway and there are some interactions between Acetyl-coA and TCA cycle. The model is based on original metabolic model by Angela Dixon in 2011. The metabolic model is built in MATLAB Simbiology extension as well. All reactions and pathways are based on ODEs and kinetic data. The model can dynamically predict the concentration of all metabolites involved by a defined duration.

Production of P3HB with glucose as the only source


<p>Synthesis model scaled up and what that means for industrial implementation and MAPLE.

2 Polyurethane (PUR) Degradation

Both efficiencies of Polyurethane (PUR) degradation and ethylene glycol production are important for the performance of MAPLE system. We built a mathematical and deterministic model based on MATLAB extension Simbiology for Polyurethane degradation. The model contains the kinetic property of degradation enzymes that is helpful for the design of assays. As we scaled up the initial concentrations of all substrates to meet the conditions for a bio-reactor, the model can provide preliminary simulations and predictions for the MAPLE system.

2.1 Objectives of the model

Here are some specific objectives for the model to achieve:

1. The model should contain the gene expression model of the degradation enzymes because the enzyme concentration determines the rate of plastic degradation. In our case for PUR degradation, we used [http://parts.igem.org/Part:BBa_K206000 pBAD strong promoter K206000] for most enzymes. We built the gene expression model based on inducible pBAD promoter, which gene expression rate can be regulated by inducer concentration.

2. The model should show the efficiency of the enzyme secretion to the culture from the cells. It's also important because the enzyme concentration in the culture depends on it. Here we used pelB secretion tag for most enzymes in order to achieve a high efficiency.

3. The model basically predict how long will take to degrade a known concentration of soluble polyurethane. It is assumed that the enzyme in our assays has the same kinetic properties as the enzyme used in the literature. The model can suggest a suitable concentration of the plastic to use in order to get good results from the assays.

4. It is known that ethylene glycol is toxic to E.coli. However, it has no clear effect on the growth of our MG1655 strain when the concentration of ethylene glycol is below 200mM. Therefore, the model should suggest a safe range of PUR concentration to avoid a high concentration (>200mM) of ethylene glycol produced.

Assembling the optimised bioplastic producing operon

We made two new improved constructs by modifying the native operon:

The modellers in the drylab predicted that an increased level of phaB enzyme will increase the amount of PHB produced and therefore we decided to change the native Ralstonia eutropha promoter and RBS to a strong constitutive E.coli promoter (J23104) and RBS (0034) in front of the operon. We have succeeded with the swap and built the new biobrick [http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052] which we refer to as constitutive phaCAB. In parallel, we have also assembled a different configuration of transcription initiation region: the "hybrid". Surprisingly, our results show that our "hybrid" phaCAB construct [http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051] significantly increased bioplastic production compared to native phaCAB. Please read on to discover more.

We tested the promoter and RBS we were going to use by cloning them in front of amilCP blue chromoprotein ([http://parts.igem.org/Part:BBa_K1149020 BBa_K1149020]). It was bright blue and we had some fun playing around with it as part of our communication work "E.coli_Art E.coliArt".
PlasticityBluePlate.JPG

In order to change the promoter, we designed a forward primer that binds to the beginning of the first gene in the operon and contains a Xba restriction site: Pha_Fw (cgcttctagagatggctactgggaaaggagccg). We used pha_Fw and the suffix primer G1005 primer pain to amplify the insert out of the backbone. The new promoter and RBS were J23104 and B0034 from the biobrick [http://parts.igem.org/Part:BBa_K608002 BBa_K608002] We digested the pSB1C3 backbone with this biobrick with SpeI and PstI.

Summary diagram of construction steps:

PSB1C3_-_BBa_K934001_newCAB.png

We performed DpnI digest on the gel purified PCR product (insert) in order to get rid of any contamination from the original plasmid. We did Alkaline Phosphatase treatment of the backbone to remove terminal phosphates in order to decrease self-ligation of plasmid. We transformed the ligation into NEB5 cells and we grew overnight cultures from single cell colonies. The next day, we purified the plasmids and digested 200 ng of them with Xba and PstI to screen for the right clones:

22-09-phaCABdigest.JPG

Colony #8 had the expected 4.2kB insert and therefore we sent this plasmid for sequencing. After having the sequenced it, we submitted the new part to registry as [http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051]. At the sequencing step, we realised that it has double P+RBS since the native P+RBS stayed there in between the new P+RBS and the operon. Anyhow, this hybrid configuration should increase the amount of protein products from the genes in the operon and we are in the process characterizing and testing our new construct. We have identified a clone (from colony #6) that contains the new constitutive promoter and submitted it as [http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052] biobrick. We are testing both the hybrid and normal constitutive constructs for PHB bioplastic production.


Partial sequence of the constitutive phaCAB construct ([http://parts.igem.org/Part:BBa_K1149052 BBa_K1149052]):

Constitutive_phaCAB.jpg

Partial sequence of the hybrid phaCAB construct ([http://parts.igem.org/Part:BBa_K1149051 BBa_K1149051]):

Hybrid_phaCAB.jpg

Our chassis (MG1655) survives in mixed waste [CLICK TO EXPAND]

These assays were designed to test whether our chassis, E.coli (MG1655) could grow directly with waste over a long period of time.

Waste media

LB-waste assay(A) Waste media (B) E.coli containing mCherry stress biosensor (BBa_K639003) were grown in mixed waste (A) over 3 days, then streaked in a qualitative assay to check for growth. (C) mCherry stress biosensor (BBa_K639003) transformed E.coli were streaked again after 7 days growth in SRF. Figure made by Imperial College London 2013 iGEM.
PBS-waste assay(A) waste media made up in PBS (phosphate buffered saline). (B) E. coli expressing mCherry stress biosensor (BBa_K639003) grown in waste media (A) over 3 days, then streaked onto an antibiotic containing plate to qualitatively assess whether the E.coli had survived. (C) Streaked again after 6 days growth in SRF. Figure made by Imperial College London 2013 iGEM.

Conclusion: MG1655 E.coli are viable and grow on mixed waste alone. Therefore we have established that our chassis could survive in a mixed waste bio-reactor context, which is validation of our concept to industrially implement our system.


Waste conditioned media

These assays were designed to test whether our chassis, E.coli MG1655 strain could grow with waste conditioned media (WCM) over a period of 24-48 hours. Waste conditioned media is a filter sterilised version of the waste media and was designed for several reasons; Firstly we were unsure whether mixed waste would be toxic to E.coli and hence a less concentrated version may be more suitable and secondly large chunks of waste would prevent accurate OD600 measurements and therefore we decided to filter out the largest chunks.

Photograph of waste conditioned media cultures mCherry stress biosensor (BBa_K639003) transformed MG1655 were grown with LB-WCM at 37ºC, with shaking for 48 hours. Figure made by Imperial College London 2013 iGEM.
Growth assay in waste conditioned media (WCM).E.coli MG1655 strain transformed with [http://parts.igem.org/Part:BBa_K639003 mCherry stress biosensor.] were grown with LB-based waste conditioned media at 37ºC, with shaking. Error bars represent S.E.M., n=4. Figure made by Imperial College London 2013 iGEM.
Growth assay in waste conditioned media (WCM). E.coli MG1655 strain transformed with either empty vector control (EV) or mCherry stress biosensor (BBa_K639003) were grown in WCM for 5 hours, with shaking at 37ºC. Error bars are SEM, n=4. Figure made by Imperial College London 2013 iGEM.


Conclusion: MG1655 transformed with either empty vector (EV) control or mCherry stress biosensor (BBa_K639003) vector are viable and can grow in waste conditioned media. Therefore waste conditioned media is an appropriate and novel experimental media with which to characterise biobricks within a mixed waste/landfill context. These data are also characterisation of an existing biobrick (BBa_K639003)

Mixed waste degradation: Polyurethane (PUR) [CLICK TO EXPAND]

PUR Esterase enzyme activity

Cell lysate assay

Since the PUR Esterases were not secreted, initially the cells were lysed to obtain crude cell extracts in order to test whether the enzymes are active. The Western Blot results showed that the constructs EstC2 [http://parts.igem.org/Part:BBa_K1149002 BBa_K1149002], PueB [http://parts.igem.org/Part:BBa_K1149004 BBa_K1149004] and PulA [http://parts.igem.org/Part:BBa_K1149006 BBa_K1149006] were being expressed. The cultures expressing these three constructs were grown, lysed by sonication and utilised in a colourimetric assay with the substrate analog para-Nitrophenyl butyrate. The data shows that PUR Esterase EstC2 [http://parts.igem.org/Part:BBa_K1149002 BBa_K1149002] is definitely active.

para-Nitrophenyl butyrate (p-NP) is commonly used to indicate an enzyme’s esterase activity. The enzyme cleaves the ester bond and releases the 4-nitrophenol (4-NP), thus causing a colour change from colourless to yellow and an increased absorbance at wavelength 405 nm.



para-Nitrophenyl butyrate is cleaved by Esterases to release 4-Nitrophenol. This is accompanied by an increase in absorbance at 405 nm. Figure adapted from TU Darmstadt 2012 iGEM




The assay was run in the [http://www.eppendorf.com/int/index.php?sitemap=2.1&action=products&contentid=1&catalognode=87236 Eppendorf BioSpectrometer] was used to automatically read the absorbance of the reaction mixture every 30 seconds. The concentration of 4-Nitrophenol produced from the reaction was calculated using the Beer-Lambert Law; the extinction coefficient of 4-NP is 18,000 M-1 cm-1 at 405 nm. [1]

The results below show the concentration of 4-NP produced by the three different PUR esterases and compare them to the Empty Vector and Substrate alone as negative controls.


The increase in absorbance that accompanies the cleavage of para-Nitrophenyl butyrate by PUR Esterase EstC2. Figure by Imperial College London iGEM 2013
The concentration of 4-Nitrophenol released by PUR Esterase EstC2 activity. Empty Vector and Substrate alone were used as negative controls. Figure by Imperial College London iGEM 2013

The above graphs clearly show that PUR Esterase EstC2 is active and cleaving p-NP. The recorded concentrations of 4-NP, in the presence of this PUR Esterase, are much greater than with the Empty Vector or the Substrate alone. Is PUR Esterase EstC2 active? Yes!



The enzyme activity of PUR Esterase PueB. The graph shows the concentration of the 4-Nitrophenol released during 10 minutes incubation of para-Nitrophenyl butyrate with PueB and Empty Vector, as well as the p-NP substrate by itself. Figure made by Imperial College London 2013 iGEM
The enzyme activity of PUR Esterase PulA. The graph shows the concentration of the 4-Nitrophenol released during 10 minutes incubation of para-Nitrophenyl butyrate with PulA and Empty Vector, as well as the p-NP substrate by itself.Figure made by imperial College London 2013 iGEM



The enzymes expressed by both PueB and PulA do not appear to have esterase activity for this substrate. There is a tiny increase in 4-NP concentration for PueB, PulA, Empty Vector and Substrate alone. This probably indicates that the substrate is slowly degrading by itself. Other constituents of the cell lysates are likely to be causing a slight increase in p-NP degradation, as PueB, PulA and Empty Vector show higher concentrations of 4-NP than the Substrate alone.


Conclusion: PUR Esterase EstC2 is active!</p>

Purified enzyme assay

<b>Stay tuned

Mixed waste degradation: Toxicity [CLICK TO EXPAND]

Ethylene glycol

Ethylene glycol in LB with Stress Response cells. MG1655 were grown in ethylene glycol, a byproduct of polyurethane degradation. Cells were grown in 0mM, 100mM or 200mM Ethylene Glycol. At 37°C, the concentrations of ethylene glycol used do not affect growth, however at 30°C, the increasing concentration results in halved growth. A two-tailed t-test addressing the null hypothesis, temperature does not affect growth with ethylene glycol shows that the null hypothesis must be rejected as p = 0.001. Data points show final time point after 6h growth for each concentration. Growth was at 37°C and 30°C with shaking over 6h. Error bars are SEM, n=4. Figure made by Imperial College London 2013 iGEM.

Reduced growth at 30°C likely due to decreased efficiency of MG1655 ethylene glycol break down enzymes. These enzymes (see UC Davis 2012) are endogenously expressed and detoxify Ethylene Glycol.

Bioplastic production [CLICK TO EXPAND]

<p align="justify">E.coliMG1655 containing the PhaCAB construct accumulates the bioplastic P3HB inside its cells. P3HB can be visualised through staining with Nile Red, which fluoresces strongly in a hydrophobic environment, such as when it binds to the P3HB. However staining will be much lower in cells where P3HB is not present. To see whether P3HB was being produced we grew E.coli containing the phaCAB operon under the native promoter from Ralstonia eutropha. This produced the results we hoped for as seen in the image below.

This also provides a preliminary qualitative way in which to investigate the effect of changing the promoter to a stronger version in order to upregulate the amount of P3HB produced. The darker staining of the streaks of the constitutive and hybrid promoter containing constructs suggests the production of higher levels of P3HB in these strains.


E.coli transformed with the phaCAB operon(native, hybrid, constitutive - different promoters expressing the operon) fluoresce when grown on LB-Agar plates with Nile Red stain as the P3HB produced within them is stained. Those without the operon do not(EV- transformed with empty vector). When the promoter is changed from the native form to the our hybrid or the constitutive J23104 then the fluorescence is more intense, suggesting more P3HB is created.

Streaking the bacteria on Nile Red plates cannot be used to accurately decide the difference between P3HB production due to the effect differing thicknesses of cell layers will have on fluorescence intensity. We imaged the cells using the fluorescent microscope to qualitatively understand how much P3HB is produced per cell. As indicated by other authors, we saw that P3HB is found in localised granules within the bacteria. Empty vector containing cells show little fluorescence. In those that do, the staining is qualitatively different than in the phaCAB containing strains. Nile Red is also used as a lipid stain and this is indicated by its staining of the membranes of EV cells. In contrast, in phaCAB containing cells, staining is restricted to points within the cells.

Each fluorescent image was created by exciting the stain at 530nm for 100ms. Despite this standard treatment of samples the intensity of fluorescence produced by the cells containing the hybrid promoter is greater than from the constitutive ones. This could indicate a difference in the strength of the promoters which lead to phaCAB expression and therefore the amount of P3HB produced. The images also suggest that not every single E.coli is stained. This may be due to the conditions in which the cells were grown or may be dependent upon the stage in the lifecycle of the E.coli.


Fluorescent microscope images of E.coli stained with Nile Red. 1 -Empty vector, 2 - constitutive promoter phaCAB, 3 - hybrid promoter phaCAB. Images labelled a are fluorescent images excited at 530nm ovelaid on the bright field images shown in the b set of images. Images by Imperial College iGEM Team
A comparison between the amount of plastic produced by bacteria containing an empty plasmid(EV), native promoter-phaCAB and hybrid promoter-phaCAB after plastic extraction. The EV does not produce P3HB while the hybrid produces much more than the native promoter.

Optimisation of bioplastic production [CLICK TO EXPAND]

A summary of the improved production of P3HB by our hybrid promoter-phaCAB construct(BBa_K1149051) over the native promoter-phaCAB.
Comparison of P3HB production (left) 1.5ml tube, 90mg produced by native promoter-phaCAB (BBa_K934001), (right) 5ml tube, hybrid promoter-phaCAB produced 2.05g P3HB, (BBa_K1149051).


Bioplastic from mixed waste [CLICK TO EXPAND]

3HB Assay: Confirming production of 3HB

The chemical analysis of the produced bioplastic. The samples break break down to 3HB monomers after treatment with our PhaZ1 enzyme (BBa_K1149010). We synthesised P(3HB) using our improved Biobrick part (hybrid promoter phaCAB, BBa_K1149051). Our engineered bioplastic producing E.coli synthesised P(3HB) directly from waste. Imperial iGEM data

Extras [CLICK TO EXPAND]

Growth assays with different experimental media

In additional to standard LB and minimal media, several novel experimental media were developed in order to characterise Biobricks within a mixed waste/landfill setting. These media were characterised through an examination of pH and through an array of growth assays with the project chassis, E.coli MG1655 strain.

Media characterisation. E.coli strain MG1655 were transformed with a control plasmid and grown in different experimental media over a period of 5 hours. LB media, minimal media (M9M), supplemented minimal media (M9S), as described here or waste conditioned media (WCM), which is made from sterile filtrated mixed waste, see here. OD600 measured, error bars are S.E.M., n=4. Figure made by Imperial College London 2013 iGEM.
pH of experimental media. pH measurements of experimental media were made both before and after several experiments. The time periods refer to the duration MG1655 transformed E.coliwere cultured in the media before a pH measurement was made. Figure made by Imperial College London 2013 iGEM.

Conclusion: E.coli strain are viable and grow in all of our experimental medias. We have established a novel media that is optimised for characterisation of biobricks within a mixed waste/landfill context.

Protocols [CLICK TO EXPAND]
Content
Safety [CLICK TO EXPAND]

Safety

Dimethyl Sulfoxide(DMSO)

It has known carcinogenic effects and can permeate your skin, carrying other chemicals with it. Handle in a fume cupboard, wearing nitrile gloves and goggles.

       </ol>

Content 2

  1. ANDERSON A, DAWES E. Occurrence, Metabolism, Metabolic Role, and Industrial Uses of Bacterial Polyhydroxyalkanoates. Microbiol Rev 1990 DEC;54(4):450-472.
  2. Harding KG, Dennis JS, von Blottnitz H, Harrison STL. Environmental analysis of plastic production processes: Comparing petroleum-based polypropylene and polyethylene with biologically-based poly-beta-hydroxybutyric acid using life cycle analysis. J Biotechnol 2007 MAY 31;130(1):57-66.
  3. Kim S, Dale BE. Energy and Greenhouse Gas Profiles of Polyhydroxybutyrates Derived from Corn Grain: A Life Cycle Perspective. Environ Sci Technol 2008 OCT 15;42(20):7690-7695.
  4. Jendrossek D, Handrick R. Microbial degradation of polyhydroxyalkanoates. Annu Rev Microbiol 2002;56:403-432.
  5. Philip S, Keshavarz T, Roy I. Polyhydroxyalkanoates: biodegradable polymers with a range of applications. Journal of Chemical Technology and Biotechnology 2007 MAR;82(3):233-247.

Our Sponsors

TueSponsorsEppendorf.png 125px Invitrogen.jpg Geneart.jpg CSynBI.JPG

Retrieved from "http://2013.igem.org/Team:Imperial_College/Waste_Degradation:_SRF"