"
Team:Freiburg/Project/effector
From 2013.igem.org
Effectors
modulating dCas9
We engineered a backbone for a DNA binding protein, by using the CRISPR/Cas9 system that is relying on a protein-RNA-DNA interaction. For this we used a catalytically inactive Cas9, the dCas9.
As we wanted to manipulate gene expression with our system we fused different effector domains to the dCas9. By doing so we created proteins that are able to stimulate, repress and alter the epigenetic state of genes.
A main feature of our uniCAS system is the so-called RNAimer, a plasmid coding for the required RNAs. To highlight the specificity of our system we conducted always experiments with an off-target control. here, the fusion protein is led to a locus that is not related to our test locus.
Activation
Introduction
The aim of this subproject was to engineer a new form of activation system based on a CRISPR RNA (crRNA)-guided dCas9-VP16 fusion protein which is able to activate gene expression of a reporter construct.
Therefore, we used our double mutated Cas9 (BBa_K1150000) impaired in its cleavage activity and fused it to the 5’ end of the sequence coding for the transactivation domain of VP16 (BBa_K1150001). To ensure nuclear localization of the whole expressed construct a nuclear localization signal (NLS) was fused to the 5’ end of Cas9-VP16. For detection of protein expression the whole construct was tagged with a HA-epitope coding sequence (BBaa_K1150016) and its expression was set under control of the SV40/CMV promoter (BBa_K1150011/BBa_K747096) and BGH terminator (BBa_K1150012). Figure 1 illustrates the detailed design of the whole device.
 |
| Figure 1: Design of the dCas9-VP16 fusion constuct. Cas9 was fused via a 3 amino acid linker to VP16. The resulting fusion protein was flanked by NLS sequences and tagged by a HA epitope. The SV40/CMV promoter and BGH terminator were chosen to control gene expression. BBa_K1150019 is set under the control of the SV40 promoter, BBa_K1150020 is under the control of the CMV promoter. |
The Virus Protein 16 (VP16) is a transcription factor of Herpes simplex virus-1.
Through complex formation with cellular host factors VP16 can bind to a common regulatory element in the upstream promoter region of immediate-early genes [1] . Through the transactivating function of VP-16 the expression of these genes will be enhanced.
VP16 consists of 490 amino acids with two important functional domains: a core domain in its central region which is necessary for the indirect DNA binding and a carboxy-terminal transactivation domain [2] [3] . The transactivation domain of VP16 can be fused to a DNA-binding domain of another protein in order to increase expression of a desired target gene [4] .
Mechanism
By co-transfecting our RNA plasmid (BBa_K1150034) which includes the tracrRNA and the separately integrated, desired crRNA, the Cas9 specifically binds to the targeted DNA sequence. With the help of the transactivation domain of VP16, transcription factors are recruited and the pre-initiation complex can be built. By targeting this construct upstream of a promoter region any gene of interest can be activated.
| Figure 2: Principle of transactivation of mammalian gene expression by the fusion protein Cas9-VP16 The double mutated Cas9 (D10A; H840A) fused to the herpes simplex virus (HSV) derived VP16 activation domain can serve as a crRNA-guided DNA-binding and transactivating protein. If a PAM sequence is present at the 5’ end of the crRNA binding site almost any DNA sequence can be targeted. |
Experimental setup
For testing this device we used HEK-293T cells, which were seeded at a densitiy of 65,000 cells/well in 24-well plates. After 24 hours RNA plasmids targeted against the indicated loci and the referring reporter plasmids containing the gene coding for a secreted alkaline phosphatase (SEAP) under the control of a CMV minimal promoter were co-transfected to this device. 48 hours post transfection the activity of SEAP in the cell culture medium was measured as well as the luciferase Renilla as an internal standard to eliminate variabilities of protein expression levels caused by the expression of the transfected plasmids. Additionally, the Cas9-VP16 expression was assessed by Western blot analysis of cell lysates. Different crRNAs were tested and compared for their activation properties of the referring reporter plasmid.
Our controls were the following:
pRSet is a vector containing junk DNA and is transfected in the same DNA amount as the probes. As our negative control it reflects the basic SEAP level production in the absence of any activator protein.
Cas-VP16 driven by a SV40/CMV promoter transfected without any crRNA is the off-target control. As Cas-VP16 should only bind to the target locus in combination with the related crRNA no increase in the SEAP production should be visible in comparison to the pRSet control. This was observed so no off-target effects exist.
Results
With the Cas9-VP16 fusion protein different target loci have been tested by the usage of a SEAP reporter plasmid with a minimal CMV promoter (pKM602). The target sites can be determined by directing the crRNA consisting of 30 bp length against the desired sequence of interest. 4 Target sites with different distances to the promoter were tested (Figure 3 and Table 1).
We used two different promoters to drive the Cas9-VP16 expression: The SV40 promoter for a moderate level of Cas9-VP16 (BBa_K1150019) and the CMV promoter for a high level of our effector fusion protein (BBa_K1150020).
 |
| Figure 3: Position of the target loci on the SEAP plasmid pKM602. The tested target loci are located in front of the SEAP promoter. Several distances and combinations of the related crRNAs were tested. |
|
Table 1: Overview of the tested crRNAs directed against different sites on the SEAP plasmid. RNA plasmids containing the crRNA EMXI, T2, T3 and T4 were transfected in combination with the activator Cas-VP16. These RNAs target different loci on the SEAP plasmid. The crRNA sequences, their promoter distance and their binding site on the SEAP plasmid are displayed. |
|||
| Name | Distance to promoter | Sequence | GC content [%] |
|---|---|---|---|
| EMX1 | | GGAAGGGCCTGAGTCCGAGCAGAAGAAGAA | |
| T2 | | AAGCATTTATCAGGGTTATTGTCTCATGAG | |
| T3 | | AATGCCGCAAAAAAGGGAATAAGGGCGACA | |
| T4 | | GACCGAGTTGCTCTTGCCCGGCGTCAATAC | |
By targeting EMXI and T2 with dCas9-VP16 driven by a SV40 promoter we gained 3 to 10 fold induction of SEAP expression (Figure 4). When we used these targets simultaneously a 17 fold activation could be achieved.
 |
| Figure 4: Results of the SEAP activation with Cas-VP16 under control of the SV40 promoter using different crRNAs. To quantify the activation properties of Cas9-VP16 the amount of SEAP expression was measured and divided through the expression level of the luciferase Renilla (internal standard). Each sample was measured in biological triplicates. Bright green columns reflect the negative controls while dark green ones reflect the different probes. The fold induction above each column is related to the basic SEAP expression level of the pRSet (junk DNA) control. |
For the dCas9-VP16 construct under the CMV promoter the crRNA targets EMXI, T2, T3 and T4 alone has been tested as well as the combination of two targets T3 & T4 and EMXI & T2 (Figure 5). All targets lead to an activation of the SEAP expression in comparison to the off target control. When compared to the samples without dCas9-VP16 only T4 showed no activation, whereas EMXI crRNA worked best for single target activation with a 11 fold induction. So T2 (BBa_K1150035) and EMXI (BBa_K1150040) proved as powerful activation sites.
By simultaniously using the EMXI and T2 loci the highest SEAP production could be determined (29 fold induction) (Figure 5).
 |
| Figure 5: Results of the SEAP activation with Cas-VP16 under control of the CMV promoter using different crRNAs. To quantify the activation properties of Cas9-VP16 the amount of SEAP expression was measured and divided through the expression level of the luciferase Renilla (internal standard). Each sample was measured in biological triplicates. Bright green columns reflect the negative controls while dark green ones reflect the different probes. The fold induction above each column is related to the basic SEAP expression level of the pRSet (junk DNA) control. T3+4 crRNAs are transcribed from one RNA plasmid while T3 & T4 crRNAs are transcribed from two independent RNA plasmids. |
Discussion
We were able to efficiently activate the expression of a reporter protein from a transfected plasmid (up to 29 fold). Different levels of this activation were achieved by targeting different loci upstream of the promoter of the reporter plasmid. The best results were gained by targeting two loci simultaneously.Very recently a 25 fold activation of transient GFP expression by dCas9-VP64 was shown by Gilbert et al. however in comparison to cells that were not transfected with a GFP plasmid [5]. So we were able to yield a higher effect of SEAP acitivation with dCas9-VP16.
With different promoters for dCas-VP16 the relations between the target sites were similar, but the activation of the SV40 driven dCas-VP16 was slightly weaker. So SV40:dCas-VP16 can be used to activate genes more moderately than with CMV:dCas-VP16.
Click here for detailed information about the target sites.
References
Epigenetics
Histone modification by dCas9-G9a
 |
| Figure 4: CMV:dCas9-G9a Cas9 was fused via a 3 amino acid linker to G9a. The resulting fusion protein was flanked by NLS sequences and tagged by a HA epitope. The CMV promoter and BGH terminator were chosen to control gene expression. BBa_K1150025 is set under the control of the SV40 promoter, BBa_K1150024 is under the control of the CMV promoter. |
Introduction
For organisms it is crucial to have a tight control over their transcriptional machinery. As every cell has basically the same genetic information, different tissues have to be formed by alter the expression of this information. One of the most prominent mechanisms that give rise to this differential expression of genes are epigenetic modifications. Epigenetics are, by definition, inheritable changes in gene expression, that are not accompanied by changes in the nucleotide sequence [7].
There are several types of epigenetic modifications that may have severe impact on gene expression [8]. Basically there are two main types of modifications. The first type are the chemical modification of cytosine residues of nucleotides, better known as DNA methylation. At so-called CpG islands, that can be found clustered in front of promoters the nucleotides can be altered by methylation. This methylation is a hallmark of repressive transcriptional states. But not only the DNA may be altered, but also the protein-nucleotide complex, called the chromatin, that forms the highly variable system that has massive impact on the differential regulation of expression. The probably most prominent epigenetic modifications are histone modifications.
Histones are proteins that work as multi-histone complexes and form a backbone for the DNA to be wound around. The termini of these nucleosomes are protruding from the histone core complex and can be targets for a lot of different modifications, which influence the chromatin state. One very prominent modification is methylation at lysine 9 of histone 3 (H3K9me) which renders before-open chromatin inactive. Such methylations are a hallmark of gene repression. One interesting fact about histone modification is the capability to spread the activity state over the surrounding chromatin via reader proteins. So the information of e.g. "repressed state" can, once specifically introduced, be propagated over a whole locus.
We engineered the uniCAS system to alter this system. By introducing specific histone modifications at several loci we should be able to regulate several genes at once. For this we fused a methyltransferase that is known to specifically perform certain histone tail methylations to dCas9.
For our device we used a part of the murine EHMT2 gene, the G9a. It is described in literature that, when targeted to an open locus via zinc finger proteins, G9a is able to repress expression of this locus [9].
We sought to test and improve the zinc finger system by fusing G9a to dCas9 and assayed the function as an epigenetic repressor. As a test subject we chose the VEGF locus, as it is
- well characterized
- easy to measure by ELISA methods
- VEGF is known to be involved in tumorgenesis and therefore an interesting target for future medical approaches
- HEK293T cells have an open VEGF locus, so we do not have to artificially open the locus, before testing the system
Results
HEK293T cells were seeded into 24-well plates and transfected with our constructs, that were targeted to open regions [10] of the VEGF locus.
 |
| Figure 3: Target sites on the VEGF locus. As the VEGF locus offers several accessible regions we chose four loci around the promoter. Arrows mark the regions. Numbers indicate position of the PAM sequence relative to the starting point of transcription. |
As a control that the repressive effect of our proteins is not based on the sterical block of the transcription, we tested against the catalytic inactive dCas9. So every detectable effect is due to the G9a targeted to this locus. [11] As we can see in the graph, we achieved a strong reduction in VEGF expression, especially when targeting the -8 and -573 loci. This is in line with literature results and plausible, when having in mind, that the promoter region is targeted and dense chromatin in promoters leads to repression.
 |
| Figure 4: Endogenous, stable repression by dCas9-G9a Chromatin remodeling, resulting in repression of endogenous genes, is possible by fusing the histone methyltransferase G9a to dCas9. (n=3, p<0.05 is marked by asterisks) |
Discussion
Our results obviously show a strong repression of VEGF expression around 50%, depending on the locus targeted. We can conclude from our results and literature data that we were able to specifically methylate histones and change the transcriptional state of the VEGF locus. Off-target controls do not display differences in VEGF expression, which indicates the specificity of our protein.
As we always show the difference to the dCas9 protein without effector. This leads to the point that we only observe the catalytic activity of G9a.
This results in a valuable repressor tool that is able to specifically change histone methylation patterns and can change transcriptional states. This leads to many possible applications such as cancer research, fundamental epigenetic science or even tissue engineering.
References
Repression
Transcriptional Repression via uniCAS-KRAB
Krüppel-associated Box (KRAB) repressor domains are highly conserved polypeptide motifs and were first functionally characterized in 1991 [1]. Their occurence in about one third of all human zinc finger transcription factors suggests key regulatory features in higher eukaryotic transcriptomics [2]. In terms of tetrapod evolution, the role of their great abundance has been extensively discussed [3]. Even though KRAB minimal domains are usually no longer than ~ 50-75 amino acids, their mechanism of function remains complex. Common biochemical models suggest a key role in epigenetic silencing, by recruiting a scaffold of diverse proteins to the zinc fingers‘ binding site - amongst others histone deacetylases and histone methyltransferases [4]. Til date, KRAB domains were attached to several DNA binding proteins such as lacR and tetR, thereby silencing gene expression downstream of designed reporter targets.
In this work, KRAB was fused to enzymatically inoperable dCas9. Thus, a transcriptional repressor with the flexibility to target almost any DNA sequence of interest was yielded. Transient SEAP expression could thus be reduced by almost 60 %. In a second attempt, CMV-driven expression of the signaling scaffold protein CNK1 was targeted over 36h - being partially knocked down to background amounts [5]. Furthermore, GFP reporter expression was shown to be drastically reduced by dCas9-KRAB in both Fluorescence Microscopy and Flow Cytometry data. Endogenous levels of VEGF-A, a key factor in hypoxic tumor angiogenesis [6], were also successfully reduced and quantified through an Enzyme-Linked Immunosorbent Assay.
References
