Team:NTU-Taida/Notebook/Journal

From 2013.igem.org

(Difference between revisions)
(→2)
Line 1: Line 1:
-
{{:Team:NTU-Taida/Templates/Header}}{{:Team:NTU-Taida/Templates/Navbar}}{{:Team:NTU-Taida/Templates/Sidebar-calendar|Title=Journal|Month=July}}{{:Team:NTU-Taida/Templates/ContentStart}}
+
{{:Team:NTU-Taida/Templates/Header}}{{:Team:NTU-Taida/Templates/Navbar}}{{:Team:NTU-Taida/Templates/ContentStart}}
-
=July=
 
-
= 7/1~7/5 =
 
-
Finish RhlR and LasR circuit.
 
-
 
-
==7/1==
 
-
 
-
===Transform:===
 
<html>
<html>
-
<ol>
+
<body class="preview" data-spy="scroll" data-target=".subnav" data-offset="180" style="padding-top:52px" >
 +
<section id="Slide" style="width:640px; margin:50px auto;">
 +
<div class="page-header">
 +
<h1>Calender</h1>
 +
</div>
 +
<div id="myCarousel" class="carousel slide">
 +
            <div class="carousel-inner">
 +
                <div class="item active">
 +
                    <img src="/wiki/images/2/2f/NTU-Taida-journal-May-1.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption" >
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/December">December</a></h4>
 +
<p>Recruited members and Started!</p>
 +
                    </div>
 +
                </div>
 +
                <div class="item">
 +
                    <img src="/wiki/images/c/c5/NTU-Taida-schedule-2.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/January">January</a></h4>
 +
<p>Design thinking working shop</p>
 +
                    </div>
 +
                </div>
 +
                <div class="item">
 +
                    <img src="/wiki/images/1/17/NTU-Taida-journal-May-2.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/February">February</a></h4>
 +
<p>Project presentation</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/5/5b/NTU-Taida-schedule-4.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/March">March</a></h4>
 +
<p>Spring days</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/9/94/NTU-Taida-journal-May-3.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/April">April</a></h4>
 +
<p>Midterm exams</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/2/25/NTU-Taida-schedule-6.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/May">May</a><h4>
 +
<p>Wiki meeting</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/3/32/NTU-Taida-schedule-7.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/June">June</a></h4>
 +
<p>Walking on a busy road</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/d/d2/NTU-Taida-schedule-8.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/July">July</a></h4>
 +
<p>Visit NTUH</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/d/d0/NTU-Taida-schedule-9.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/August">August</a></h4>
 +
<p>NCTU</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/a/a8/NTU-Taida-journal-May-4.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/September">September</a></h4>
 +
<p>Fighting!!!</p>
 +
                    </div>
 +
                </div>
 +
            </div>
 +
        </div> 
 +
        <div style="height: 100px">
 +
<ol class="carousel-indicators">
 +
                <li data-target="#myCarousel" data-slide-to="0" class="active">
 +
<img src="/wiki/images/2/2f/NTU-Taida-journal-May-1.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="1">
 +
<img src="/wiki/images/c/c5/NTU-Taida-schedule-2.jpg" width="50px" alt=""></li>
 +
                <li data-target="#myCarousel" data-slide-to="2">
 +
<img src="/wiki/images/1/17/NTU-Taida-journal-May-2.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="3">
 +
<img src="/wiki/images/5/5b/NTU-Taida-schedule-4.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="4">
 +
<img src="/wiki/images/9/94/NTU-Taida-journal-May-3.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="5">
 +
<img src="/wiki/images/2/25/NTU-Taida-schedule-6.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="6">
 +
<img src="/wiki/images/3/32/NTU-Taida-schedule-7.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="7">
 +
<img src="/wiki/images/d/d2/NTU-Taida-schedule-8.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="8">
 +
<img src="/wiki/images/d/d0/NTU-Taida-schedule-9.jpg" width="640px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="9">
 +
<img src="/wiki/images/a/a8/NTU-Taida-journal-May-4.jpg" width="50px" alt=""></li>
 +
            </ol>
 +
</div>
 +
</section>
 +
 +
<!-- Le javascript
 +
    ================================================== -->
 +
    <!-- Placed at the end of the document so the pages load faster -->
 +
    <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.9.1/jquery.min.js"></script>
 +
    <script src="js/jquery.smooth-scroll.min.js"></script>
 +
    <script src="js/bootstrap.min.js"></script>
 +
    <script src="js/bootswatch.js"></script>
 +
<script>//usermenu dropdown
 +
if ($('#pt-logout').length){
 +
// login
 +
$('#nav-login').text('User: ' + $('#pt-userpage').text()).append('<b class="caret"></b>');
 +
$('#nav-edit').attr('href',$('#menubar.left-menu > ul > li > a[href$="edit"]').attr('href'));
 +
$('#nav-history').attr('href',$('#menubar.left-menu > ul > li > a[href$="history"]').attr('href'));
 +
$('#nav-logout').attr('href',$('#pt-logout > a').attr('href'));
 +
$('.dropdown-toggle').dropdown();
 +
}else{
 +
// not login
 +
$('#nav-usermenu').remove();
 +
$('#nav-login').attr('href',$('#pt-login>a').attr('href')).removeAttr('data-toggle');
 +
}
-
<li>Positive feedback circuit:<br>
+
reactiveNavbar();
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;</li>
+
});
-
<li>Control: <br>
+
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;</li>
+
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
+
-
<li>New: <br>
+
-
Pcin, CinR (resistant=C)</li>
+
-
</ol>
+
 +
</script>
 +
</body>
</html>
</html>
-
 
-
==7/2==
 
-
===Result:===
 
-
There’s no colonies at plates of Pcin and CinR. 
 
-
===Transform:===
 
-
Pcin(resistant=A), CinR (resistant=K)
 
-
===Inoculation and incubation at LB broth===
 
-
<html>
 
-
<ol>
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control:</li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
</ol>
 
-
</html>
 
-
==7/3==
 
-
===Inoculation and incubation at LB broth===
 
-
Pcin(resistant=A), CinR (resistant=K)
 
-
===Check ===
 
-
<html>
 
-
<ol>
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control: </li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
</ol>
 
-
</html>
 
-
 
-
==7/4==
 
-
===Check and Plasmid DNA extraction (mini-prep):===
 
-
<html>
 
-
<ol>
 
-
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control:</li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
<li>Pcin(resistant=A), CinR (resistant=K)</li>
 
-
</ol></html>
 
-
[[File:NTU-Taida-journal-July-1.jpg|500px | thumb|center|]]
 
-
 
-
==7/5==
 
-
===Check: (for plasmid ready to be sequenced)===
 
-
ACB-4, ACE-5, ACG-1, DFB-1, DFE-2, DFE-3, DFE-4, DFE-5, DFG-1, RhlB-1, RhlE-2,  RhlG-1, RhlG-2, LasB3, LasE1, LasG4
 
-
(8,9,11 well failed :DFE-4/DFE-5/ RhlB-1)
 
-
 
-
 
-
[[File:NTU-Taida-journal-July-2.jpg|NTU-Taida-journal-July-2.jpg]]
 
-
 
-
= 7/8~7/12 =
 
-
Construct the circuit for new receptor CinR
 
-
==7/8==
 
-
===Sequence:===
 
-
ACB-4, ACE-5, ACG-1, DFB-1, DFE-2, DFE-3, DFG-1, RhlE-2, RhlG-1, RhlG-2, LasB3, LasE1, LasG4
 
-
===Primer list:===
 
-
<html>
 
-
<table>
 
-
<tr class="tableizer-firstrow"><th>Primer order</th><th>Name</th><th>sequence</th><th>&nbsp;</th></tr>
 
-
<tr><td>BMRC-120</td><td>iGEM2013-pSB1A2</td><td>attaccgcctttgagtgagc</td><td>R</td></tr>
 
-
<tr><td>BMRC-153</td><td>iGEM2013-pSB1A2</td><td>gtgccacctgacgtctaagaa</td><td>F</td></tr>
 
-
<tr><td>BMRC-122</td><td>iGEM2013-mCherry</td><td>gccgtcctcgaagttcatcac</td><td>mcherry</td></tr>
 
-
<tr><td>BMRC-124</td><td>iGEM2013-mRFP</td><td>aacggtaacaccaccgtc</td><td>RFP</td></tr>
 
-
<tr><td>BMRC-126</td><td>iGEM2013-GFP</td><td>cttgtagttcccgtcatcttt</td><td>GFP</td></tr>
 
-
</table>
 
-
</html>
 
-
===Digestion, ligation, transform: 3A assembly and standard assembly both===
 
-
 
-
B0030+CinR
 
-
 
-
==7/9==
 
-
 
-
===Result:===
 
-
The plate of B0030+CinR following 3A assembly was OK. The other following standard assembly failed unexpectedly.
 
-
===Inoculation and incubation:===
 
-
B0030+cinR
 
-
 
-
==7/10==
 
-
 
-
===Plasmid DNA extraction (mini-prep):===
 
-
B0030-cinR
 
-
===Result:===
 
-
A260/A280=1.3
 
-
===Re-inoculation and incubation of plate of B0030-CinR===
 
-
 
-
==7/11==
 
-
 
-
===Plasmid DNA extraction (mini-prep):==
 
-
B0030-cinR
 
-
===Result:===
 
-
A260/A280=1.3
 
-
 
-
==7/12==
 
-
===Digestion: standard assembly only:===
 
-
B0030 CinR
 
-
===Result:===
 
-
There’s no band for B0030
 
-
 
-
=7/15~7/19=
 
-
CinR, LuxR
 
-
==7/15==
 
-
===Ligation:===
 
-
B0030+CinR
 
-
(The certain content in the ependorf labeled B0030 undergone digestion was actually previously digested; thus, concentration was assumed to be low)
 
-
===Transform:===
 
-
B0030-CinR
 
-
pCI
 
-
CI
 
-
 
-
==7/16==
 
-
===Result:===
 
-
Only one colony of plate(B0030-CinR) grew.
 
-
CI are successfully incubated.
 
-
pCI failed to grow.
 
-
===Conclusion: ===
 
-
B0030 threw away.
 
-
 
-
==7/17==
 
-
===Digestion and ligation:===
 
-
B0030 (eppendorf from early stage)
 
-
===Transform:===
 
-
B0030-CinR
 
-
 
-
RBS(B0030)
 
-
 
-
pCI(R0051)
 
-
 
-
LuxR(C0062)
 
-
 
-
pLux(Lux pR, R0062)
 
-
 
-
pConst(J23119)
 
-
 
-
mTagBFP(K592100)
 
-
 
-
Luciferase(J52008)
 
-
 
-
simple Las detecting system(K575024)
 
-
 
-
simple Rhl detecting system(K575033)
 
-
 
-
===Sequence:===
 
-
PcDFE, PcDFG, Pc ACB, Rhl B, Rhl E
 
-
Total 16 tube
 
-
===Sequence results:===
 
-
No single plasmid was correct at all.
 
-
 
-
==7/18==
 
-
===Inoculation and Incubation at LB broth:===
 
-
B0030-CinR, B0030, LuxR, pLux, pConst(J23119), mTagBFP, Luciferase, simple Las detecting system(K575024), simple Rhl detecting system(K575033)
 
-
 
-
==7/19==
 
-
===Check and Plasmid DNA extraction (mini-prep):===
 
-
B0030-CinR, B0030, LuxR, pLux, pConst(J23119), mTagBFP, Luciferase, simple Las detecting system(K575024), simple Rhl detecting system(K575033)
 
-
 
-
[[File:NTU-Taida-journal-July-3.jpg]][[File:NTU-Taida-journal-July-4.jpg]]
 
-
 
-
=7/22~7/31=
 
-
Construct our circuit.
 
-
==7/22==
 
-
===Digestion:===
 
-
B0030, CI, mTagBFP, Luciferase, B0015(tt), pCin, ACin (RBS-CinR), BCin (RBS-CinR), B0030 (RBS), LuxR
 
-
 
-
''Note:Because the gel for electrophoresis healed since we took away the comb too early, most of the digestion products overflew from the wells. And we almost couldn’t see the band after dyeing, so we redid the digestion step. ''
 
-
''The second time we finally got our material for ligation!''
 
-
''But LuxR had very strange bands (too large), so we decided not use it. And retransformed it from official plasmid.''
 
-
 
-
===Ligation overnight at 16 degree incubator:===
 
-
(1) B0030+CI
 
-
 
-
(2) B0030+mTagBFP
 
-
 
-
(3) B0030+Luciferase
 
-
 
-
(4) B0030-CinR+tt
 
-
 
-
(5) pCin+B0030-CinR
 
-
 
-
===Transform:===
 
-
(1) pCI (Amp, Chl): to check the drug resistance was correct.
 
-
 
-
(2) LuR (Chl)
 
-
 
-
(3) pCin (Amp)
 
-
 
-
===Primer design and Sequence:===
 
-
Design primers for AbaR, pqsR.
 
-
 
-
Start checking sequencing results.
 
-
 
-
==7/23==
 
-
===Results:===
 
-
Transformation: All 4 plates didn’t grow
 
-
 
-
===Transform: ===
 
-
(1) B0030-CI (Amp)
 
-
 
-
(2) B0030-mTagBFP (Amp)
 
-
 
-
(3) B0030-Luciferase (Amp)
 
-
 
-
(4) [B0030-CinR]-tt (Amp)
 
-
 
-
(5) pCin-[B0030-CinR] (Amp)
 
-
 
-
(6)(7) pCI (Amp, Chl)
 
-
 
-
(8) pCin (Amp)
 
-
 
-
(9) LuxR (Chl) x2
 
-
 
-
===Original biobrick:===
 
-
(1) Got P.aeruginosa & A.baumannii (on blood agar plate)
 
-
 
-
(2) Each liquid culture x3 tubes
 
-
 
-
===Human practice:===
 
-
Visited the department of laboratory medicine in NTUH
 
-
 
-
==7/24==
 
-
===Result:===
 
-
(1) Transformation: all 10 plates didn’t growth…
 
-
 
-
(2) Debug: We took the wrong competent cell(HB101)…
 
-
 
-
(3) Sequencing: for functional assay, only the positive feedback of RhlR-GFP (ACE) was all correct. Others need to be redone.
 
-
 
-
===Ligation at room temperature for 3 hours:===
 
-
(1) B0030-CI
 
-
 
-
(2) B0030-mTagBFP
 
-
 
-
(3) B0030-Luciferase
 
-
 
-
(4) [B0030-CinR]-tt
 
-
 
-
(5) pCin-[B0030-CinR]
 
-
 
-
===Transformation (correct competent cell – DH5α)===
 
-
(1) B0030-CI (Amp)
 
-
 
-
(2) B0030-mTagBFP (Amp)
 
-
 
-
(3) B0030-Luciferase (Amp)
 
-
 
-
(4) [B0030-CinR]-tt (Amp)
 
-
 
-
(5) pCin-[B0030-CinR] (Amp)
 
-
 
-
(6)(7) pCI (Amp, Chl)
 
-
 
-
(8) pCin (Amp)
 
-
 
-
(9) LuxR (Amp): we took the wrong LuxR previously, but this time it was correct.
 
-
 
-
(10) B0015 (tt) (Amp)
 
-
 
-
===Original biobrick:===
 
-
(1) Extracted the whole genome of P. aeruginosa
 
-
 
-
==7/25==
 
-
===Results===
 
-
(1) Transformation: 7 growth except pCI and LuxR
 
-
 
-
===Transformation===
 
-
(1) PcA (pConst18C-B0030-RhlR-tt)
 
-
 
-
(2) PcD (pConst18C-B0030-LasR-tt)
 
-
 
-
(3) G5 (B0030-mRFP-tt)
 
-
 
-
(4) E1 (B0030-GFP-tt)
 
-
 
-
(5) B5 (B0030-mCherry-tt)
 
-
 
-
(6) C1 (pRhl-B0030-RhlR)
 
-
 
-
(7) F2 (pLas-B0030-LasR)
 
-
 
-
(8) pCI
 
-
 
-
(9) LuxR
 
-
 
-
 
-
No.1~7 are going to make stocks.
 
-
 
-
===Inoculation and Incubation: ===
 
-
(No.1~5 cultured 5 tubes, 6 & 7 cultured 2 tubes, total 29 tubes)
 
-
 
-
(1) B0030-CI (Amp)
 
-
 
-
(2) B0030-mTagBFP (Amp)
 
-
 
-
(3) B0030-Luciferase (Amp)
 
-
 
-
(4) B0030-CinR-tt (Amp)
 
-
 
-
(5) pCin-B0030-CinR (Amp)
 
-
 
-
(6) pCin (Amp)
 
-
 
-
(7) B0015 (Amp)
 
-
 
-
===Original biobrick:===
 
-
(1) Extracted the whole genome of A. baumannii
 
-
 
-
(2) The concentration wasn’t very high
 
-
 
-
==7/26==
 
-
 
-
===Results:===
 
-
(1) Inoculation: forgot to put in 37 degree incubator…(put in 4 degree refrigerator)
 
-
 
-
(2) Transformation: 7 growth except pCI and LuxR…
 
-
 
-
(3) Debug: purified LuxR official plasmid, but the concentration was very~low
 
-
 
-
===Official biobricks===
 
-
(1) Take pCI and LuxR from 2012 official kit (at Life Science college)
 
-
 
-
===Transformation===
 
-
(1) pCI (Amp)
 
-
 
-
(2) LuxR (Amp)
 
-
 
-
(3) ACE (positive feedback of RhlR-GFP) (Amp): for functional assay
 
-
 
-
 
-
Transform at room temperature over weekend.
 
-
 
-
===Inoculation and Incubation===
 
-
(1) Keep inoculating at 37 degree incubator (since they didn’t growth very well)
 
-
 
-
(2) But the quality is uncertain
 
-
 
-
===Make new Amp plates===
 
-
 
-
==7/29==
 
-
 
-
===Check:===
 
-
(1)B0030-CI (Amp)
 
-
 
-
(2)B0030-mTagBFP (Amp)
 
-
 
-
(3)B0030-Luciferase (Amp)
 
-
 
-
(4)B0030-CinR-tt (Amp)
 
-
 
-
(5)pCin-B0030-CinR (Amp)
 
-
 
-
(6)pCin (Amp)
 
-
 
-
(7)B0015 (Amp)
 
-
 
-
B0015 contained a backbone of 3K. Check again!?
 
-
 
-
[[File:NTU-Taida-journal-July-5.jpg]]
 
-
 
-
===Inoculation and Incubation at LB broth:===
 
-
(1)PcA (pConst18C-B0030-RhlR-tt)
 
-
 
-
(2)PcD (pConst18C-B0030-LasR-tt)
 
-
 
-
(3)G5 (B0030-mRFP-tt)
 
-
 
-
(4)E1 (B0030-GFP-tt)
 
-
 
-
(5)B5 (B0030-mCherry-tt)
 
-
 
-
(6)C1 (pRhl-B0030-RhlR)
 
-
 
-
(7)F2 (pLas-B0030-LasR)
 
-
 
-
(8)pCI
 
-
 
-
(9)LuxR
 
-
 
-
(10)ACE
 
-
 
-
==7/30==
 
-
===Check:===
 
-
pCI-1, ACE, LuxR, C1, PcA, E1-1, C1, B5, PcD, F2, G5
 
-
 
-
[[File:NTU-Taida-journal-July-6.jpg]][[File:NTU-Taida-journal-July-7.jpg]][[File:NTU-Taida-journal-July-8.jpg]]
 
-
 
-
===Digestion, Ligation and Transformation:===
 
-
Pc+AcinR
 
-
 
-
BcinR+C GFPmut(E1)
 
-
 
-
BcinR +C mCherry(B5)
 
-
 
-
B0030-mTagBFP+B0015
 
-
 
-
B0030-Luci+B0015
 
-
 
-
B0030-CI+B0015
 
-
 
-
==7/31==
 
-
===Digestion, Ligation and Transformation:===
 
-
Pc+AcinR
 
-
 
-
BcinR+CGFPmut(E1)
 
-
 
-
B0030-mTagBFP+B0015
 
-
 
-
B0030-Luci+B0015
 
-
 
-
B0030-CI+B0015
 
-
 
-
pLas + RBS-LasR failed two times (without bands at gel extracting)
 
-
 
-
 
-
11  plate
 
-
Pc+AcinR 30 / 31
 
-
 
-
BcinR+CGFPmut(E1) 30 / 31
 
-
 
-
BcinR +CmCherry(B5) 30
 
-
 
-
B0030-mTagBFP+B0015 30/31
 
-
 
-
B0030-Luci+B0015 30/31
 
-
 
-
B0030-CI+B0015 30/31
 
-
 
-
===Plasmid DNA Extraction (mini-prep):===
 
-
<html>
 
-
<table>
 
-
<tr class="tableizer-firstrow"><th>gene</th><th>name</th><th>vector</th><th>size(bp)</th><th>conc(ng/ul)</th><th>site</th></tr>
 
-
<tr><td>pCI-1</td><td>Bba_R0051</td><td>pSB1A3</td><td>49</td><td>136</td><td>yellow box</td></tr>
 
-
<tr><td>pCI-2</td><td>Bba_R0051</td><td>pSB1A4</td><td>49</td><td>66.6</td><td>yellow box</td></tr>
 
-
<tr><td>LuxR-1</td><td>Bba_C0062</td><td>pSB1A2</td><td>781</td><td>119</td><td>yellow box</td></tr>
 
-
<tr><td>LuxR-3</td><td>Bba_C0062</td><td>pSB1A2</td><td>781</td><td>119.8</td><td>yellow box</td></tr>
 
-
<tr><td>RhlR-GFPmut3-positive</td><td>ACE-2</td><td>pSB1A2</td><td>2572</td><td>308.8</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>ACE-4</td><td>pSB1A2</td><td>2572</td><td>287.9</td><td>yellow box</td></tr>
 
-
<tr><td>Pc-RBS-Rhl-tt</td><td>PcA-1</td><td>pSB1A2</td><td>908</td><td>82.3</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>PcA-3</td><td>pSB1A2</td><td>908</td><td>79.8</td><td>yellow box</td></tr>
 
-
<tr><td>Pc-RBS-Las-tt</td><td>PcD-2</td><td>pSB1A2</td><td>902</td><td>72.4</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>PcD-3</td><td>pSB1A2</td><td>902</td><td>81.5</td><td>yellow box</td></tr>
 
-
<tr><td>pLas-RBS-LasR</td><td>seguence is not correct</td></tr>
 
-
<tr><td>pRhl-RBS-RhlR</td><td>C1-2</td><td>pSB1A2</td><td>797</td><td>104.2</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>C1-3</td><td>pSB1A2</td><td>797</td><td>119.2</td><td>yellow box</td></tr>
 
-
<tr><td>RBS-GFPmut3-tt</td><td>E1-1</td><td>pSB1AK3</td><td>867</td><td>129.2</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>E1-3</td><td>pSB1AK3</td><td>867</td><td>91.1</td><td>yellow box</td></tr>
 
-
<tr><td>RBS-mCherry-tt</td><td>B5-1</td><td>pSB1AK3</td><td>858</td><td>105.1</td><td>yellow box</td></tr>
 
-
<tr><td>&nbsp;</td><td>B5-3</td><td>pSB1AK3</td><td>858</td><td>73.2</td><td>yellow box</td></tr>
 
-
<tr><td>RBS-mRFP-tt</td><td>seguence is not correct</td></tr>
 
-
</table>
 
-
 
-
</html>
 
-
 
{{:Team:NTU-Taida/Templates/ContentEnd}}{{:Team:NTU-Taida/Templates/Footer|ActiveNavbar=Notebook}}
{{:Team:NTU-Taida/Templates/ContentEnd}}{{:Team:NTU-Taida/Templates/Footer|ActiveNavbar=Notebook}}

Revision as of 10:25, 14 September 2013


Calender

Retrieved from "http://2013.igem.org/Team:NTU-Taida/Notebook/Journal"