Team:Macquarie Australia/Notebook

From 2013.igem.org

(Difference between revisions)
Line 103: Line 103:
<img style="margin:0 auto;float:none;"src="https://static.igem.org/mediawiki/2012/7/77/KAIST_Protocol_content_top.png" id="top-part"></img>
<img style="margin:0 auto;float:none;"src="https://static.igem.org/mediawiki/2012/7/77/KAIST_Protocol_content_top.png" id="top-part"></img>
<div id="protocolcontent">
<div id="protocolcontent">
 +
 +
<b>Week 1</b><br><br>
<p>We spent this week designing the sequences of the genes: ChlI1, CTH1, CHlM, POR, CHlD, ChlH, GUN4 and Plastocyanin that we will use for the project, including gBlocks and PCR products. The gBlocks were designed to eliminate unwanted restriction endonuclease sites, encode restriction enzyme sites EcoR1 (E), Xbal (X), SpeI (S) and PstI (P) at the ends of the gBlocks and possess 35bp overlaps between the gBlocks and PCR products that comprise each gene separately. Each gene sequence was ensured to have a bacterial ribosome binding site (shine-dalgarno sequence).</p>
<p>We spent this week designing the sequences of the genes: ChlI1, CTH1, CHlM, POR, CHlD, ChlH, GUN4 and Plastocyanin that we will use for the project, including gBlocks and PCR products. The gBlocks were designed to eliminate unwanted restriction endonuclease sites, encode restriction enzyme sites EcoR1 (E), Xbal (X), SpeI (S) and PstI (P) at the ends of the gBlocks and possess 35bp overlaps between the gBlocks and PCR products that comprise each gene separately. Each gene sequence was ensured to have a bacterial ribosome binding site (shine-dalgarno sequence).</p>
Line 119: Line 121:
included restriction sites S and P, however the short primers were both forward and reverse primers.<br><br>
included restriction sites S and P, however the short primers were both forward and reverse primers.<br><br>
-
Primers:<br>
+
<b>Primers:</b><br>
GUN4-F1          AAGCGCAACTGGGTTTACTTC<br>
GUN4-F1          AAGCGCAACTGGGTTTACTTC<br>
GUN4-R1S        ATACAACACCTGGCAGGATCA<br>
GUN4-R1S        ATACAACACCTGGCAGGATCA<br>
Line 147: Line 149:
 +
<b>Summer break week 2:</b>
 +
<p>During week 2 we focused on making LB media, SOC media and gels for electrophoresis. PCR reactions were performed on all the genes.</p><br><br>
 +
 +
[Picture]<br><br>
 +
 +
 +
The results we obtained showed that all the genes’ PCR products were successfully amplified, apart from ChlD (both long and short primers). From this we decided to use the short forward and long reverse primers for future PCR amplification of gene PCR products. The gene products were cut out from the gel and purified.
 +
<br><br>
 +
Nanodrop concentrations were taken for each gene product. For Gibson Assembly (required to join the gBlock and PCR products together) a concentration of 10ng/μl DNA was aimed to be obtained however, for smaller genes a smaller concentration could be adequate.<br><br>
 +
 +
GUN4  -  15.0 ng/μL<br>
 +
ChlM  - 6.0 ng/μL<br>
 +
ChlI1 – 15.0 ng/μL<br>
 +
CTH1 – 17.0 ng/μL<br>
 +
ChlH1 -12.0 ng/μL<br>
 +
ChlH2 – 8.0 ng/μL<br>
 +
ChlH3 – 4.0 ng/μL<br>
 +
POR short primer – 5.5 ng/μL<br>
 +
POR long primer – 5.4 ng/μL<br>
 +
 +
<br><br>
 +
 +
To conclude this week’s wet lab work ChlH2, ChlH3 and POR were amplified again with PCR as the concentration of DNA was too low. ChlD was also re-amplified due to PCR failure.
 +
<br><br>
 +
<b>Summer break week 3:</b><br>
 +
The gBlocks arrived for all the genes. ChlD, POR and ChlH2 and ChlH3 PCR products were run out on gels and DNA concentrations were observed using nanodrop. The results indicated the DNA concentrations were less than 6.0ng/μL thus, are not adequate enough for use in Gibson Assembly. E. coli Top10 cells were made competent using electroporation.
 +
<br><br>
 +
<b>Summer break week 4:</b><br>
 +
The genes ChlH2, ChlH3, POR and CHlD were amplified again with PCR. However, the temperature of the PCR machine was set too low, thus PCR attempt was unsuccessful. Therefore, the PCR was redone using slightly modified primers (1/10 dilution of the ChlD forward primer). <br><br>
 +
GET PICTURE FOR THESE RESULTS – pg 18
 +
<br><br>
 +
This week, we discovered that our previous concentrations for GUN4, ChlM, ChlI1, CTH1 and ChlH1 may have been due to protein contamination. The nanodrop was being read at an absorbance of 260/230 rather than 260/280 thus the results are inconclusive. From these results we wanted to determine the gene intensity by comparing them against a control (T3 plasmid) using gel electrophoresis. The results indicated that all the genes had similar intensities to the control plasmid and vectors, except for ChlM, which was slightly lower.
 +
<br><br>
 +
 +
[Picture]
 +
<br><br>
 +
 +
The genes ChlI1, GUN4, ChlM and CTH1 had the same approximate DNA concentration as the control, confirming the DNA concentrations obtained by the nanodrop weren’t caused by protein contamination.
 +
<br><br>
 +
 +
[Picture]
 +
<br><br>
 +
 +
ChlH1 had a similar intensity to the control; however POR-L, ChlH2 and ChlH3-L possessed a much lower intensity (weaker bands). <br><br>
 +
We performed gel purification on GUN4, ChlI1, ChlM, CTH1, plastocyanin, ChlH2 and  ChlH3.<br><br>
 +
 +
Nanodrop readings:<br>
 +
 +
ChLH2: 11.0 ng/μL<br>
 +
ChLH3: 5.0 ng/μL<br>
 +
<br><br>
 +
<b>Summer break week 5:</b><br><br>
 +
 +
The plastocyanin was digested with restriction enzymes (S and E) to check that the gene had been inserted. The results indicated that the gene was successfully inserted into the plasmid vector.
 +
<br><br>
 +
We tested the competent cells by measuring the absorbance of an inoculate of E. coli Top 10 cells in LB media. The Absorbance reading was recorded as 0. 687.
 +
<br><br>
 +
 +
ChlD, ChlD (with plasmid), POR, ChlI1, ChlM, GUN4 and CTH1 digests (using S and E) and plasmids were amplified again with PCR. The results indicated that the plasmid digests for ChlI1 and CTH1 showed suggested gene insertion, thus could be sent off for gene sequencing. The circled section of POR was cut out, purified and a nanodrop indicated a concentration of 22.5 ng/μL of DNA (Fig. 5).
 +
 +
<br><br>
 +
[Picture]
 +
<br><br>
 +
Following this gel electrophoresis, we performed a plasmid preparation and restriction digests (using S and E) for ChlM and GUN4. The results indicated that it was successfully digested, thus confirming the genes hae been inserted into the plasmid vectors.<br><br>
 +
 +
<b>Summer break week 6:</b><br>
 +
GUN4, ChlM, plastocyanin, CHlI1 and CTH1 were sent for sequencing. The method used was Big-Dye sequencing. GUN4 and plastocyanin came back as successful however, the others were incorrect. GUN4 and plastocyanin were placed into glycerol stock (-80oC storage). <br><br>
 +
 +
Gibson assembly for ChlH and POR was completed; however our results indicated that it was unsuccessful. The promoters Tet and Lac, from the 2012 part kits, were tested and transformed into E. coli.<br><br>
 +
 +
Objectives achieved: received gBlocks, designed sequences for genes and primers (except for ChlD) and successfully inserted GUN4 and plastocyanin into separate Biobrick parts.<br><br>
 +
<br><br>
</div>
</div>

Revision as of 03:22, 12 September 2013


Notebook

To browse through our notebook simply click on the image with the date. It will expand with what we did that week. To continue on simply click on the next one. If the notebook isn't functioning as planned (it will not load the next tab of content) then please go to our linearised view which is located here.


A seperate 'Results & Characterization' section has been created to show and highlight our successful accomplishments, shown Here.


Intro to the week, Work being done, "Using PCR we amplified the genes X and X"
Results (This worked, this didnt), "Gene X didnt amplify, Gene X did"
Small discussion + Whats next "We plan on then doing X to amplified gene"

Month 1 - Summer Break
Week 1

We spent this week designing the sequences of the genes: ChlI1, CTH1, CHlM, POR, CHlD, ChlH, GUN4 and Plastocyanin that we will use for the project, including gBlocks and PCR products. The gBlocks were designed to eliminate unwanted restriction endonuclease sites, encode restriction enzyme sites EcoR1 (E), Xbal (X), SpeI (S) and PstI (P) at the ends of the gBlocks and possess 35bp overlaps between the gBlocks and PCR products that comprise each gene separately. Each gene sequence was ensured to have a bacterial ribosome binding site (shine-dalgarno sequence).

gBLocks:
1. ChlI1 - 1 gBlock + 2 PCR products
2. ChlH - 5 gBlocks + 3 PCR products
3. ChlD - 1 gBlock + 2 PCR products
4. GUN4 - 1 gBlock + 1 PCR product
5. ChlM - 1 gBlock + 1 PCR product
6. CTH1 - 2 gBlocks + 1 PCR products
7. POR - 1 gBlock + 1 PCR product
8. Plastocyanin - 1 gBlock

Short and long primers for the PCR products were designed. Long primers (only reverse primers) included restriction sites S and P, however the short primers were both forward and reverse primers.



included restriction sites S and P, however the short primers were both forward and reverse primers.

Primers:
GUN4-F1 AAGCGCAACTGGGTTTACTTC
GUN4-R1S ATACAACACCTGGCAGGATCA
GUN4-R1L CAGCGGCGGCCTACTAGTATACAACACCTGGCAGG
ChlM-F1 AGACGGTGGACAAGGTGCT
CHLM-R1S GTCCGAGTCCATCAGTCCTTAC
CHLM-R1L CAGCGGCCGCCTACTAGTCCGAGTCCATCAGTCC
ChlD-F1 CCCGTGGAAGACCAAGATGC
ChlD-R1S GTAACGCTCACATACCAACAC
ChlD-R1L CAGCGGCCGCCTACTAGTAACGCTCACATACCAAC
Chll1-F1 AGCTGATGAGCGAGGAGGT
Chll1-R1S TGCCGCTTACTCCATGCCG
Chll1-R1L CAGCGGCCGCCTACTAGTGCCGCTGACTCCATG
CTH1-F1 CGGAGATGGTCAACGACTG
CTH-R1S GCTCCAAAGCACTCTCAAAACT
CTHR1L CAGCGGCCGCCTACTAGTGCTCCAAAGCACTCTC
ChlH-F1 GCTCATCTTCATTGAGGAGCTT
ChlH-R1 GCTGTTCACGAAGTTCTTG
ChlH-F2 GAGGATCTGATCCAGTCGGT
ChlH-R2 CTGGTCAACGTCAGCCAGGA
ChlH-F3 GAGATGTACCTGAAGCGCAAG
ChlH-R3S ACTAGTGCTACCATGAAGGG
ChlH-R3L CAGCGGCCGCCTACTAGTGCTACCATGAAGGG
POR-F1 ACTCAATCCTGCACCTGGAC
POR-R1S CAGAGACGAACCGCAGGTAG
POR-R1L CAGCGGCCGCCTACTAGTCAGAGACGAACCGCAG
Summer break week 2:

During week 2 we focused on making LB media, SOC media and gels for electrophoresis. PCR reactions were performed on all the genes.



[Picture]

The results we obtained showed that all the genes’ PCR products were successfully amplified, apart from ChlD (both long and short primers). From this we decided to use the short forward and long reverse primers for future PCR amplification of gene PCR products. The gene products were cut out from the gel and purified.

Nanodrop concentrations were taken for each gene product. For Gibson Assembly (required to join the gBlock and PCR products together) a concentration of 10ng/μl DNA was aimed to be obtained however, for smaller genes a smaller concentration could be adequate.

GUN4 - 15.0 ng/μL
ChlM - 6.0 ng/μL
ChlI1 – 15.0 ng/μL
CTH1 – 17.0 ng/μL
ChlH1 -12.0 ng/μL
ChlH2 – 8.0 ng/μL
ChlH3 – 4.0 ng/μL
POR short primer – 5.5 ng/μL
POR long primer – 5.4 ng/μL


To conclude this week’s wet lab work ChlH2, ChlH3 and POR were amplified again with PCR as the concentration of DNA was too low. ChlD was also re-amplified due to PCR failure.

Summer break week 3:
The gBlocks arrived for all the genes. ChlD, POR and ChlH2 and ChlH3 PCR products were run out on gels and DNA concentrations were observed using nanodrop. The results indicated the DNA concentrations were less than 6.0ng/μL thus, are not adequate enough for use in Gibson Assembly. E. coli Top10 cells were made competent using electroporation.

Summer break week 4:
The genes ChlH2, ChlH3, POR and CHlD were amplified again with PCR. However, the temperature of the PCR machine was set too low, thus PCR attempt was unsuccessful. Therefore, the PCR was redone using slightly modified primers (1/10 dilution of the ChlD forward primer).

GET PICTURE FOR THESE RESULTS – pg 18

This week, we discovered that our previous concentrations for GUN4, ChlM, ChlI1, CTH1 and ChlH1 may have been due to protein contamination. The nanodrop was being read at an absorbance of 260/230 rather than 260/280 thus the results are inconclusive. From these results we wanted to determine the gene intensity by comparing them against a control (T3 plasmid) using gel electrophoresis. The results indicated that all the genes had similar intensities to the control plasmid and vectors, except for ChlM, which was slightly lower.

[Picture]

The genes ChlI1, GUN4, ChlM and CTH1 had the same approximate DNA concentration as the control, confirming the DNA concentrations obtained by the nanodrop weren’t caused by protein contamination.

[Picture]

ChlH1 had a similar intensity to the control; however POR-L, ChlH2 and ChlH3-L possessed a much lower intensity (weaker bands).

We performed gel purification on GUN4, ChlI1, ChlM, CTH1, plastocyanin, ChlH2 and ChlH3.

Nanodrop readings:
ChLH2: 11.0 ng/μL
ChLH3: 5.0 ng/μL


Summer break week 5:

The plastocyanin was digested with restriction enzymes (S and E) to check that the gene had been inserted. The results indicated that the gene was successfully inserted into the plasmid vector.

We tested the competent cells by measuring the absorbance of an inoculate of E. coli Top 10 cells in LB media. The Absorbance reading was recorded as 0. 687.

ChlD, ChlD (with plasmid), POR, ChlI1, ChlM, GUN4 and CTH1 digests (using S and E) and plasmids were amplified again with PCR. The results indicated that the plasmid digests for ChlI1 and CTH1 showed suggested gene insertion, thus could be sent off for gene sequencing. The circled section of POR was cut out, purified and a nanodrop indicated a concentration of 22.5 ng/μL of DNA (Fig. 5).

[Picture]

Following this gel electrophoresis, we performed a plasmid preparation and restriction digests (using S and E) for ChlM and GUN4. The results indicated that it was successfully digested, thus confirming the genes hae been inserted into the plasmid vectors.

Summer break week 6:
GUN4, ChlM, plastocyanin, CHlI1 and CTH1 were sent for sequencing. The method used was Big-Dye sequencing. GUN4 and plastocyanin came back as successful however, the others were incorrect. GUN4 and plastocyanin were placed into glycerol stock (-80oC storage).

Gibson assembly for ChlH and POR was completed; however our results indicated that it was unsuccessful. The promoters Tet and Lac, from the 2012 part kits, were tested and transformed into E. coli.

Objectives achieved: received gBlocks, designed sequences for genes and primers (except for ChlD) and successfully inserted GUN4 and plastocyanin into separate Biobrick parts.



Week 1 - Thursday August 1st
Week 1 - Thursday August 1st
Week 1 - Thursday August 1st
Week 1 - Thursday August 1st
Week 1 - Thursday August 1st
Week 1 - Thursday August 1st

With the break between semesters over, the Macquarie iGEM team returned to classes; for many of us this was the first day of iGEM 2013. We had our first meeting and discussed our project. Dr. Louise Brown and Associate Professor Rob Willows were introduced to the team and we began to determine who would take on certain roles within the team.

We eagerly began our project, deciding to use Gibson Assembly to produce our optimised genes. We had decided to develop BioBricks necessary for the biosynthesis of chlorophyll within E.coli. To do this, we constructed a gene pathway, containing 12 genes to reach our goal of chlorophyll biosynthesis.

Week 2 - Thursday August 8th

Week 2 (G block assemblies & transformations) - Update Coming soon