"
Team:Bielefeld-Germany/Labjournal/May
From 2013.igem.org
(Difference between revisions)
| Line 20: | Line 20: | ||
*Initiating lab work on the sub-project endogenous mediator [[Team:Bielefeld-Germany/Project/GldA|Glycerol dehydrogenase]]. | *Initiating lab work on the sub-project endogenous mediator [[Team:Bielefeld-Germany/Project/GldA|Glycerol dehydrogenase]]. | ||
| - | *Starting lab work with the first successful PCR: | + | *Starting lab work with the first successful PCR: gldA with pre- and suffix overlaps could be amplified from ''Escherichia coli'' genome. |
| - | *The main work however is still planning of our | + | *The main work however is still planning of our sub-projects, designing experiments and a lot of research. |
*Finding sponsors goes ahead. Many companies like our project and want to support us. | *Finding sponsors goes ahead. Many companies like our project and want to support us. | ||
<br><br><br><br> | <br><br><br><br> | ||
| Line 38: | Line 38: | ||
====Mediators==== | ====Mediators==== | ||
*Glycerol dehydrogenase | *Glycerol dehydrogenase | ||
| - | **Primerdesign for isolation of | + | **Primerdesign for isolation of ''gldA'' gene from ''Escherichia coli'' KRX strain, with overlaps for BioBrick prefix and suffix: |
| - | **Forward | + | **Forward primer ''gldA'' (43 bp): GAATTCGCGGCCGCTTCTAGATGGACCGCATTATTCAATCACC |
| - | **Reverse | + | **Reverse primer ''gldA'' (45 bp): CTGCAGCGGCCGCTACTAGTATTATTCCCACTCTTGCAGGAAACG |
| Line 74: | Line 74: | ||
**Starting first cultivation of ''Escherichia coli'' KRX strain for [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation |complete genome isolation]]. | **Starting first cultivation of ''Escherichia coli'' KRX strain for [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation |complete genome isolation]]. | ||
**Successful [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation| genome isolation]] of ''Escherichia coli'' KRX. | **Successful [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation| genome isolation]] of ''Escherichia coli'' KRX. | ||
| - | **Successful PCR on the | + | **Successful PCR on the ''gldA'' gene of ''Escherichia coli'' KRX strain. |
| - | [[Image:IGEM_Bielefeld_Standard_Phusion_PCR_Master_MixLRO.jpg|300px|thumb|left| <p align="justify">'''Table 1: Standard | + | [[Image:IGEM_Bielefeld_Standard_Phusion_PCR_Master_MixLRO.jpg|300px|thumb|left| <p align="justify">'''Table 1: Standard phusion PCR master mix. '''</p>]] |
| - | [[Image:IGEM_Bielefeld_Standard_Phu_PCR_GldA_OprF.jpg|300px|thumb|center| <p align="justify">'''Table 2: Two step standard | + | [[Image:IGEM_Bielefeld_Standard_Phu_PCR_GldA_OprF.jpg|300px|thumb|center| <p align="justify">'''Table 2: Two step standard phusion PCR program for ''gldA'' amplification. '''</p>]] |
| - | ** | + | **The ''gldA'' PCR product was isolated by agarose gel electrophoresis and [[Team:Bielefeld-Germany/Labjournal/Molecular#Used Kits| purified]]. |
**Bands are on at the expected size of 1050 bp. | **Bands are on at the expected size of 1050 bp. | ||
| - | [[Image:IGEM_Bielefeld_GldA_PCR_Gel.jpg|200px|thumb|left| <p align="justify">'''Figure 1: Agarose gel from PCR on the | + | [[Image:IGEM_Bielefeld_GldA_PCR_Gel.jpg|200px|thumb|left| <p align="justify">'''Figure 1: Agarose gel from PCR on the ''gldA'' gene of ''Escherichia coli'' KRX strain with forward and reverse primer ''gldA''. As a ladder we used [http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-dna-ladder-ready-to-use-250-to-10000-bp GeneRuler™ 1 kb DNA Ladder from Thermo Scientific]. '''</p>]] |
| Line 94: | Line 94: | ||
====Organization==== | ====Organization==== | ||
| - | *We will also take part at the congress | + | *We will also take part at the congress ‘‘Next generation of biotechnological processes 2020+‘‘ in Berlin on June 27th, 2013. |
*Having a second presentation at Merck KGaA head office in Darmstadt for explaining our project in detail. We are happy that Merck will be our next supporter in 2013. | *Having a second presentation at Merck KGaA head office in Darmstadt for explaining our project in detail. We are happy that Merck will be our next supporter in 2013. | ||
Revision as of 01:57, 5 October 2013
May
Milestones
- Initiating lab work on the sub-project endogenous mediator Glycerol dehydrogenase.
- Starting lab work with the first successful PCR: gldA with pre- and suffix overlaps could be amplified from Escherichia coli genome.
- The main work however is still planning of our sub-projects, designing experiments and a lot of research.
- Finding sponsors goes ahead. Many companies like our project and want to support us.
Week 1
Organization
- We were already able to find sponsors for our team: IIT BIEKUBA, IIT Biotech, Evonik, PlasmidFactory and FisherScientific will support us.
MFC
Mediators
- Glycerol dehydrogenase
- Primerdesign for isolation of gldA gene from Escherichia coli KRX strain, with overlaps for BioBrick prefix and suffix:
- Forward primer gldA (43 bp): GAATTCGCGGCCGCTTCTAGATGGACCGCATTATTCAATCACC
- Reverse primer gldA (45 bp): CTGCAGCGGCCGCTACTAGTATTATTCCCACTCTTGCAGGAAACG
2.Week
Organization
- Distribution of our team in various subgroups for best work efficiency.
- We’ve organized a barbecue to thank the working group of Dr. Jörn Kalinowski in the CeBiTec for the appropriation of space and support in the laboratory.
MFC
3.Week
Organization
- Planning the trip to the European jamboree in Lyon from October 11th to 13th, 2013.
MFC
Mediators
- Glycerol dehydrogenase
- Starting first cultivation of Escherichia coli KRX strain for complete genome isolation.
- Successful genome isolation of Escherichia coli KRX.
- Successful PCR on the gldA gene of Escherichia coli KRX strain.
Table 1: Standard phusion PCR master mix.
Table 2: Two step standard phusion PCR program for gldA amplification.
- The gldA PCR product was isolated by agarose gel electrophoresis and purified.
- Bands are on at the expected size of 1050 bp.
Figure 1: Agarose gel from PCR on the gldA gene of Escherichia coli KRX strain with forward and reverse primer gldA. As a ladder we used [http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-dna-ladder-ready-to-use-250-to-10000-bp GeneRuler™ 1 kb DNA Ladder from Thermo Scientific].
4.Week
Organization
- We will also take part at the congress ‘‘Next generation of biotechnological processes 2020+‘‘ in Berlin on June 27th, 2013.
- Having a second presentation at Merck KGaA head office in Darmstadt for explaining our project in detail. We are happy that Merck will be our next supporter in 2013.
MFC
