September

Milestones

Week 18

Organization

• This week, we supported the CeBiTec pupil academy with supervising the ‘Synthetic Biology’ experiment. In addition we had a presentation about iGEM and the Bielefeld iGEM projects.
• Our team assigned the Track Food & Energy in this year, with the project title ‘Ecolectricity – currently available’. Project abstract, safety forms and team roster were added.

MFC

Mediators

• Glycerol dehydrogenase
  • Repeating NADH-Assay with three times PBS buffer washing step shows good results with better NADH production for E. coli KRX with pSB1C3 <bbpart>BBa_K1172203</bbpart> and <bbpart>BBa_K1172204</bbpart> compared with E. coli KRX wildtyp. GldA with T7 promotor (<bbpart>BBa_K1172203</bbpart>) shows 0,5 μM NADH overproduction and GldA with Lac promotor (<bbpart>BBa_K1172204</bbpart>) shows 0,3 μM NADH overproduction. The data refer to a culture with OD600 = 3.0.

Table 1: Results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172204</bbpart> and <bbpart>BBa_K1172203</bbpart>. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

Figure 1: Column Chart with results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172204</bbpart> and <bbpart>BBa_K1172203</bbpart>. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

• • Second successful optimized NADH-Assay with Escherichia coli KRX Wildtyp strain and E. coli KRX with pSB1C3 and <bbpart>BBa_K1172203</bbpart>, <bbpart>BBa_K1172204</bbpart>, and <bbpart>BBa_K1172205</bbpart>.
  • GldA with T7 promotor (<bbpart>BBa_K1172203</bbpart>) shows 1,7 μM NADH overproduction and GldA with Lac promotor (<bbpart>BBa_K1172204</bbpart>) shows 0,2 μM NADH overproduction. The GldA expression by the Anderson promotor (<bbpart>BBa_K1172205</bbpart>) is too weak for an efficient NADH overproduction. The data refer to a culture with OD600 = 5.0.

Table 2: Results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172205</bbpart>, <bbpart>BBa_K1172204</bbpart> and <bbpart>BBa_K1172203</bbpart>. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

Figure 2: Column Chart with results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172205</bbpart>, <bbpart>BBa_K1172204</bbpart> and <bbpart>BBa_K1172203</bbpart>. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

• • Overexpressed glycerol dehydrogenase (Figure. 4 Week 17) should be examined by MALDI-TOF MS/MS.
    • Tryptic digest of gel lanes for analysis with MALDI-TOF.
    • Glycerol dehydrogenase was examined by MALDI-TOF MS/MS with a Mascot Score of 266 against Escherichia coli database.

• Riboflavin
  • We tried to ligate our four DNA-Sequences in pSB1C3 using Gibson-Assembly.
  • To further minimize the risk of false positive clones just carrying pSB1C3, we digested the pSB1C3-PCR-products with DpnI, prior to Gibson.
  • We assembled every fragment with its specific vector six times. For each fragment, we used two different approaches: The “Standard-protocol” where you take 100ng insert in 3:1 molar excess compared to the vector and an “over the top-protocol” (OTTP). The OTTP uses the same molar excess, but a much higher amount of DNA.

Table 1: Amounts of vector and insert used for gibson assembly

• • After the succesfull integration of the three most important sequences in pSB1C3, and the insofar completion of our first Biobrick BBa_K7211XXX (ribC), we started with the elimination of the illegal restriction sites in rib and norM.
  • Therefore we diluted one rib and one norM sample to 10 ng/µl and used it as PCR template.
  • At the beginning of the week, we had started to design primers for this purpose:
    • pst1-234 fwd (38 bp) TGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGC
    • pst1-234 rev (32 bp) CGACCATAATGGCTACAGGGTTCTAAGGTGAC
    • pst1-1644 fwd (30 bp) GTGCCCCATACTGTAGGTGAAACCACGTTG
    • pst1-1644 rev (34 bp) AACGTGGTTTCACCTACAGTATGGGGCACAATCG
    • EcoR1 fwd (43 bp) GGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCAC
    • EcoR1 rev (43 bp) GTGACTGTTGTTATAAATTCTATACCTAAGTGAACTGAGTGCC
    • pst1 norM fwd (38 bp) GCGATCGTGCTGATATTTCTGCGGTGGTCGCCAAAGTC
    • pst1 norM rev (41 bp) CAATAAGCCGACTTTGGCGACCACCGCAGAAATATCAGCAC

Cytochromes

Biosafety

• We executed the characterization of araC by cultivation (200rpm) in shaking flasks with different carbon sources. We used the M9 minimal medium with glucose/arabinose/glycin to measure the growth and the fluorescence of our biosafety system. The fluorescence is caused by the protein GFP which is a replacement for Barnase which is applied for the characterization to draw conclusions from the theoretical expression of the RNase. In continious intervals samples were taken the growth of the cells were measured by absorbance and the fluorescence by a plate reader.

Porines

• Successful Hexadecan-Assay for characterization of hydrophobicity of the outer membrane. Using Escherichia coli KRX Wildtyp and comparing it with:
  • <bbpart>BBa_K1172502</bbpart>: <bbpart>BBa_K1172501</bbpart> + <bbpart>BBa_K525998</bbpart>
  • <bbpart>BBa_K1172503</bbpart>: <bbpart>BBa_K1172501</bbpart> + <bbpart>BBa_J04500</bbpart>
  • <bbpart>BBa_K1172504</bbpart>: <bbpart>BBa_K1172501</bbpart> + <bbpart>BBa_K608007</bbpart>
  • <bbpart>BBa_K1172505</bbpart>: <bbpart>BBa_K1172501</bbpart> + <bbpart>BBa_K608006</bbpart>
  • <bbpart>BBa_K1172507</bbpart>: <bbpart>BBa_K1172501</bbpart> + <bbpart>BBa_K608002</bbpart>

Table 3: Results of the Hexadecane-Hydrophobicity-Assay. Comparison of protein Hydrophobicity between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart>, <bbpart>BBa_K1172504</bbpart>, <bbpart>BBa_K1172505</bbpart> and <bbpart>BBa_K1172507</bbpart>. Affinity to hexadecane (Hydrophobicity) with standard deviation and enhancement in comparison to the wild-type is shown.

Figure 3: Results of the Hexadecane-Hydrophobicity-Assay. Comparison of protein Hydrophobicity between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart>, <bbpart>BBa_K1172504</bbpart>, <bbpart>BBa_K1172505</bbpart> and <bbpart>BBa_K1172507</bbpart>. Affinity to hexadecane (Hydrophobicity) with standard deviation and enhancement in comparison to the wild-type is shown.

• The hydrophobicity increases continuously with increasing promoter strength up to 221% hydrophobizity in contrast to wildtyp strain.

• Successful ONPG and NPN uptake assays were performed. Membrane permeability is continuously increasing from weak to strong promoter strength.

Figure 4: Results of the NPN-uptake-assay. Comparison of fluorescence emission between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart>, <bbpart>BBa_K1172504</bbpart>, <bbpart>BBa_K1172505</bbpart> and <bbpart>BBa_K1172507</bbpart>. Fluorescence emission scan from 320 up to 390 nm wavelength with standard deviation is shown.

Figure 5: Results of the ONPG-uptake-assay. Comparison of ONPG hydrolysis between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart>, <bbpart>BBa_K1172504</bbpart>, <bbpart>BBa_K1172505</bbpart> and <bbpart>BBa_K1172507</bbpart>. Absorbance at 405 nm wavelength with standard deviation is shown.

• Beside testing OprF Biobrick (<bbpart>BBa_K1172501</bbpart>) with different assays and SDS-PAGE, the membrane should be visually displayed. The technique of choice is atomic force microscopy.
  • The glass slides were coated with Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart> in order to compare the membrane differences. The AFM itself was performed with the help of the working group of Prof. Dr. Dario Anselmetti, with special help from Dr. Volker Walhorn.

Week 19

Organization

• Our WDR TV contribution could be seen in the ‘OWL local time’ and in the WDR library.
• We have successfully performed the day of synthetic biology in the city of Bielefeld. We were able to explain many people our project with the help of our poster and the kids had a lot of fun with performing different experiments for introducing them into scientific work. DNA isolation from fruit and vegetables, pipetting of bright colors, chromatography with markers, a potato battery and microscopy were on the program. All in all a very successful day.

MFC

Mediators

Cytochromes

Biosafety

• We isolated the plasmids which we have transformed into KRX cells days before. We also transformed the Biobricks <bbpart>BBa_R0010</bbpart> (lacI regulated promoter) and <bbpart>BBa_K741002</bbpart> (plac with RBS+GFP+terminators) and measured their DNA concentration:
  • Alr_1: 214,2 ng/µL
  • Alr_2: 203,6 ng/µL
  • Alr_3: 301,3 ng/µL
  • BBa_R0010: 121,7 ng/µL
  • BBa_R0010: 136,0 ng/µL
  • BBa_K741002: 145,9 ng/µL
  • BBa_K741002: 175,1 ng/µL

• We deleted GFP out of the pBAD device for preparing to replace the RNase by cutting and insertion with the correlated restriction enzymes.
• PCR, purification and transformation in KRX:

• • RNase Ba fwd_rev 1: 79,2 ng/µL
  • RNase Ba fwd_rev 2: 85,9 ng/µL
  • Ptac fwd_rev 1: 74,4 ng/µL
  • Ptac fwd_rev 2: 69,8 ng/µL
  • RNase_pBAD (GFP_del) 68,4 ng/µL
  • Ptac_alr_pre_suf 1: 33,4 ng/µL
  • Ptac_alr_pre_suf 2: 41,0 ng/µL

• We isolated more plasmids out of KRX competente cells. The new BBa were previously transformed into competent cells.

• • Ptac_alr (9-89-451) 190,8 ng/µL
  • Ptac_alr (9-89-452) 212,8 ng/µL
  • Ptac_alr (9-89-453) 117,9 ng/µL
  • Ptac_alr (9-89-454) 107,3 ng/µL
  • RNase Ba (9-89-455) 101,0 ng/µL
  • RNase Ba (9-89-456) 82,5 ng/µL
  • pBAD_RNase Ba (9-89-4567 177,9 ng/µL
  • pBAD_RNase Ba (9-89-458) 151,9 ng/µL
  • pBAD_RNase Ba (9-89-459) 89,2 ng/µL
  • pBAD_RNase Ba (9-89-460) 83,5 ng/µL
  • BBa_I13504 (9-89-461) 152,3 ng/µL
  • BBa_I13504 (9-89-462) 159,4 ng/µL
  • BBa_R0040 (9-89-463) 125,7 ng/µL
  • BBa_R0040 (9-89-464) 129,0 ng/µL
  • BBa_R0040 (9-89-465) 105,5 ng/µL
  • K1172001 alr (9-89-466) 169,8 ng/µL
  • K1172001 alr (9-89-467) 156,0 ng/µL
  • K1172001 alr (9-89-468) 163,7 ng/µL
  • K1172001 alr (9-89-468) 135,8 ng/µL
  • BBa_C0040_3 250,2 ng/µL (9-108-451)
  • BBa_C0040_4 124,5 ng/µL (9-108-452)
  • Ptac_alr1 115,8 ng/µL (9-108-453)
  • Ptac_alr5 68,1 ng/µL (9-108-454)
  • Ptac_alr6 163,6 ng/µL (9-108-455)
  • DNase Ba3 86,6 ng/µL (9-108-456)

After the isolation and measuring we checked if the right insert is in the vector, so we did restriction analysis with EcoR1+ Pst1 and Barnase+pSB1C3 only with EcoR1. The results are listened below:

In this picture is shown the 1kb DNA ladder from Thermo Scientific on the right side and the different sampes of alanine racemase and barnase. In the second pocket is the first alanine racemase biosafety biobrick. The band by 2000bp is the vector pSB1C3 and the band on 1000 bp is the lanine racemase. The pocket number 7 shows Barnase in pSB1C3. As it was cut by only one restriction enzyme it is on the higth of ca. 2350 bp. This is the second biosafety biobrick we created.

Left and right the 1kb ladder from Thermo Scientific flanks the barnase samples. The bands of the samples lie between 250bp and 500 bp as expected. The expected size of Barnase is about 330 bp. We got successfully the barnase.

Porines

• SDS-PAGE with improved protein isolation of outer membrane porin oprF by Release of periplasmic protein fraction from E. coli by cold osmotic shock using Cell fractionating buffer 2.2. There is a slight overexpression band for E.coli with T7 promoter (<bbpart>BBa_K1172502</bbpart>) at the expected size of OprF (36 kDa). But the gel is a little bit overloaded with protein. Maybe the SDS concentration in Cell fractionating buffer 2.2 was elected with 2% too high, which has led to partial cell lysis and total protein extraction.

Figure 6: SDS-PAGE with Prestained Protein Ladder from Thermo Scientific as marker. Comparison of protein expression between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart> and <bbpart>BBa_K1172507</bbpart> after periplasmic protein fractioning with Cell fractioning buffer 2.2.

• Further improving of cell fractioning for protein isolation of outer membrane porin oprF by Release of periplasmic protein fraction from E. coli by cold osmotic shock using Cell fractionating buffer 2.3.

Figure 7: SDS-PAGE with Prestained Protein Ladder from Thermo Scientific as marker. Comparison of protein expression between Escherichia coli KRX wild type and Escherichia coli KRX with <bbpart>BBa_K1172502</bbpart>, <bbpart>BBa_K1172503</bbpart> and <bbpart>BBa_K1172507</bbpart> after periplasmic protein fractioning with Cell fractioning buffer 2.3.

• The SDS-PAGE shows a significantly higher protein concentration for E.coli with OprF and T7 promoter (<bbpart>BBa_K1172502</bbpart>). It seems to be that the higher membrane permeability allows a better release of membrane proteins by 0.2 % SDS. Nevertheless, we can see a strong overexpression band at the expected OprF size of about 36 kDa for <bbpart>BBa_K1172502</bbpart>, which is equated with a strong expression and overproduction of OprF.
• Overexpressed outer membrane porin (Figure. 5) should be examined by MALDI-TOF MS/MS.
  • Tryptic digest of gel lanes for analysis with MALDI-TOF.
  • Outer membrane porin was examined by MALDI-TOF MS/MS with a Mascot Score of 222 against bacteria database.

Week 20

Organization

• iGEM-Team Bielefeld 2013 T-shirts and hoodies were designed and are in production. Orange shirts with a great Ecolectricity logo. We are pleased to wear them in Lyon.
• As announced, we have participated at the conference '60 Years of DNA’ in Berlin at 14. September and received good reviews for our project.

MFC

Mediators

• Glycerol dehydrogenase
  • Glycerol dependent NADH-Assay with Escherichia coli KRX Wildtyp strain and E. coli KRX with pSB1C3 and <bbpart>BBa_K1172203</bbpart> by testing supplementation of different glycerol concentrations to the LB-medium.

Table 4: Experimental design of the glycerol dependent NADH-Assay. Supplementation of different amounts of glycerol to LB-medium should show the effect of glycerol on NADH overproduction.

Table 5: Results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172203</bbpart> supplemented with different amounts of glycerol to LB-medium. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

• • NADH-Assay shows a quiet good NADH overproduction for <bbpart>BBa_K1172203</bbpart> with increasing glycerol concentration.

Figure 8: Column Chart with results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172203</bbpart> supplemented with different amounts of glycerol to LB-medium. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown.

Cytochromes

Biosafety

• We transformed the tetracyclin repressor into KRX via electroporation for plasmid isolation. After this we isolated the plasmids and other plasmids which are listend below.
  • BBa_C0040_3 250,2 ng/µL (9-108-451)
  • BBa_C0040_4 124,5 ng/µL (9-108-452)
  • Ptac_alr1 115,8 ng/µL (9-108-453)
  • Ptac_alr5 68,1 ng/µL (9-108-454)
  • Ptac_alr6 163,6 ng/µL (9-108-455)
  • DNase Ba3 86,6 ng/µL (9-108-456)

Left and right the 1kb ladder from Thermo Scientific flanks the 3 different samples. In the first two pockets there is the TetR in pSB1C3 located.The expected bands by 2000bp and ca. 700 bp occured. The next three samples of ptac with alanine racemase had to be on the higth by 2000 and over 1000. This is also the fact by pocket six. The last pocket shows the Barnase in the pSB1C3 vector. Expected bands by 2000bp and ca. 350 bp are existing.

• We did purification of the restriction and measured the dna concentration via nanodrop:

• • BBa_C0040 TetO: 35,0 ng/µL
  • B0015 Terminator 22,1 ng/µL
  • GFP 4,4 ng/µL
  • Alr 8,7 ng/µL

• After we isolated the different plasmids we assembled the alanine racemase with the terminator (<bbpart>BBa_K1172003</bbpart>), TetO with GFP (<bbpart>BBa_K1172014</bbpart>) lacI+terminator. We transformed them into competent cells and did plasmid isolation.
  • LacI (C0012) 86,5 ng/µL (9-129-451)
  • Terminator (B0015) 95,4 ng/µL (9-129-452)
  • Terminator (B0015) 46,1 ng/µL (9-129-453)
  • Alr_Terminator 84,6 ng/µL (9-129-454)
  • Alr_Terminator 65,5 ng/µL (9-129-455)
  • Alr_Terminator 33,4 ng/µL (9-129-456)
  • Alr_Terminator 98,2 ng/µL (9-129-457)
  • TetO_GFP 102,6 ng/µL (9-129-458)
  • TetO_GFP 77,1 ng/µL (9-129-459)
  • TetO_GFP 91,8 ng/µL (9-129-460)

• After the plasmid isolation we checked with a restriction analysis with EcoR1 and Pst1 if the correct inserts are in the vectors. The results are schown below.

Left, in the middle and right the 1kb ladder from Thermo Scientific is located. From pocket 2 to 4 lacI with terminator is shown. The expected bands are 2000 bp for the vector and ca. 1300 bp. Pocket 2 is the correct sample and will be used for the following tests. From 7-10 the pockets are filled with alanine racemase + terminator. The expected bands are the same like before. 7,8 and 10 are the right samples to use. The pockets 11-13 shows tetO with GFP and terminator. The expected bands are 2000 bp for the vector and ca. 900 for GFP plus terminator. The bands have got the right higth and can be used for the next tests.

• We send them for sequence analysis to the sequencing service. The results confirmed our constructs.

• We did a PCR to get araC. It was done by executing the phusion protocoll and recipe. The results are listened below:

Left the 1kb ladder from Thermo Scientific is located. The following pockets are filled with the araC PCR samples. The expected band should be at about 1000 bp which is the fact.

• After cheking the PCR result we purified the samples with the PCR clean up Kit and measured the DNA concentration.:
• araC 12a 58,8 ng/µL (9-129-463)
• araC 12b 84,1 ng/µL (9-129-464)

• We did PCR with Tetracylin repressor purificated the samples and did gelelectrophoresis:

Left and right the 1kb ladder from Thermo Scientific is located. We did a PCR gradient to get the tetracycline repressor. The expected band should be 685bp which can be seen here. The TetR was successfully amplified.

• We assembled the three front constructs of our biosafety system via Gibson Assembly:
• BSVaraC
  • 1,5 µL pRha (BBa_K914003)
  • 2,3 µL alr_terminator (BBa_K1172003)
  • 1,5 µL araC

• BSVTetR
  • 1,5 µL pRha (BBa_K914003)
  • 2,3 µL alr_terminator (BBa_K1172003)
  • 1,5 µL TetR (BBa_C0040)

• BSVlacI
  • 1,0 µL pRha (BBa_K914003)
  • 7,0 µL lacI (BBa_C0012)
  • 0,7 µL alr_terminator

• We had assembled TetO with GFP before. pBAD with GFP and plac with GFP were already in the parts registry.
• Back constructs:

• • BSVaraC
    • pBAD+GFP

• • BSVTetR
    • TetO+GFP

• • BSVlacI
    • plac+GFP

Porines

Week 21

Organization

MFC

Mediators

• Glycerol dehydrogenase
  • Glycerol dependent NADH-Assay with Escherichia coli KRX Wildtyp strain and E. coli KRX with pSB1C3 and <bbpart>BBa_K1172203</bbpart> by testing different glycerol concentrations of M9-medium.

Table 6: Experimental design of the glycerol dependent NADH-Assay. Different concentrations of glycerol in M9-medium should show the effect of glycerol on NADH overproduction.

Table 7: Results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172203</bbpart> grown in M9-medium with different concentrations of glycerol. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown for cell disruption and supernatant fraction.

• • NADH-Assay shows an increasing intra- and extracellular NADH concentration for <bbpart>BBa_K1172203</bbpart> with increasing glycerol concentration in M9-medium.

Figure 9: Column Chart with results of the NADH-Assay. Comparison between Escherichia coli KRX Wildtyp and Escherichia coli KRX with <bbpart>BBa_K1172203</bbpart> grown in M9-medium with different concentrations of glycerol. NADH concentration with standard deviation and concentration in comparison to the wild-type is shown for cell disruption (Intracellular) and supernatant (Extracellular) fraction.

Cytochromes

Biosafety

• We cultivated the different biosafety systems for measuring how the specific product building rate looks like in M9 mediumwith different carbon sources. As mentioned before, we used GFP instead of Barnase for characterisation. We sampled in regulary intervals to measure the absorbance and the fluorescence.

Porines