Team:Edinburgh/Introduction/Metal promoters

The Fur Box

The fur box pattern that is conserved by in all different fur boxes is the palyndromic sequence: TGATAAT-N-ATTATCA (N being any base). Most fur boxes are 19 to 21 base pairs and always contain this 7-1-7 palyndromic sequence. Different theories exist as to how the Fur dimer binds to the fur box. The classical model states that a Fur dimer binds to one fur box and represses the downstream gene. Another states that the hexameric GATAAT pattern is recognized by three different fur dimers (Fuangthong and Helmann, 2003). The most recent one posits that the minimal binding site for the Fur dimer is TGATAAT-N-ATTATCA and that most fur boxes contain two repeats of this pattern, such as TGATAATGATAATCATTATCA (figure 2).

We decided to assess the minimal binding site for the fur box to work (TGATAAT-N-ATTATCA) in a synthetic construct and assay the effect of iron on a fluorescent protein located downstream.