Team:Paris Bettencourt/Notebook
From 2013.igem.org
Line 681: | Line 681: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_2nd_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 694: | Line 700: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 706: | Line 718: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 718: | Line 736: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 730: | Line 754: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 742: | Line 772: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 754: | Line 790: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_3th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 767: | Line 809: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 779: | Line 827: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 791: | Line 845: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 803: | Line 863: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 815: | Line 881: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 827: | Line 899: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_4th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 840: | Line 918: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 852: | Line 936: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 864: | Line 954: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 876: | Line 972: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 888: | Line 990: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 900: | Line 1,008: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_5th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<!-- {{:Team:Paris_Bettencourt/Notebook/Friday_5th_July/Modeling}} --> | <!-- {{:Team:Paris_Bettencourt/Notebook/Friday_5th_July/Modeling}} --> | ||
Line 912: | Line 1,026: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 924: | Line 1,044: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 936: | Line 1,062: | ||
</a> | </a> | ||
<b> SB6 Conference </b> | <b> SB6 Conference </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 948: | Line 1,080: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 960: | Line 1,098: | ||
</a> | </a> | ||
<b> SB6 Conference </b> | <b> SB6 Conference </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 972: | Line 1,116: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Monday_8th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 987: | Line 1,137: | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
+ | </html> | ||
<!-- {{:Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Drug_Screen}} --> | <!-- {{:Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Drug_Screen}} --> | ||
</div> | </div> | ||
Line 997: | Line 1,153: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,009: | Line 1,171: | ||
</a> | </a> | ||
<b> SB6 Conference </b> | <b> SB6 Conference </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,021: | Line 1,189: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,033: | Line 1,207: | ||
</a> | </a> | ||
<b> SB6 Conference </b> | <b> SB6 Conference </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,045: | Line 1,225: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Tuesday_9th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,058: | Line 1,244: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,070: | Line 1,262: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,082: | Line 1,280: | ||
</a> | </a> | ||
<b> SB6 Conference</b> | <b> SB6 Conference</b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,094: | Line 1,298: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,106: | Line 1,316: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,118: | Line 1,334: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Wednesday_10th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,131: | Line 1,353: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,143: | Line 1,371: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/Phage_Sensor&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,155: | Line 1,389: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/Trojan_Horse&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,167: | Line 1,407: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/TB-ception&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,179: | Line 1,425: | ||
</a> | </a> | ||
<b> Attempting to NightScience </b> | <b> Attempting to NightScience </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/Human_Practice&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,191: | Line 1,443: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Thursday_11th_July/Modeling&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> | ||
Line 1,204: | Line 1,462: | ||
</a> | </a> | ||
<b> Add here your twit </b> | <b> Add here your twit </b> | ||
+ | </html> | ||
+ | <html> | ||
+ | <p><a target="_blank" | ||
+ | href="https://2013.igem.org/wiki/index.php?title=Team:Paris_Bettencourt/Notebook/Friday_12th_July/Drug_Screen&action=edit"> | ||
+ | Edit note page</a> | ||
+ | </p> | ||
</html> | </html> | ||
<div class="FU_note"> | <div class="FU_note"> |
Revision as of 14:18, 26 July 2013
<body>
June 2013 | ||||||
Mo | Tu | We | Th | Fr | Sa | Su |
1 | 2 | |||||
3 | 4 | 5 | 6 | 7 | 8 | 9 |
10 | 11 | 12 | 13 | 14 | 15 | 16 |
17 | 18 | 19 | 20 | 21 | 22 | 23 |
24 | 25 | 26 | 27 | 28 | 29 | 30 |
July 2013 | ||||||
Mo | Tu | We | Th | Fr | Sa | Su |
1 | 2 | 3 | 4 | 5 | 6 | 7 |
8 | 9 | 10 | 11 | 12 | 12 | 13 |
14 | 15 | 16 | 17 | 18 | 19 | 20 |
21 | 22 | 23 | 24 | 25 | 26 | 27 |
28 | 29 | 30 | 31 |
August 2013 | ||||||
Mo | Tu | We | Th | Fr | Sa | Su |
1 | 2 | 3 | 4 | |||
5 | 6 | 7 | 8 | 9 | 10 | 11 |
12 | 13 | 14 | 15 | 16 | 17 | 18 |
19 | 20 | 21 | 22 | 23 | 24 | 25 |
26 | 27 | 28 | 29 | 30 | 31 |
September 2013 | ||||||
Mo | Tu | We | Th | Fr | Sa | Su |
1 | ||||||
2 | 3 | 4 | 5 | 6 | 7 | 8 |
9 | 10 | 11 | 12 | 13 | 14 | 15 |
16 | 17 | 18 | 19 | 20 | 21 | 22 |
23 | 24 | 25 | 26 | 27 | 28 | 29 |
October 2013 | ||||||
Mo | Tu | We | Th | Fr | Sa | Su |
1 | 2 | 3 | 4 | 5 | 6 | |
7 | 8 | 9 | 10 | 11 | 12 | 13 |
14 | 15 | 16 | 17 | 18 | 19 | 20 |
21 | 22 | 23 | 24 | 25 | 26 | 27 |
28 | 29 | 30 | 31 | 1 | 2 | 3 |
Control display by sub-project
Control display by content
Week 01: 3th - 9th June
Monday 3th June
Tuesday 4th June
Wednesday 5th June
Thursday 6th June
Friday 7th June
Week 02: 10th - 16th June
Monday 10th June
Tuesday 11th June
Wednesday 12th June
Thursday 13th June
Friday 14th June
Week 03: 17th - 23th June
Monday 17th June
Tuesday 18th June
Wednesday 19th June
Thursday 20th June
Friday 21th June
Week 04: 24th - 30th June
Monday 24th June
Trojan Horse
Starting bacterial culture of MG1655-6300 (Chantal’s glycerol).
Streaking 2 Agar plate with it.
Tuesday 25th June
Trojan Horse
Choosing a nice colony and launching overnight culture 37° in LB.
Wednesday 26th June
Thursday 27th June
Friday 28th June
Trojan Horse
sRNA design
Red sequences:
pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT
pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT
We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.
Week 05: 1st - 7th July
Monday 1st July
Drug Screening
Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.
4 strains were received from Jake:
- E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
- E. coli: NEBTurbo zmSIR Chloramphenicol
- E. coli: NEBTurbo zmFNR Spectinomycin
- E. coli: NEBTurbo soFD, zmSIR Chloramphenicol
Media Preparation
3 500ml bottles of LB broth and LB agar were prepared by standard methods.12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.
Glycerol Stocks
Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.
Tuesday 2nd July
Drug Screening
Plasmids were extracted from strains sD002, sD003, sD004
Plasmid Extraction
Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in the protocol (available on google drive).Lacking Resuspention solution we used some from a different mini prep upstairs.
Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. Plasmids were included in catalog.
Trojan Horse
Glycerol stock was made and cells were transformed.
Glycerol stock
From overnight culture of MG1655-6300 O/N : T001Centrifuge 4000rpm, 10 minutes,
Take out liquid
Resuspend cells in 1mL glycerol, 2mL LB
Separate in two cryotubes, one for the -80°C, one for the -20°C
Electroporation
Making MG1655-6300 competent using Electroporation protocolTest of the competent cells (negative
Transforming with pCOLADuet-1
Transforming with pACYCDuet-1
Plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)
Wednesday 3th July
Drug Screening
Competent Cells : BL21 (DE3) dCysI dFpr dydbk
- We grew 5ml of sD001 cells overnight from a single colony.
- This 5ml was used to innoculate 500ml of LB broth.
- Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
- Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
- Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
- Cells were centrifuged again for 20 minutes at 4000xg.
- Supernatant was removed and cells were resuspended in 12ml Buffer 2.
- Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
Buffer 2: 0.53ml 2M CaCl2 2.8ml 60% Glycerol 8.67ml sterile H2O
Trojan Horse
Transformation results
Negative controls are negative.Transformed cells grew on plates.
In the evening launch of 5mL Lb cultures from clones on the plates.
Igem Buffer for chemical competent cells.
Igem protocol for chemical competent cells.
Launch overnight culture of NEB turbo.
5mL LB inoculated with a clone from plate of drug team.
Thursday 4th July
Trojan Horse
Glycerols of the overnight cultures of the transformation.
- sT002 : MG1655 pCOLADuet-1
- sT003 : MG1655 pACYCDuet-1
- Making stocks of electro competent NEB turbo
- Prepare 10% glycerol solution
- Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes
- Cool down centrifuge to 4°C
- Prepare a rack with 50 microtubes at -80°C
- Making electroconpetent cells stock
- Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured
- Check the OD until it reached 0,5
- Put 500mL cultures in 10 50mL falcon tubes in ice
- Wait for 20 minutes for the culture to cool down
- Centrifuge at 3400 rpm 4°C for 10 minutes
- Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube)
- Centrifuge 10 minutes, 4°C , 3400 rpm
- Take out liquid and resuspend in 25 mL ice cold water
- Centrifuge 10 minutes, 4°C, 3400 rpm
- Resuspend all the content of the tubes in 20mL ice cold glycerol
- Centrifuge 10 minutes, 4°C, 3400rpm
- Resuspend in 5mL ice cold 10°C glycerol solution
- Aliquot in 50 tubes (100uL per microtubes)
- Store at -80°C
Friday 4th July
Week 06: 8th - 14th July
Monday 8th July
Tuesday 9th July
Wednesday 10th July
Thursday 11th July
Friday 12th July
Week 07: 15th - 21th July
Monday 15th July
Trojan Horse
Primer Design
Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol.
Geneious files in the dropbox: LacZ primers, KanR primers.
Tuesday 16th July
Trojan Horse
Transformation of pUC18 (NEB, NEB CC, BL21)
- Thaw competent cells on ice.
- Place 20 ul of cells in a pre-chilled Eppendorf tube.
- add o.5ul of plasmid to the cells
- Mix gently by flicking the tube.
- Chill on ice for 10 minutes.
- Heat shock at 42 °C for 30 seconds.
- Return to ice for 2 minutes.
- Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)
- Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)
- Incubate at 37 °C. Transformants should appear within 12 hrs.
Result: Colonies (around 10)
In silico cloning: sRNA gBlocks into pUC18 and litmus28-GFP
Successful with both Gibson assembly and regular cloning.
See file: “in silico cloning trojan horse.geneious”
Streaking Ortiz’s strain ELS-41 and ELS-13 containing Litmus28i_J23115-B0032-GFP and M13K07, respectively.
Wednesday 17th July
Trojan Horse
Redsign of Primers
Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol.
Geneious files in the dropbox: LacZ primers, KanR primers.
Liquid Cultures (for Miniprep)
7ml LB with proper antibiotics adding:
- NEB with pUC18 (AmpR)
- sT002 : MG1655 pCOLADuet-1 (KanR)
- sT003 : MG1655 pACYCDuet-1 (ChlaR)
Check: GFP expressed as expected in ELS-41
Lauching O/N of ELS-41 and ELS-13 with Amp and Kan, respectively.
Lauching O/N of MGZ1 (Glycerol from lab upstairs) with Spec (500X)
Thursday 18th July
Friday 19th July
Week 08: 21th - 27th July
Monday 21st July
Tuesday 22nd July
Wednesday 23th July
Thursday 24th July
Friday 25th July
Week 09: 29th July - 4th August
Week 10: 5th - 11th August
Week 11: 12th - 18th August
Week 12: 19th - 25th August
Week 13: 26th August - 1st September
Week 14: 2nd - 8th September
Week 15: 9th - 15th September
Week 16: 16th - 22th September
Week 17: 23th - 29th September
Week 18: 30th September - 6th October
Week 19: 7th - 13th October
Week 20: 14th - 20th October
Week 21: 21th - 27th October
Week 22: 28th October - 3th November