Team:Paris Bettencourt/Notebook

Starting bacterial culture of MG1655-6300 (Chantal’s glycerol).
Streaking 2 Agar plate with it.

Choosing a nice colony and launching overnight culture 37° in LB.

Making MG1655-6300 competent (edit 28/06: failure).

sRNA design



Red sequences:

pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT
pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT

We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.

Glycerol stock

Electroporation

Transformation results

Glycerols of the overnight cultures of the transformation.

• sT002 : MG1655 pCOLADuet-1
• sT003 : MG1655 pACYCDuet-1

Making stocks of electro competent NEB turbo

Prepare 10% glycerol solution

Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes

Cool down centrifuge to 4°C

Prepare a rack with 50 microtubes at -80°C

Making electroconpetent cells stock

Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured

Check the OD until it reached 0,5

Put 500mL cultures in 10 50mL falcon tubes in ice

Wait for 20 minutes for the culture to cool down

Centrifuge at 3400 rpm 4°C for 10 minutes

Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube)

Centrifuge 10 minutes, 4°C , 3400 rpm

Take out liquid and resuspend in 25 mL ice cold water

Centrifuge 10 minutes, 4°C, 3400 rpm

Resuspend all the content of the tubes in 20mL ice cold glycerol

Centrifuge 10 minutes, 4°C, 3400rpm

Resuspend in 5mL ice cold 10°C glycerol solution

Aliquot in 50 tubes (100uL per microtubes)

Store at -80°C

Primer Design

Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol.

Geneious files in the dropbox: LacZ primers, KanR primers.

Transformation of pUC18 (NEB, NEB CC, BL21)

1. Thaw competent cells on ice.
2. Place 20 ul of cells in a pre-chilled Eppendorf tube.
3. add o.5ul of plasmid to the cells
4. Mix gently by flicking the tube.
5. Chill on ice for 10 minutes.
6. Heat shock at 42 °C for 30 seconds.
7. Return to ice for 2 minutes.
8. Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)
9. Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)
10. Incubate at 37 °C. Transformants should appear within 12 hrs.

Redsign of Primers
Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol.
Geneious files in the dropbox: LacZ primers, KanR primers.

Liquid Cultures (for Miniprep)
7ml LB with proper antibiotics adding:

• NEB with pUC18 (AmpR)
• sT002 : MG1655 pCOLADuet-1 (KanR)
• sT003 : MG1655 pACYCDuet-1 (ChlaR)