Team:ETH Zurich/Experiments
From 2013.igem.org
Line 155: | Line 155: | ||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
- | <th colspan="4" height="30px">pLuxR | + | <th colspan="4" height="30px"> pLuxR constructs </th> |
<tr> | <tr> | ||
<th width="20px" height="30px"> </th> | <th width="20px" height="30px"> </th> | ||
Line 253: | Line 253: | ||
<td>24</td> | <td>24</td> | ||
<td>OHHL inducible expression of GusA with positive feedback loop for LuxR expression</td> | <td>OHHL inducible expression of GusA with positive feedback loop for LuxR expression</td> | ||
- | <td></td> | + | <td>BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga |
+ | <br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | ||
<td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td> | <td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 268: | Line 269: | ||
<td>26</td> | <td>26</td> | ||
<td>OHHL inducible expression of Aes with mutant pLux promoter</td> | <td>OHHL inducible expression of Aes with mutant pLux promoter</td> | ||
- | <td></td> | + | <td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] (SpeI,PstI) insert</td> |
+ | <td>[[File:Pla7.png|225px]]</td> | ||
<td>[[File:Pla30.png|225px]]</td> | <td>[[File:Pla30.png|225px]]</td> | ||
</tr> | </tr> |
Revision as of 13:05, 4 October 2013
Contents |
Final Circuit
For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the OHHL signal. PhoA is expressed constitutively as well as reporter for safe cells. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.
Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.
Cloned Constructs
To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.