From 2013.igem.org

(Difference between revisions)

Latest revision as of 01:37, 29 October 2013

Del Rest. Creating a 32 kb plasmid.

Week 10

This week the project "DelRest" was launched, which aims at creating a single, 32 kb plasmid enabling the expression of most genes from the D. Acidovorans Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we decided to use Gibson cloning. This weeks goal was amplify the pSB4K5 backbone from the partsregistry with primers giving the intended overlaps as well as the desired genes from our host organism D. Acidovorans . Therefore, Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a Gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed cloning strategy and primer design.

Week 11

During the past week we managed to amplify a fragment of 11 kbp encoding the genes DelA-F from genomic DNA of D. Acidovorans. We were further able to amplify the backbone fragment from pSB4K5 carrying the desired overlaps to the corresponding fragments to be amplified from the Del cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. Unfortunately, the amplification of DelF-G and DelO-P turned out to be more difficult than expected. Since our initial plan, which required the amplification of DelO-P using a Gibson primer which introduces an overlap to DelL and furthermore introduces an artificial ribosom binding site did not work out, we changed our strategy. We orderd shorter versions of all our Gibson primers. Using these shorter primers not bearing any overlaps to other fragments, we will try to amplify the desired genes in order to obtain a specific template for the reamplification with the primers carrying the needed overlaps. Furthermore, we will optimize the PCR conditions for the amplification of the DelF-G fragment.

Week 12

By the end of last week we found out, that the short primers we had ordered did not improve amplification of the missing fragments from D. Acidovorans. Additionly, further analysis of the Delftibactin cluster, led to the discovery of a predicted promoter present in front of DelO-P potentially essential for DelO-P expression. Therefore, we not only decided to design new primers for the amplyfication of DelF-G, but also modifie the entire strategy concerning the DelO-P fragment. To ensure the expression of DelO-P in our target organism E.coli we decided to amplify DelO-P together with its putative promoter. In consequence, we ordered new primers for DelO-P and also for the last DelA-G fragment in order to introduce the required new overhang to the new DelO-P fragment. The correlating primers can be found in our new vector map.

Week 13

In the previous week, several of the newly ordered primer pairs improved our PCRs for DelO-P and DelF-G. However, results were not convincing enough to use these amplicons for Gibson assembly. Therefore, we spend this week optimizing the PCRs for the abovementioned fragments. In addition we validated the amplicon of DelG with restriction digest. Validation of the other PCR products did not succeed, mostly due to very low amount of DNA.

Week 14

We were still struggeling with getting the correct amplicons for the fragments encoding DelF-G as well as DelO-P. Furthermore, the restriction digests of the already successfully amplified fragments needed to be repeated using higher amounts of DNA, as results of the previous test digests were rather inconclusive. Furthermore, samples of these fragments were send for sequencing.

Week 15

Single read sequencing of the PCR amplified fragments DelA-E, DelL as well as the backbone pSB4K5 was carried out by GATC. We blasted the obtained seqeuences against the reference sequence based on the D. acidovorans SPH-1 strain available on NCBI. Although our sequence matched to the reference sequence, we found a significant number of missmatches, which was too diverse and high to be simply explained by random mutations introduced by our polymerase during PCR (note: we used a high-fidelity proofreading polymerase suitable for GC-rich templates and long amplicons). We thus hypothesized that the SPH-1 strain based on which our cloning strategy was designed might have a significant number of single-nucleotide polymorphisms in the Del cluster compared to the D. acidovorans DSM-39 strain, which we used as template for all PCRs (note: there is no complete genomic sequence available for the DSM-39 strain on NCBI). We further hypothesized, that this difference in sequence between the DSM-39 strain used as PCR template and the SPH-1 strain based on which our primers were designed could explain our troubles with the PCR amplifications of DelF-G and DelO-P. In consequence, we ordered the SPH-1 strain from the DSMZ in order to obtain a suitable template for our PCRs. This solved all our PCR problems right away and we were able to get all amplicons required for cloning the DelRest construct within this week. Furthermore, we successfully validated our amplicons by restriction digest and sequencing.

Week 16

Last week we successfully amplified all the fragments needed to complete the DelRest cloning. Therefore, we went ahaed and performed Gibson assembly in order to assembel the final pFSN plasmid carrying bearing the DelRest genes. The assembly mix was transformed into E. coli DH10beta electrocompetent cells. Screening PCRs showed that the assembly was successful, calling for futher validation of the clones.

Week 17

From colonies which were positive for screening last week, we rescued 3 plasmids. Test restriction digest were conducted and showed our clones to be correct.

Week 18

We send one of our DelRest constructs that showed the right restriction pattern in the test digest for sequencing. As it would be quite costly to sequence the whole 32 kb plasmid, we focused on the ligation sites between the different assembly fragments, which are most prone to insertion of errors. Although all insert fragments sequenced, including the ligation sites between DelA and DelF, DelO-P and DelL, were 100 % correct, we detected a mutation within the mRFP cds (note: we wanted to use mRFP in order to confirm expression from our DelRest plasmid). FACS analysis of E. coli bearing the DelRest construnct confirmed that mRFP expression was impaired, likely due to the corresponding mutation. However, as mRFP was only meant to be a general expression control on our construct, we did not start correcting out construct by mutagenesis. Instead, we started preparing samples for an SDS page in order to directly proof the expression of the Del genes by Coomassie staining.

Week 19

The Coomassie staining we carried out last week did not display all expected bands clearly. This occured most likely due to the low amount of protein loaded onto the corresponding SDS page. Therefore the SDS page was repeated. This expression analysis confirmed the results indicated by the previous SDS-page. We were able to show that DelE and DelG are expressed at a detectable level. As we could confirm the successful cloning and functioning of the DelRest expression plasmid named pFSN (for Florian-Sophie-Nils :)) the DelRest subproject was succssfully completed and the personal resources of the DelRest group were shifted to the DelH group as well as the wiki.

Identifier	Order date	Note	Sequence
FS_01: pSB4K5_DelA_rv	20-13-06-28	Amplification of pSB4K5 from the iGEM Distribution. Gibson Primer with overhang to DelA introducing the RBS BBa_B0035	TCGCGGCGATCCGGTACTGCGCCTCTGTTGAACATCTGATATTCT CCTCTTTAATCGACAGATTGTGTGAAATTGTTATCCGCTCAC
FS_02: DelAG_1_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTCAACAGAGGCGCAGTACCGGATC
FS_03: DelAG_1_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTCGGAGACGATGTGGTGCATCAC
FS_04: DelAG_2_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CTGCAGGCCAATGAGCACATCCTG
FS_05: DelAG_2_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CACAGGTGGTAGATGGCGTC
FS_06: DelAG_3_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	ATTGCGAGGACTTGCTCGATG
FS_07: DelAG_3_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTTGCTGCAGCGCCAGCACATCGAG
FS_08: DelAG_4_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTACGGCCTATCACATCAGCG
FS_09: DelAG_4_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAAGCTCAGCAGGTTGGGCGAGACG
FS_10: DelAG_5_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAATTTTGTTCCACCACCTGCTG
FS_11: DelAG_5_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome. Gibson Primer with overhang to DelOP	CTTGAGCAGGCGCAGTACCTCGGAGGGCGGTCGGCTGGCGTTTTCCATGATTCAGG TTTCCTGTGTGAAGCTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_11: DelAG_5_short_rv	2013-08-02	Amplification of DelA-G from Delftia acidovorans genome.	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_12: DelOP_fw	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome.	GAATCATGGAAAACGCCAGCCGAC
FS_13: DelOP_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	CAATGTTGGAGGGGCCGAAGCCGATGCCGATCAGCGGGTGGGTTTGCATGGAAGGT CCTTTCATTGGGTCGATGCGTCCAGTGTCACACCGTGGTGTCTGCAGGCG
FS_13: DelOP_short_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_14: DelL_fw	2013-06-28	Amplification of DelL from Delftia acidovorans genome.	CAAACCCACCCGCTGATCGGCATC
FS_15: DelL_mRFP_pSB4K5_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	GAAACGCATGAACTCTTTGATAACGTCTTCGGAGGAAGCCATCTAGTATTTCTCCTC TTTCTCTAGTATCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_16: mRFP_pSB4K5_fw (Del)	2013-06-28	Amplification of pSB4K5 from iGEM Distribution. Gibson Primer	GCTTCCTCCGAAGACGTTATC

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-F	FS_02 and FS_05
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
	DelG	FS_08 and FS_11
DelO DelP DelL	DelO-P	FS_12 and FS_13
DelO DelP DelL	DelL	FS_14 and FS_15
pSB4K5	pSB4K5	FS_01 and FS_16

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	1
FS_03: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30 min
18	98	1
	63	5
	72	2:30 min
1	72	10 min
1	4	inf

µL 1st PCR	what	µL 2nd PCR
1	D. acidovorans DSM-39	1
2.5	FS_02 (1/10)	2.5
2.5	FS_05 (1/10)	2.5
25	Phusion Master Mix	25
-	DMSO	2.5
19	dd H₂O	19

@@ Line 1: / Line 1: @@
-{{:Team:Heidelberg/Templates/bootstrap-css}}
-{{:Team:Heidelberg/Templates/basic-css}}
-{{:Team:Heidelberg/Templates/style2-css}}
-{{:Team:Heidelberg/Templates/scrollbar-css}}
 {{:Team:Heidelberg/Templates/Navigation}}
+{{:Team:Heidelberg/Templates/scrollbar-css}}
 <html>
 <style type="text/css">
@@ Line 11: / Line 9: @@
     p  {
        font-size:14px;
+      text-align:justify;
+}
+   .carousel-inner {
+      margin-top:20%;
+}
+.tab-content .wikitable {
+ font-size:9pt;
 }
 </style>
    <div class="container">
              <!--Project Description-->
-             <div style="margin-top:80px">
+             <div>
-                         <h1><span style="font-size:180%;color:#FFCC00;">Del Rest.</span><span class="text-muted" style="font-size:120%"> Creating a 32 kbp plasmid.</span></h1>
+                         <h1><span style="font-size:180%;color:#FFCC00;">Del Rest.</span><span class="text-muted" style="font-size:120%"> Creating a 32 kb plasmid.</span></h1>
-                         <p>Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.</p>
              </div>
              <div class="row">
-             <div class="col-sm-4">
+             <div class="col-sm-12 col-md-6">
              <!--Months-->
-                 <ul class="pagination" style="margin-bottom:2%; margin-left:8%;">
+                 <ul class="pagination" style="margin-bottom:2%; margin-left:17%;">
                      <!--<button type="button" class="btn btn-default">May</button>
@@ Line 47: / Line 52: @@
              ================================================== -->
-                 <div style="margin-bottom:2%;">
+                 <div style="margin-bottom:8%;">
                      <div id="myCarousel" class="carousel slide">
                          <!-- Indicators -->
@@ Line 65: / Line 70: @@
                                        <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-This week the project DelRest was launched.
+This week the project "DelRest" was launched, which aims at creating a single, 32 kb plasmid enabling the expression of most genes from the <i>D. Acidovorans </i> Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we decided to use Gibson cloning.
-In order to clone the Delftibactin cluster from <i>D. Acidovorans </i> into <i> E.coli </i>  we decided to use Gibson cloning. Therefore Gibson primers were designed to amplify our target backbone pSB4K5 with an overlap to DelA. Furthermore the Gibson primer connecting DelOP and DelAG introduces the ribosome binding site BBa_BNILS. Accordingly the Gibson primer for joining DelL with DelOP includes the ribosome binding site BBa_BNILS. The very last gibson primer used to amplify DelL consequently has an overlap to the beginning of the mRFP reporter gene connected to pSB4K5. Check out our vectormap if you are curious about the detailed primer design. The goal of this week was to amplify our previously assembled backbone with the intended overlaps as well as the desired genes from our host organism <i>D. Acidovorans </i>.
+This weeks goal was amplify the pSB4K5 backbone from the partsregistry with primers giving the intended overlaps as well as the desired genes from our host organism <i>D. Acidovorans </i>.
+Therefore, Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a Gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed cloning strategy and primer design.
                                         </p>
@@ Line 78: / Line 83: @@
                                    <h1>Week 11</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
+During the past week we managed to amplify a fragment of 11 kbp encoding the genes DelA-F from genomic DNA of <i>D. Acidovorans</i>. We were further able to amplify the backbone fragment from pSB4K5 carrying the desired overlaps to the corresponding fragments to be amplified from the Del cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. Unfortunately, the amplification of DelF-G and DelO-P turned out to be more difficult than expected. Since our initial plan, which required the amplification of DelO-P using a Gibson primer which introduces an overlap to DelL and furthermore introduces an artificial ribosom binding site did not work out, we changed our strategy. We orderd shorter versions of all our Gibson primers. Using these shorter primers not bearing any overlaps to other fragments, we will try to amplify the desired genes in order to obtain a specific template for the reamplification with the primers carrying the needed overlaps. Furthermore, we will optimize the PCR conditions for the amplification of the DelF-G fragment.
-Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
-                                  <p><a class="btn btn-large btn-primary" href="#">Learn more</a></p>
-                                  <p>
-During the past week the managed to amplify 11 kb as a single fragment including the genes DelA to DelF from genomic DNA from <i>D. Acidovorans<i/>. Furthermore we were able to equip our biobrick backbone pSB4K5 with the desired overlaps to the genes of the Delftibactin cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. However still a lot of work has to be done, since the amplification of DelFG and DelOP turned out to be more complicated. Since our initial plan, to amplify DelOP with a Gibson primer which includes an overlaps to DelL and furthermore introduces an artificial ribosom binding site, turned out to be quite ambitious, we orderd shorter versions of all our Gibson primers, used to amplify genomic DNA. Using these shorter primers which should anneal better we will try to preamplify the desired genes in order to obtain a specific template for the amplification with the needed overlaps. Furthermore we will optimize the PCR conditions for amplification of DelFG.
                                    </p>
@@ Line 94: / Line 95: @@
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
+By the end of last week we found out, that the short primers we had ordered did not improve amplification of the missing fragments from <i>D. Acidovorans. </i> Additionly, further analysis of the Delftibactin cluster, led to the discovery of a predicted promoter present in front of DelO-P potentially essential for DelO-P expression. Therefore, we not only decided to design new primers for the amplyfication of DelF-G, but also modifie the entire strategy concerning the DelO-P fragment. To ensure the expression of DelO-P in our target organism <i> E.coli </i> we decided to amplify DelO-P together with its putative promoter. In consequence, we ordered new primers for DelO-P and also for the last DelA-G fragment in order to introduce the required new overhang to the new DelO-P fragment. The correlating primers can be found in our new vector map.
-                                  <p><a class="btn btn-large btn-primary" href="#">Browse gallery</a></p>
-                                  <p>At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed. After the Transformation to DH10β cells and screening by restriction digest we could send samples for the Dipeptide and Tetrapeptide I to sequencing and obtained a positive alignment. Hence we transformed BAP I cells with the positive constructs. The same was...
                                    </p>
@@ Line 106: / Line 105: @@
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 13</h1>
-                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-                                  <p><a class="btn btn-large btn-primary" href="#">Browse gallery</a></p>
+In the previous week, several of the newly ordered primer pairs improved our PCRs for DelO-P and DelF-G. However, results were not convincing enough to use these amplicons for Gibson assembly. Therefore, we spend this week optimizing the PCRs for the abovementioned fragments. In addition we validated the amplicon of DelG with restriction digest. Validation of the other PCR products did not succeed, mostly due to very low amount of DNA.
+</p>
                                  </div>
                                </div>
@@ Line 115: / Line 115: @@
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 14</h1>
-                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed.</p>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
+We were still struggeling with getting the correct amplicons for the fragments encoding DelF-G as well as DelO-P. Furthermore, the restriction digests of the already successfully amplified fragments needed to be repeated using higher amounts of DNA, as results of the previous test digests were rather inconclusive. Furthermore, samples of these fragments were send for sequencing.
+</p>
                                  </div>
                                </div>
@@ Line 124: / Line 126: @@
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 15</h1>
-                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-                                  <p><a class="btn btn-large btn-primary" href="#">Learn more</a></p>
+Single read sequencing of the PCR amplified fragments DelA-E, DelL as well as the backbone pSB4K5
+was carried out by GATC. We blasted the obtained seqeuences against the reference sequence based on the <i>D. acidovorans SPH-1</i> strain available on NCBI. Although our sequence matched to the reference sequence, we found a significant number of missmatches, which was too diverse and high to be simply explained by random mutations introduced by our polymerase during PCR (note: we used a high-fidelity proofreading polymerase suitable for GC-rich templates and long amplicons). We thus hypothesized that the SPH-1 strain based on which our cloning strategy was designed might have a significant number of single-nucleotide polymorphisms in the Del cluster compared to the <i>D. acidovorans</i> DSM-39 strain, which we used as template for all PCRs (note: there is no complete genomic sequence available for the DSM-39 strain on NCBI). We further hypothesized, that this difference in sequence between the DSM-39 strain used as PCR template and the SPH-1 strain based on which our primers were designed could explain our troubles with the PCR amplifications of DelF-G and DelO-P. In consequence, we ordered the SPH-1 strain from the DSMZ in order to obtain a suitable template for our PCRs. This solved all our PCR problems right away and we were able to get all amplicons required for cloning the DelRest construct within this week. Furthermore, we successfully validated our amplicons by restriction digest and sequencing.
+</p>
                                  </div>
                                </div>
@@ Line 133: / Line 137: @@
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 16</h1>
-                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-                                  <p><a class="btn btn-large btn-primary" href="#">Browse gallery</a></p>
+Last week we successfully amplified all the fragments needed to complete the DelRest cloning. Therefore, we went ahaed and performed Gibson assembly in order to assembel the final pFSN plasmid carrying bearing the DelRest genes. The assembly mix was transformed into <i>E. coli DH10beta</i> electrocompetent cells. Screening PCRs showed that the assembly was successful, calling for futher validation of the clones.
+</p>
                                  </div>
                                </div>
                              </div>
-                             <div class="item august last">
+                             <div class="item august">
                                <img src="data:image/png;base64,"/>
                                <div class="container">
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 17</h1>
-                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.</p>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-                                   <p><a class="btn btn-large btn-primary" href="#">Browse gallery</a></p>
+From colonies which were positive for screening last week, we rescued 3 plasmids. Test restriction digest were conducted and showed our clones to be correct.
+</p>
+                                </div>
+                              </div>
+                            </div>
+                             <div class="item august">
+                              <img src="data:image/png;base64,"/>
+                              <div class="container">
+                                <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                                  <h1>Week 18</h1>
+                                   <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
+We send one of our DelRest constructs that showed the right restriction pattern in the test digest for sequencing. As it would be quite costly to sequence the whole 32 kb plasmid, we focused on the ligation sites between the different assembly fragments, which are most prone to insertion of errors. Although all insert fragments sequenced, including the ligation sites between DelA and DelF, DelO-P and DelL, were 100 % correct, we detected a mutation within the mRFP cds (note: we wanted to use mRFP in order to confirm expression from our DelRest plasmid). FACS analysis of <i> E. coli </i>  bearing the DelRest construnct confirmed that mRFP expression was impaired, likely due to the corresponding mutation. However, as mRFP was only meant to be a general expression control on our construct, we did not start correcting out construct by mutagenesis. Instead, we started preparing samples for an SDS page in order to directly proof the expression of the Del genes by Coomassie staining.
+</p>
+                                </div>
+                              </div>
+                            </div>
+                             <div class="item september first">
+                              <img src="data:image/png;base64,"/>
+                              <div class="container">
+                                <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                                  <h1>Week 19</h1>
+The Coomassie staining we carried out last week did not display all expected bands clearly. This occured most likely due to the low amount of protein loaded onto the corresponding SDS page. Therefore the SDS page was repeated.
+This expression analysis confirmed the results indicated by the previous SDS-page. We were able to show that DelE and DelG are expressed at a detectable level.
+As we could confirm the successful cloning and functioning of the DelRest expression plasmid named pFSN (for Florian-Sophie-Nils :)) the DelRest subproject was succssfully completed and the personal resources of the DelRest group were shifted to the DelH group as well as the wiki.
+                                  <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
+</p>
                                  </div>
                                </div>
@@ Line 154: / Line 184: @@
                  </div>
              </div><!-- /.carousel -->
+        </div>
+<div class="col-sm-12 col-md-6" style="margin-top:7%">
+             <div class="jumbotron">
+                <div style="width:100%;">
+<a class="fancybox fancyGraphical" rel="group" href="https://static.igem.org/mediawiki/2013/e/e3/Heidelberg_ga_delf.png">
-            <div class="jumbotron methods" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+    <img style="width:100%; margin-bottom:10px; padding:1%;border-style:solid;border-width:1px;border-radius: 4px; border-color: grey;" src="https://static.igem.org/mediawiki/2013/e/e3/Heidelberg_ga_delf.png"></img>
-                <h2>Methods:</h2>
-                <p style="font-size:10pt; text-align:justify">Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .
+</a>
-                </p>
              </div>
+           </div>
+          </div>
+        </div>
+        </div>
          </div>
-         <div class="col-sm-8">
+      <div class="container">
+        <div class="row">
+         <div class="col-sm-12">
              <!--Start Weekly Labjournal-->
@@ Line 181: / Line 223: @@
                  </div>
                  <div class="jumbotron">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
@@ Line 187: / Line 229: @@
                              <div class="tab-pane active" id="a10">
                                  <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week10_overview}}<html>
                                  </p>
                              </div>
@@ Line 268: / Line 310: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a11">
                                  <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week11_overview}}<html>
                                  </p>
@@ Line 353: / Line 396: @@
                  </div>
                      <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
@@ Line 359: / Line 402: @@
                              <div class="tab-pane active" id="a12">
                                  <p style="font-size:12pt; text-align:justify;">
+                                     </html>{{:Team:Heidelberg/Templates/Del_week12_overview}}<html>
                                  </p>
                              </div>
@@ Line 421: / Line 464: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                           <div class="tab-content">
                              <div class="tab-pane active" id="a13">
                                  <p style="font-size:12pt; text-align:justify;">
+                                  </html>{{:Team:Heidelberg/Templates/Del_week13_overview}}<html>
                                  </p>
                              </div>
@@ Line 499: / Line 542: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                           <div class="tab-content">
@@ Line 505: / Line 548: @@
                              <div class="tab-pane active" id="a14">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week14_overview}}<html>
                                  </p>
                              </div>
@@ Line 568: / Line 611: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a15">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week15_overview}}<html>
                                  </p>
                              </div>
@@ Line 655: / Line 698: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a16">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week16_overview}}<html>
                                  </p>
                              </div>
@@ Line 726: / Line 769: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a17">
                                  <p style="font-size:12pt; text-align:justify;">
+                                </html>{{:Team:Heidelberg/Templates/Del_week17_overview}}<html>
                                  </p>
                              </div>
@@ Line 754: / Line 797: @@
              </div>
+            <!--Week 18-->
+            <div class="labjournal-weekly">
+                <div>
+                    <ul class="nav nav-tabs">
+                      <li class="active"><a href="#a18" data-toggle="tab">Overview</a></li>
+                      <li><a href="#z18" data-toggle="tab">Gibson assembly and validation</a></li>
+                    </ul>
+                </div>
+                <div class="jumbotron weekly">
+                    <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                       <div class="tab-content">
+                            <div class="tab-pane active" id="a18">
+                                <p style="font-size:12pt; text-align:justify;">
+                                  </html>{{:Team:Heidelberg/Templates/Del_week18_overview}}<html>
+                                </p>
+                            </div>
+                            <div class="tab-pane" id="z18">
+                                <p style="font-size:12pt; text-align:justify;">
+                               </html>{{:Team:Heidelberg/Template/Del_week18_Gibson}}<html>
+                                </p>
+                            </div>
+                       </div>
+                   </div>
+               </div>
+            </div>
+            <!--Week 19-->
+            <div class="labjournal-weekly">
+                <div>
+                    <ul class="nav nav-tabs">
+                      <li class="active"><a href="#a19" data-toggle="tab">Overview</a></li>
+                      <li><a href="#z19" data-toggle="tab">Gibson assembly and validation</a></li>
+                    </ul>
+                </div>
+                <div class="jumbotron weekly">
+                    <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                       <div class="tab-content">
+                            <div class="tab-pane active" id="a19">
+                                <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week19_overview}}<html>
+                                </p>
+                            </div>
+                            <div class="tab-pane" id="z19">
+                                <p style="font-size:12pt; text-align:justify;">
+                               </html>{{:Team:Heidelberg/Template/Del_week19_Gibson}}<html>
+                                </p>
+                            </div>
+                       </div>
+                   </div>
+               </div>
+            </div>
+          </div>
+          </div>
          </div>
      </div>
 </div>
 </html>
+{{:Team:Heidelberg/Templates/Footer-Nav}}
 {{:Team:Heidelberg/Templates/Footer-DelRest}}

Team:Heidelberg/Delftibactin/DelRest

From 2013.igem.org

Latest revision as of 01:37, 29 October 2013

Team

Project

Notebook

Parts

Software

Human Practice

Safety

Modeling

Del Rest. Creating a 32 kb plasmid.

Week 10

Week 11

Week 12

Week 13

Week 14

Week 15

Week 16

Week 17

Week 18

Week 19

Strategy

Plasmid backbone part from the partsregistry

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

06-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

03-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

04-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

05-08-2013

Amplification from FS_02 to FS_07; 16.4 kb

06-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

03-07-2013

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_11; 11.6 kb

05-07-2013

Amplification from FS_06 to FS_07; 5.2 kb

05-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

07-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

04-07-2013

Amplification from FS_12 to FS_13; 2.7 kb

04-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

06-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

05-07-2013

Amplification from FS_01 to FS_16; 4.2 kb

Strategy

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

08-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

12-07-2013

Amplification from FS_02 to FS_07; 16.4 kb

09-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

11-07-2013

Amplification from FS_04 to FS_11s; 17.5 kb

Amplification from FS_04 to FS_11; 17.5 kb; Phusion II

14-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

09-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

13-07-2013

Amplification from FS_10 to FS_11s; 3.3 kb

Amplification from FS_10 to FS_11(s); 3.3 kb

11-07-2013

Amplification from FS_13s to FS_15s; 6.4 kb

12-07-2013