Team:ETH Zurich/Experiments

From 2013.igem.org

(Difference between revisions)
 
(127 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:ETH_Zurich/Templates}}
{{:Team:ETH_Zurich/Templates}}
 +
{{:Team:ETH_Zurich/Templates/stylesheet}}
 +
 +
<h1>Final Circuit</h1>
 +
 +
<p align="justify">For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.</p>
 +
 +
<br clear="all"/>
<html>
<html>
-
<style type="text/css">
+
 
-
body, p, #eth_content {
+
 
-
  color:white;
+
 
-
  font-family: Verdana;
+
 
-
  font-size:16px;
+
<img src="https://static.igem.org/mediawiki/2013/d/d0/ETHZ_plasmidmaps.png" usemap="#map3" id="imagemap3" width="100%">
-
  margintop:2.5%;
+
 
 +
<map id="imagemap3" name="map3"><area shape="rect" alt="" title="constitutive promoter: BBa_J23100" coords="223,104,337,136" href="http://parts.igem.org/Part:BBa_J23100" target="" /><area shape="rect" alt="" title="NagZ: BBa_K1216003" coords="364,92,482,146" href="http://parts.igem.org/Part:BBa_K1216003" target="" /><area shape="rect" alt="" title="constitutive promoter: BBa_J23110" coords="218,333,334,365" href="http://parts.igem.org/Part:BBa_J23110" target="" /><area shape="rect" alt="" title="LuxI: BBa_K805016" coords="359,311,465,360" href="http://parts.igem.org/Part:BBa_K805016" target="" /><area shape="poly" alt="" title="constitutive promoter pLac in BBa_J09855" coords="839,134,946,116,952,154,844,168" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="rect" alt="" title="LuxR in BBa_J09855" coords="970,92,1088,147" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="poly" alt="" title="Lux promoter with high sensitivity: BBa_R0062" coords="1114,105,1225,114,1222,149,1107,138" href="http://parts.igem.org/Part:BBa_R0062" target="" /><area shape="poly" alt="" title="GusA: BBa_K1216000" coords="1255,105,1372,122,1366,172,1244,155" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><area shape="poly" alt="" title="SM1 Lux promoter with low sensitivity: BBa_K1216008" coords="824,363,936,343,943,381,827,395" href="http://parts.igem.org/Part:BBa_K1216007" target="" /><area shape="rect" alt="" title="Aes: BBa_K1216002" coords="959,320,1052,376" href="http://parts.igem.org/Part:BBa_K1216002" target="" /><area shape="rect" alt="" title="promoter pLuxL: BBa_R0063" coords="1092,333,1208,366" href="http://parts.igem.org/Part:BBa_R0063" target="" /><area shape="rect" alt="" title="LacI: BBa_J24679" coords="1241,333,1358,382" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><!-- Created by Online Image Map Editor (http://www.maschek.hu/imagemap/index) --></map>
 +
<br clear="all"/>
 +
<b>Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.</b>
 +
 
 +
<script type="text/javascript">
 +
(function($) {
 +
function img(url) {
 +
var i = new Image;
 +
i.src = url;
 +
return i;
}
}
 +
 +
if ('naturalWidth' in (new Image)) {
 +
$.fn.naturalWidth = function() { return this[0].naturalWidth; };
 +
$.fn.naturalHeight = function() { return this[0].naturalHeight; };
 +
return;
 +
}
 +
$.fn.naturalWidth = function() { return img(this[0].src).width; };
 +
$.fn.naturalHeight = function() { return img(this[0].src).height; };
 +
})(jQuery);
-
h1, #eth_content {
+
 
-
  color:black;
+
 
-
  font-family: Verdana;
+
function onWindowResize()
-
  font-size:22px;
+
{
-
  margin-left:6px;
+
  var curWidth = $(window).width(),
 +
  curHeight = $(window).height(),
 +
  checking=false;
 +
  if (checking) {
 +
      return;
 +
  }
 +
  checking = true;
 +
  window.setTimeout(
 +
    function() {
 +
        var newWidth = $(window).width(),
 +
            newHeight = $(window).height();
 +
        if (!(newWidth !== curWidth ||
 +
            newHeight !== curHeight)) {
 +
            resize(false);
 +
        }
 +
        checking=false;
 +
    }, 300);
}
}
-
b, #eth_content {
 
-
  color:black;
 
-
  font-family: Verdana;
 
-
  font-size:18px;
 
-
</style>
+
function resize(initial) {
 +
 
 +
if (navigator.userAgent.match(/msie/i))
 +
{
 +
    if ($("#bxsliderText").parent().css("height") != $("#bxslider").parent().css("height"))
 +
        setTimeout(function() {$( "#bxsliderText" ).parent().css({"height": $("#bxslider").parent().css("height")});}, 100);
 +
}
 +
 
 +
if (!initial)
 +
{
 +
    var container =  $('#bxslider > li');
 +
    var imgWidth = container.width();
 +
 
 +
  $( "#imagemap3" ).each(function() {
 +
      $(this).css('height', 'auto', 'width', 'auto');
 +
      $(this).mapster('resize',Math.min(imgWidth, $(this).naturalWidth()) ,0,0); 
 +
  });
 +
}
 +
 
 +
}
 +
 
 +
 
 +
$(document).ready(function(){
 +
  sliderText = $('#bxsliderText').bxSlider({'mode': 'fade', 'controls': false, 'pager': false, 'auto': false, "responsive": false, 'touch': false});
 +
  slider = $('#bxslider').bxSlider({ 'auto': false, onSlideAfter: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}, onSlideBefore: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}});
 +
  $('#bxsliderText').parent().css({"height": "100%", 'min-height' : '430px'});
 +
  $('#bxsliderText').parent().parent().css({"height": "100%"});
 +
  $('.bx-viewport #bxslider').bind('mousewheel', function(event, delta, deltaX, deltaY) {
 +
            event.preventDefault();
 +
            if (delta < 0) {slider.goToNextSlide();}
 +
            else {slider.goToPrevSlide();}
 +
          });
 +
  $('#imagemap3').mapster({
 +
    fillColor: 'c2d8f1',
 +
    fillOpacity: 0.6, /*
 +
    stroke: true,
 +
    strokeColor: 'c2d8f1',
 +
    strokeOpacity: 0.7,
 +
    strokeWidth: 2, */
 +
    clickNavigate: true
 +
  });
 +
 
 +
 
 +
$(window).resize(
 +
  function()
 +
  {
 +
onWindowResize();
 +
  });
 +
resize(true);
 +
});
 +
</script>
</html>
</html>
-
<b>Tranformation and cloning constructs</b>
+
<br><h1>Cloned Constructs</h1>
-
<hr>
+
<p align="justify">To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.</p>
-
<table style="float:left;margin-top:10px">
+
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px">
 +
<th colspan="4" height="30px">Fluorescent protein reporter constructs</th>
<tr>
<tr>
-
<th>Sender cells</th>
+
<th width="20px" height="30px"> </th>
-
<th colspan="2">Receiver cells</th>
+
<th width="475px" height="30px">Description</th>
 +
<th width="475px" height="30px">Cloning</th>
 +
<th width="350px" height="30px">Maps</th>
</tr>
</tr>
 +
<tr>
<tr>
-
<th>AHL expressing system </th>
+
<td>1</td>
-
<th>Fluorescent reporter system</th>
+
<td>Receiver cell construct for GFP diffusion experiments</td>
-
<th>Enzyme reaction-based reporter system</th>
+
<td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla1.png|300px]<br>[File:Pla2.png|300px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons-LuxI 1 (Strong)</td>
+
<td>2</td>
-
<td>Plac-LuxR-Plux-GFP</td>
+
<td>Library of the Receiver cell constructs</td>
-
<td>Plac-LuxR-Plux-LacZ</td>
+
<td>Using the Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities<br>Primers:<br>5'-tatactagagac<b>nnn</b>taggatcgtacag<br>5'-gatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagac<b>nnn</b>taggatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.</td>
 +
<td>[[File:Pla3.png|300px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons-LuxI 2 </td>
+
<td>3</td>
-
<td>Plac-LuxR-Plux-YFP</td>
+
<td>Receiver cell construct for GFP experiments without the LuxR generating part</td>
-
<td>Plac-LuxR-Plux-Aes</td>
+
<td>[http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla4.png|225px]]<br>[[File:Pla5.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons-LuxI 3 </td>
+
<td>4</td>
-
<td>Plac-LuxR-Plux-CFP</td>
+
<td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td>
-
<td>Plac-LuxR-Plux-GusA</td>
+
<td>Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
 +
<br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td>
 +
<td>[[File:Pla6.png|300px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons-LuxI 4 (Weak) </td>
+
<td>5</td>
-
<td></td>
+
<td>Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell</td>
-
<td>Plac-LuxR-Plux-PhoA</td>
+
<td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from [http://parts.igem.org/Part:BBa_J23118 BBa_J23118]</td>
-
</tr>
+
<td>[[File:Pla7.png|225px]]</td>
-
<tr>
+
-
<td></td>
+
-
<td></td>
+
-
<td>Plac-LuxR-Plux-NagZ</td>
+
</tr>
</tr>
 +
</table>
</table>
-
<table style="float:right;margin-top:10px">
+
<br clear="all"/>
 +
 
 +
 
 +
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px">
 +
<th colspan="4" height="30px">LuxI generating constructs</th>
<tr>
<tr>
-
<th>Biobrick</th>
+
<th width="20px" height="30px"> </th>
-
<th>Registry part</th>
+
<th width="475px" height="30px">Description</th>
 +
<th width="475px" height="30px">Cloning</th>
 +
<th width="350px" height="30px">Maps</th>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>LuxI</td>
+
<td>6</td>
-
<td>K805016</td>
+
<td>Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td>
 +
<td>[http://parts.igem.org/Part:BBa_J23100 BBa_J23100] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons 1 (Strong)</td>
+
<td>7</td>
-
<td>J23100</td>
+
<td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td>
 +
<td>[http://parts.igem.org/Part:BBa_J23118 BBa_J23118] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons 2 </td>
+
<td>8</td>
-
<td>J23110</td>
+
<td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td>
 +
<td>[http://parts.igem.org/Part:BBa_J23110 BBa_J23110] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Pcons 3 </td>
+
<td>9</td>
-
<td>J23114</td>
+
<td>Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td>
 +
<td>[http://parts.igem.org/Part:BBa_J23114 BBa_J23114] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td>
</tr>
</tr>
 +
 +
</table>
 +
<br clear="all"/>
 +
 +
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px">
 +
<th colspan="4" height="30px">LuxR generating constructs</th>
<tr>
<tr>
-
<td>Pcons 4 (Weak) </td>
+
<th width="20px" height="30px"> </th>
-
<td>J23118</td>
+
<th width="475px" height="30px">Description</th>
 +
<th width="475px" height="30px">Cloning</th>
 +
<th width="350px" height="30px">Maps</th>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Mutagenized promoter 1 <br>( low [AHL])</td>
+
<td>10</td>
-
<td>Optimized Biobrick !</td>
+
<td>constitutive LuxR generating biobrick</td>
 +
<td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855]</td>
 +
<td>[[File:Pla10.png|250px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Mutagenized promoter 2 <br>( middle [AHL])</td>
+
<td>11</td>
-
<td>Optimized Biobrick !</td>
+
<td>constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations</td>
 +
<td>[http://parts.igem.org/Part:BBa_F2621 BBa_F2621]</td>
 +
<td>[[File:Pla11.png|250px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Mutagenized promoter 3<br>( high [AHL])</td>
+
<td>12</td>
-
<td>Optimized Biobrick !</td>
+
<td>negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system</td>
 +
<td>[http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert (XbaI, PstI)</td>
 +
<td>[[File:Pla12.png|225px]]</td>
</tr>
</tr>
 +
 +
 +
</table>
 +
<br clear="all"/>
 +
 +
 +
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px">
 +
<th colspan="4" height="30px"> pLuxR constructs </th>
<tr>
<tr>
-
<td>pLuxR</td>
+
<th width="20px" height="30px"> </th>
-
<td>R0062</td>
+
<th width="475px" height="30px">Description</th>
 +
<th width="475px" height="30px">Cloning</th>
 +
<th width="350px" height="30px">Maps</th>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Plux</td>
+
<td>13</td>
-
<td></td>
+
<td>Library of pLuxR promoter variants in pSB1C3 backbone for cloning</td>
 +
<td> The promoter variants were chosen after characterization and sequencing with the GFP receiver library. The sequences were ordered as custom-made oligos and inserted into pSB1C3 using EcoRI and PstI restriction sites.<br>Oligos:<br>5'-accagtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accggtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-acccgtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accagtaggatcgtaaaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accagtaggatcgtataggtttacgcaagaaaatggtttgttatagtcgaataaa<br></td>
 +
<td>[[File:Pla13.png|225px]]</td>
</tr>
</tr>
 +
</table>
 +
 +
 +
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px">
 +
<th colspan="4" height="30px">Hydrolase constructs</th>
<tr>
<tr>
-
<td>Plac</td>
+
<th width="20px" height="30px"> </th>
-
<td></td>
+
<th width="475px" height="30px">Description</th>
 +
<th width="475px" height="30px">Cloning</th>
 +
<th width="350px" height="30px">Maps</th>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>GFP</td>
+
<td>14</td>
-
<td>E0840</td>
+
<td>Aes coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.<br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br>5'-gtttcttcctgcagcggccgctactagtattattaaagctgagcggtaaagaactgag</td>
 +
<td>[[File:Pla14.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>YFP</td>
+
<td>15</td>
-
<td>E0030</td>
+
<td>Aes-His coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216006 BBa_K1216006] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br>
 +
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td>
 +
<td>[[File:Pla15.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>CFP</td>
+
<td>16</td>
-
<td>E0020</td>
+
<td>GusA coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattattgtttgcctccctgctgcg</td>
 +
<td>[[File:Pla16.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>LacZ</td>
+
<td>17</td>
-
<td>I732006</td>
+
<td>GusA-His coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216004 BBa_K1216004] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td>
 +
<td>[[File:Pla17.png|225px]]</td>
</tr>
</tr>
-
<td>GusA</td>
+
 
-
<td>New Biobrick !</td>
+
<tr>
<tr>
-
<td>PhoA</td>
+
<td>18</td>
-
<td>New Biobrick !</td>
+
<td>PhoA coding region with RBS in SB1C3 backbone</td>  
 +
<td>[http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattacttcaggcccagcgccgctttc</td>
 +
<td>[[File:Pla18.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Aes</td>
+
<td>19</td>
-
<td>New Biobrick !</td>
+
<td>PhoA-His coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216005 BBa_K1216005] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td>
 +
<td>[[File:Pla19.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>NagZ</td>
+
<td>20</td>
-
<td>New Biobrick !</td>
+
<td>NagZ coding region with RBS in SB1C3 backbone</td>
 +
<td>[http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br>5'-gtttcttcctgcagcggccgctactagtattattactcgtgacctgctttctcttc</td>
 +
<td>[[File:Pla20.png|225px]]</td>
</tr>
</tr>
-
</table>
 
-
<br><br><br><br><br><br><br><br><br><br><br>
 
-
Here we will paste some circuit designs
 
-
 
-
<br clear="all"/>
 
-
 
-
<b>Enzyme-substrate reactions</b>
 
-
<hr>
 
-
<p>We have cloned fluorescent receiver systems as backup for our circuit in case the hydrolase reaction do not work properly.<br>The enzyme substrate reactions take less than 5 minutes and are visible by eye.<br><br> Our minesweeper become better and better so keep on track for updates !</p>
 
-
 
-
<table style="float:left;margin-top:10px">
 
<tr>
<tr>
-
<th colspan="2">Hydrolase</th>
+
<td>21</td>
-
<th colspan="2">Complementary substrate / IUPAC name</th>
+
<td>constitutive expression of PhoA for non-mine cells</td>
-
<th>Visible color</th>
+
<td>constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001]insert (XbaI, PstI)</td>
 +
<td>[[File:Pla21.png|225px]]<br>[[File:Pla22.png|225px]]</td>
</tr>
</tr>
 +
<tr>
<tr>
-
<td>LacZ</td>
+
<td>22</td>
-
<td>Beta-Galactosidase</td>
+
<td>constitutive expression of NagZ for mine cells</td>
-
<td>X-Gal</td>
+
<td>constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003]insert (XbaI, PstI)</td>
-
<td>5-Bromo-4chloro-3-indolyl-beta-galactopyranoside</td>
+
<td>[[File:Pla23.png|225px]]<br>[[File:Pla24.png|225px]]</td>
-
<td style="color:blue">Blue</td>
+
</tr>
</tr>
 +
<tr>
<tr>
-
<td>LacZ</td>
+
<td>23</td>
-
<td>Beta-Galactosidase</td>
+
<td>AHL inducible expression of GusA</td>
-
<td>Green-beta-D-Gal</td>
+
<td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000]insert (XbaI, PstI)</td>
-
<td>N-Methyl-3-indolyl-beta-D_galactopyranoside</td>
+
<td>[[File:Pla25.png|300px]]<br>[[File:Pla26.png|300px]]</td>
-
<td style="color:Green">Green</td>
+
</tr>
</tr>
 +
<tr>
<tr>
-
<td>GusA</td>
+
<td>24</td>
-
<td>Beta-glucuronidase</td>
+
<td>AHL inducible expression of GusA with positive feedback loop for LuxR expression</td>
-
<td>Magenta glucuronide</td>
+
<td>Plac-LuxR-pLuxR BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
-
<td>6-chloro-3-indolyl-beta-D-glucuronide-cycloheylammonium salt</td>
+
<br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td>
-
<td style="color:Red">Red</td>
+
<td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td>
</tr>
</tr>
 +
 +
<tr>
<tr>
-
<td>PhoA</td>
+
<td>25</td>
-
<td>Alkaline phosphatase</td>
+
<td>AHL inducible expression of Aes</td>
-
<td>pNPP</td>
+
<td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002]insert (XbaI, PstI)</td>
-
<td>4-Nitrophenylphosphatedi(tris) salt</td>
+
<td>[[File:Pla29.png|300px]]</td>
-
<td style="color:Yellow">Yellow</td>
+
</tr>
</tr>
 +
<tr>
<tr>
-
<td>Aes</td>
+
<td>26</td>
-
<td>Carboxyl esterase</td>
+
<td>AHL inducible expression of Aes with mutant pLux promoter</td>
-
<td>Magenta butyrate</td>
+
<td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] (SpeI,PstI) insert</td>
-
<td>5-bromo-6-chloro-3-indoxyl butyrate</td>
+
<td>[[File:Pla30.png|225px]]</td>
-
<td style="color:Magenta">Magenta</td>
+
-
</tr>
+
-
<tr>
+
-
<td>NagZ</td>
+
-
<td>Glycoside hydrolase</td>
+
-
<td>X-glucosaminide X-Glunac</td>
+
-
<td>5-bromo-4-chloro-3-indolyl-N-acetyl-beta-D-glucosaminide</td>
+
-
<td style="color:Lightblue">Blue</td>
+
</tr>
</tr>
 +
 +
</table>
</table>
 +
 +
<html>
 +
<style type="text/css">
 +
#groupparts
 +
{
 +
    width:100% !important;
 +
    height:170px !important;
 +
   
 +
}
 +
#groupparts .pgrouptable {
 +
  width:100% !important;
 +
  height:auto !important;
 +
  font-family: Verdana !important;
 +
  font-size:18px !important;
 +
}
 +
#eth_content{
 +
  height:100% !important;
 +
}
 +
</style>
 +
</html>
<br clear="all"/>
<br clear="all"/>
 +
<br><br>
 +
<h1>Groupparts / Biobricks</h1>
 +
 +
<p> In the following table you can find all the biobricks that were submitted by our group. </p>
 +
<br>
 +
<groupparts>iGEM2013 ETH_Zurich</groupparts>
 +
 +
<br clear="all"/>
 +
 +
{{:Team:ETH_Zurich/templates/footer}}

Latest revision as of 19:22, 28 October 2013

Header2.png
80px-Eth igem logo.png

Contents

Final Circuit

For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.



Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.


Cloned Constructs

To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.

Fluorescent protein reporter constructs
Description Cloning Maps
1 Receiver cell construct for GFP diffusion experiments Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI) 300px][File:Pla2.png
2 Library of the Receiver cell constructs Using the Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities
Primers:
5'-tatactagagacnnntaggatcgtacag
5'-gatcgtannngtttacgcaagaaaatg
5'-tagagacnnntaggatcgtannngtttacgcaagaaaatg
5'-tagagaccnntaggatcgtanangtttacgcaagaaaatg
5'-tagagacctntaggatcgtacangtttacgcaagaaaatg
Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.
Pla3.png
3 Receiver cell construct for GFP experiments without the LuxR generating part [http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI) Pla4.png
Pla5.png
4 Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.
Oligos:
5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct
5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt
Pla6.png
5 Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from [http://parts.igem.org/Part:BBa_J23118 BBa_J23118] Pla7.png



LuxI generating constructs
Description Cloning Maps
6 Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Pla8.png
Pla9.png
7 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23118 BBa_J23118] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Pla8.png
Pla9.png
8 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23110 BBa_J23110] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Pla8.png
Pla9.png
9 Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23114 BBa_J23114] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Pla8.png
Pla9.png


LuxR generating constructs
Description Cloning Maps
10 constitutive LuxR generating biobrick Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] Pla10.png
11 constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations [http://parts.igem.org/Part:BBa_F2621 BBa_F2621] Pla11.png
12 negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system [http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert (XbaI, PstI) Pla12.png



pLuxR constructs
Description Cloning Maps
13 Library of pLuxR promoter variants in pSB1C3 backbone for cloning The promoter variants were chosen after characterization and sequencing with the GFP receiver library. The sequences were ordered as custom-made oligos and inserted into pSB1C3 using EcoRI and PstI restriction sites.
Oligos:
5'-accagtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accggtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-acccgtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accagtaggatcgtaaaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accagtaggatcgtataggtttacgcaagaaaatggtttgttatagtcgaataaa
Pla13.png


Hydrolase constructs
Description Cloning Maps
14 Aes coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattaaagctgagcggtaaagaactgag
Pla14.png
15 Aes-His coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216006 BBa_K1216006] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla15.png
16 GusA coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattattgtttgcctccctgctgcg
Pla16.png
17 GusA-His coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216004 BBa_K1216004] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla17.png
18 PhoA coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattacttcaggcccagcgccgctttc
Pla18.png
19 PhoA-His coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216005 BBa_K1216005] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla19.png
20 NagZ coding region with RBS in SB1C3 backbone [http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattactcgtgacctgctttctcttc
Pla20.png
21 constitutive expression of PhoA for non-mine cells constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001]insert (XbaI, PstI) Pla21.png
Pla22.png
22 constitutive expression of NagZ for mine cells constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003]insert (XbaI, PstI) Pla23.png
Pla24.png
23 AHL inducible expression of GusA Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000]insert (XbaI, PstI) Pla25.png
Pla26.png
24 AHL inducible expression of GusA with positive feedback loop for LuxR expression Plac-LuxR-pLuxR BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.
Oligos:
5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct
5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt
Pla27.png
Pla28.png
25 AHL inducible expression of Aes Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002]insert (XbaI, PstI) Pla29.png
26 AHL inducible expression of Aes with mutant pLux promoter Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] (SpeI,PstI) insert Pla30.png




Groupparts / Biobricks

In the following table you can find all the biobricks that were submitted by our group.


<groupparts>iGEM2013 ETH_Zurich</groupparts>