Team:Heidelberg/Delftibactin/DelH

From 2013.igem.org

(Difference between revisions)

Revision as of 20:07, 1 October 2013

Del H. This bitchy 18 kbp fragment.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Week 1

In order to transfer the gold precipitating NRPS from D. acidovorans to E.coli, the necessary modules will be amplified from the D. acidovorans genome and assembled as plasmids. Due to its large size of 18 Kb, the module DelH will be expressed on a separate plasmid. A strategy was developed, primers designed accordingly and necessary BioBricks obtained from the distribution. The D. acidovorans was obtained from the DSMZ and cultured in Acidovorax complex medium.

Week 2

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed. After the Transformation to DH10β cells and screening by restriction digest we could send samples for the Dipeptide and Tetrapeptide I to sequencing and obtained a positive alignment. Hence we transformed BAP I cells with the positive constructs. The same was...

Week 3

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed. After the Transformation to DH10β cells and screening by restriction digest we could send samples for the Dipeptide and Tetrapeptide I to sequencing and obtained a positive alignment. Hence we transformed BAP I cells with the positive constructs. The same was...

Week 4

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 5

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed.

Week 6

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 7

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 8

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 9

In order to transfer the gold precipitating NRPS from D. acidovorans to E.coli, the necessary modules will be amplified from the D. acidovorans genome and assembled as plasmids. Due to its large size of 18 Kb, the module DelH will be expressed on a separate plasmid. A strategy was developed, primers designed accordingly and necessary BioBricks obtained from the distribution. The D. acidovorans was obtained from the DSMZ and cultured in Acidovorax complex medium.

Week 10

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed. After the Transformation to DH10β cells and screening by restriction digest we could send samples for the Dipeptide and Tetrapeptide I to sequencing and obtained a positive alignment. Hence we transformed BAP I cells with the positive constructs. The same was...

Week 11

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed. After the Transformation to DH10β cells and screening by restriction digest we could send samples for the Dipeptide and Tetrapeptide I to sequencing and obtained a positive alignment. Hence we transformed BAP I cells with the positive constructs. The same was...

Week 12

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 13

At the beginning of the week, we could verify that the Gibson Assembly for Tripeptide I was indeed positive, however, the other Gibson Assemblies did not work properly. Instead of picking new colonies, we decided to optimize the Gibson recipe instead, as backbone religations were the most common problem. With these improved protocols, we used Gibson Assembly for the Dipeptide, Tripeptide II and Tetrapeptide I, later that week, Tetrapeptide II followed.

Week 14

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 15

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 16

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 17

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Week 18

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Methods:

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .

Overview
Experiments

test

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Part of the registry	Plate of 2012	Well	Resistance
pSB4K5 (insert=J04450)	1	5G	Kanamycin
pSB6A1 (insert=J04450)	1	1K	Ampicillin
lacZ (I732019) in pSB1AK3	4	12G	Kanamycin, Ampicillin
AraC (I0500) in pSB2K3	1	14N	Kanamycin
pSB1C3 (insert=J04450)	1	3A	Chloramphenicol

Added 10 µl H₂O to each well
Incubated for 10 min at RT
Thawed 5x chemical competent E.coli Top10
3 µl of plasmid DNA were added
Incubated for 10 min on ice
Heat shock for 40 s at 42.2°C
Incubated for 10 min on ice
Added 500 µl LB Medium
Incubated at 37°C for 40 min
Centrifuged 120 at 5,000 rpm, supernatant discarded
Pellet resuspended in remaining medium
Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
Incubated for 2 days at RT
One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above

Result

All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.

Amplification of DelH Fragments

Design of Primers

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Overview
Experiments

test

Amplification of 2

06-05 - 12-05-13

Amplification of BioBricks

Miniprep of BioBricks

Miniprep was performed using Qiagen kit and eluted in 35 µl ddH₂O.
From 500 µl of liquid culture, a glycerol stock was prepared as described in Preparing glycerol stocks.

Result

DNA concentration was determined using nanovue.

Sample	Concentration [ng/µl]
pSB4K5	21
pSB6A1	47
lacZ	45
pSB1C3	23

Generation of Plasmid Backbones

Restriction Digest of BioBrick pSB6A1

Component	Amount [µl]
PSB6A1 DNA	32.5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	4.5

Result

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified DelH fragment 1 , l6-7:amplified DelH fragment 2,l8:2log, l9: P3 (pSB1C3)

The fragments of plasmids pSB4K5 and pSB1C3 show the expected pattern.

=> BioBrick backbone was cut and gel isolated.

Generation of LacZ Fragment

Restriction Digest of BioBrick pSB1AK3 Conditions A

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB3 buffer (10x)	5
Enzymes (XbaI and PstI)	1.5 each
ddH₂O	4.5

Incubation for 1 h at 37°C

Result

The restriction mix was loaded onto a 1% agarose gel using 6 µl gene ruler marker.

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified F1 for Backbone (pSB6A1), l6-7:amplified fragment 2 for Backbone (lacZ),l8:2log, l9: P3 (pSB13)

The fragments show the expected pattern.

=> LacZ insert were cut and gel isolated.

Restriction Digest of BioBrick K173004(lacZ) Conditions B

Component	Amount [µl]
pSB1AK3 DNA	8.3
BSA (10x)	5
NEB4 buffer (10x)	5
Enzymes (XbaI & SalI-HF)	1.5 each
ddH₂O	28.7

Purification was performed with Qiagen Nucleotide removal Kit and eluted in 38.5 µl ddH₂O

Result

2.5 µl were measured with the Nanovue. The measurement proved the failure of miniprep.

Restriction Digest of BioBrick K173004(lacZ) Conditions C

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB 3 buffer (10x)	5
Enzyme (PstI)	1.5
ddH₂O	-

Result

Fig.2.2 Gel of cut lacZ (loaded 20 µL)
, l1-2: lacz & pSB1AT,l3:2log ladder
=> lacZ was cut out

=>The band was too high on gel and discarded, because we cannot be sure if it really is lacZ or the backbone of the lacZ plasmid.

Generation of AraC Fragment

Amplification of BioBricks containing I13453 and K206000

The transformation was performed as described on 03-05 and incubated ON at 37°.

Amplification of DelH F1

PCR Conditions F1.W2.A

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1
	62	5
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 10 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l1:2log ladder, l5-6:DelH-F2
no specific band at 10 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.B

Reagent	DelH-fragment1	DelH-fragment1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.4 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2:DelH-F1 amplified from DNA, l3:DelH-F1 amplified from cells
no specific band at 10 Kb

PCRs showed only unspecific bands.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.C

Reagent	DelH F1	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10	10
Template	1 µl D. acidovorans normal	1 µl D. acidovorans normal	1 µl D. acidovorans 1:25	1 µl D. acidovorans 1:25
DelH_f1_PacI_fw	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
DelH_f1_SalI_rev	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
DMSO	-	-	2.5 µl	2.5 µl
ddH₂O	23 µl	23 µl	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.5 Gel of DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2-9: F1 with different conditions => l9 shows the best match

PCR with DMSO and 1:10 diluted primer looked best.

=> Gel extraction performed.

Amplification of DelH F2

PCR Conditions F2.W2.A

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1 s
	62	5 s
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 8 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l4:2log ladder, l5-6:DelH-F2
no specific band at 8 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F2.W2.B

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
30	72	2:45 min
1	72	5 min
1	4	inf

Results

Expected band: 8 Kb

Fig.2.6 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:DelH-F1 amplified from DNA, l2:DelH-F1 amplified from cells, l3:2log ladder
no specific band at 8 Kb

Gel shows the expected specific band at 8 Kb.

=> DelH F2 was thus successfully amplified from the glycerol stock.

Overview
Experiments

test

Amplification of 1

13-05 - 19-05-13

Amplification of DelH F1

Gel Purification

45 µl of DelH F1 PCR (08-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH₂O.

Result

Sample	Concentration [ng/µl]
DelH F1	7

=> Because the concentration is so low, a re-PCR of the PCR product (08-05) is going to be done.

re-PCR Conditions F1.W3.A

Reagent	DelH F1
Expected length [Kb]	10
Template	1 µl 1:10 gel purified F1
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl
DMSO	2.5 µl
ddH₂O	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	3:30 min
72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.1 PCR of DelH fragment 1 (loaded 20 µL)
l1:fragment 1 of DelH, l2: 2log ladder

Different unspecific bands were observed.

=> Test digest to confirm identity.

Test Restriction Digest

PCR product of DelH-F1	BSA	NEBuffer 4	Enzymes	ddH₂O	Total amount
18 µl	5 µl	5 µl	2x 1.5 µl SalI-HF & PacI	19 µl	50 µl

Afterwards, purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F1.

PCR Conditions F1.W3.B

Reagent	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10
Template	Picked colony	Picked colony	Picked colony
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl	25 µl
DMSO	1.5 µl	2.5 µl	5 µl
ddH₂O	21.5 µl	20.5 µl	18 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
1	72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2-4: fragment 1 of DelH, l5: fragment 2 of DelH

There is only an unspecific band at the second PCR of F1 with 2.5 µl DMSO.

=> Repeat using DMSO and altered PCR program.

PCR Conditions F1.W3.C

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl glycerol stock	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	2.5 µl
ddH₂O	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
1	72	3:30 min
1	4	inf

Result

Expected length: 10 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH, l4: fragment 1 of DelH, l5: fragment 2 of DelH

There was no band visible.

=> Repeat using DMSO and altered PCR program.

Amplification of DelH F2

Gel Purification

45 µl of DelH F1 PCR (07-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH₂O.

Result

Sample	Concentration [ng/µl]
DelH F2	6

=> Because the concentration is so low, a re-PCR of the PCR product (07-05) is going to be done.

Re-PCR Conditions F2.W3.A

Reagent	DelH-fragment2
Expected length [Kb]	8
Template	1 µl 1:10 gel purified F2
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	2.5 µl
ddH₂O	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
	66	5 s
	72	3:30 min
72	3:30 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.4 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 2 of DelH

Specific band was observed.

=> Test digest to confirm identity.

Test Restriction Digest

PCR product of DelH-F1	BSA	NEBuffer 4	Enzymes	ddH₂O	Total amount
18 µl	5 µl	5 µl	2x 1.5 µl SalI-HF & KpnI-HF	19 µl	50 µl

Afterwards, a purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F2.

PCR Conditions F2.W3.B

Reagent	DelH F2
Expected length [Kb]	8
Template	Picked colony
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There is no band visible.

=> Repeat using altered PCR program.

PCR Conditions F2.W3.B

Reagent	DelH F2
Expected length [Kb]	8
Template	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There was a specific band at 8 Kb

=> Fragment was cut and gel extracted.

Generation of Backbone pSB6A1-AraC-lacZ

Miniprep of Amplified Parts

DH10ß containing I13453 and K20600 (for AraC) and backbone pSB1AK3 (lacZ) were grown ON at 37°C and minipreped.

Result

Sample	Concentration [ng/µl]
lacZ	42.5
AraC (5)	26.5
AraC (6)	34.5

Restriction Digest

AraC was cut with EcoRI-HF and SpeI buffered in NEB4
LacZ was cut with XbaI and PstI buffered in NEB3

Reagent	Amount [µl]
DNA	22.5
Enzymes	1.5 each
Buffer (10x)	5
BSA (10x)	5
ddH₂O	14.5

Incubated for 1h at 37°C
Purified with Qiagen Kit and diluted in 20 µl ddH₂O

Result

Sample	Concentration [ng/µl]
lacZ	33.5
AraC (5)	19.5
AraC (6)	25.5

Ligation of pSB6A1, AraC and lacZ

Reagent	Amount [µl]
pSB6A1	1.5
lacZ	4
AraC	3
Ligase	1.5
Buffer	2
ddH₂O	8.5

Incubated at RT for 45 min
Chemical transformation of competent DH10ß
Streaked on LB Amp plates
Incubation ON at 37°C

Miniprep of pSB6A1-AraC-lacZ

One colony each was picked and grown in 2 ml LB Amp ON
Cultures were minipreped.

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ (5)	57
pSB6A1-AraC-lacZ (6)	73

Restriction Digest of Backbone pSB6A1-AraC-lacZ

AraC-lacZ was cut from pSB6A1-AraC-lacZ using PstI & EcoRI-HF

Reagent	Amount [µl]
Miniprep DNA	10
Enzymes	1.5 each
Buffer NEB 2(10x)	5
BSA (10x)	5
ddH₂O	27

Incubated for 1 h at 37°C
Purified with Qiagen kit and diluted in 20 µl ddH₂O

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ (5) D+P	18
pSB6A1-AraC-lacZ (6) D+P	26

Ligation of AraC-lacZ with pSB1C3

Reagent	Amount [µl]
DNA of pSB1C3	10
DNA of AraC-lacZ (6)	5
Ligase	1
Buffer	2
ddH₂O	2

Incubated at RT for 50 min
Heat inactivation at 70°C for 5 min
10 µl were used for a chemical transformation in TOP10 and plated on LB Chlor
Incubation ON at 37°C

Conlony-PCR Conditions BB.W3.A

Reagent	psB1C3-AraC-lacZ (5)
Expected length [Kb]	?
Template	Picked colony of psB1C3-AraC-lacZ (5)
Primer 10 µM fw	0.5 µl
Primer 10 µM rev	0.5 µl
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	24 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	1:30 min
1	72	1:30 min
1	4	inf

Result

Expected length:

Fig.3.5 PCR of BB psB1C3-AraC-lacZ(loaded 20 µL)
l1:2log ladder, l2: psB1C3-AraC-lacZ
no yield

There was no fragments visible.

=> Is picked coloniy negative or did entire ligation not work out?

Overview
Experiments

test

Amplification of 1

20-05 - 26-05-13

DelH Fragment F1a

The new primer arrived.

PCR Conditions F1a.W4.A

Reagent	DelH F1a	DelH F1a
Expected length [Kb]	5	5
Template	1 µl D. acidovorans	1 µl D. acidovorans
Primer fw 10 µM	DN01	DN01
Primer rev 10 µM	DN08	DN08
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	-
ddH₂O	20,5	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	62	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Results

Expected band: 5 Kb

Fig.4.1 PCR ofDelH-fragments and pSB1C3(loaded 20 µL)
l1:2log ladder, l2-3: DelH-F1a without DMSO, l4-5: DelH-F1a with DMSO, l6-7: DelH-F1b, l8:2log ladder, l9:pSB1C3 l10: pSB1C3-AraC-lacZ

The gel shows a lot unspecific bands for both DelH F1a samples.

=> Alter PCR conditions.

DelH F1b

The new primer arrived

PCR Conditions F1b.W4.A

Reagent	DelH F1b
Expected length [Kb]	5
Template	1 µl D. acidovorans
Primer fw 10 µM	DN07
Primer rev 10 µM	DN02
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	62	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.4.1 PCR ofDelH-fragments and pSB1C3(loaded 20 µL)
l1:2log ladder, l2-3: DelH-F1a without DMSO, l4-5: DelH-F1a with DMSO, l6-7: DelH-F1b, l8:2log ladder, l9:pSB1C3 l10: pSB1C3-AraC-lacZ

The gel shows a lot unspecific bands for DelH F1b, but also the band at 5 Kb.

=> Band was cut and gel isolated.

Generation of Backbone pSB6A1-AraC-lacZ

Miniprep

From three different clones, 2ml of pSB6A1-AraC-lacZ (6) in LB Amp were minipreped and eluted in 30 µl ddH₂O. Additionally, a glycerol stock was prepared.

Result

Sample	Concentration [ng/µl]
8 - pSB6A1-AraC-lacZ (6)	63
9 - pSB6A1-AraC-lacZ (6)	61
10 - pSB6A1-AraC-lacZ (6)	62

PCR Conditions BB.W4.A

Reagent	8 - pSB6A1-AraC-lacZ (6)	9 - pSB6A1-AraC-lacZ (6)
Expected length [Kb]	7.382	7.382
Template	1 µl of 1:10 diluted 8	1 µl of 1:10 diluted 9
Primer 10 µM fw	0.5 µl
Primer 10 µM rev	0.5 µl
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	-	-
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1 s
	66↓	5 s
	72	3:00 min
14	98	1 s
	63	5 s
	72	3:00 min
1	72	5:00 min
1	4	inf

Results

Expected band: 7.4 Kb

Fig.4.2 PCR of BB pSB6A1-AraC-lacZ (loaded 50 µL)
l1:2log ladder, l2-3: pSB6A1-AraC-lacZ (8),l4:2log ladder, l5-6: pSB6A1-AraC-lacZ (10)
no band visible

The gel shows no bands.

=> Perform test restriction to test identity of plasmid.

Restriction Digest A

Digest with PstI & XbaI of samples 8, 9 and 10 for checking identity of the construct

Reagent	Amount [µl]
DNA	10
Enzymes	1.5 each
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	27

Incubated for 1 h at 37°C

Result

Expected bands: 3360 and 4022 bp

Fig.4.3 PCR of BB pSB6A1-AraC-lacZ (loaded 50 µL)
l1:2log ladder, l2: pSB6A1-AraC-lacZ (8), l3: pSB6A1-AraC-lacZ (9), l4: pSB6A1-AraC-lacZ (10),l5:2log ladder, l6: pSB6A1-AraC-lacZ (8) digested with XbaI & PstI, l7: pSB6A1-AraC-lacZ (9) digested with XbaI & PstI, l8: pSB6A1-AraC-lacZ (10)digested with XbaI & PstI, l9:2log ladder, l10: pSB6A1-AraC-lacZ (8) 1:10 diluted, l11: pSB6A1-AraC-lacZ (10) 1:10 diluted, l12: pSB1C3

The gel shows a band at 5 Kb.

=> Colonies 8, 9 and 10 are not the desired construct.

Restriction Digest B

Digest with KpnI of samples 8, 9, 10 for checking length of the construct and KpnI and BamHI to check for identity.

Reagent	Amount [µl]
pSB6A1-AraC-lacZ (8, 9, 10)	5
Enzymes	1.5 KpnI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	33,5
Expected bands	7.381 bp

Reagent	Amount [µl]
pSB6A1-AraC-lacZ (8, 9, 10)	5
Enzymes	1.5 KpnI & 1,5 BamHI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	32
Expected bands	4.607 bp & 2.781 bp

Result

Expected bands: 7.381 bp and 4.607 bp & 2.781 bp

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

=> Colonies 8, 9 and 10 are not desired construct. Pick new colony from pSB1C3-AraC(6)-lacZ and test digest.

Miniprep

A new colony was picked from pSB1C3-AraC(6)-lacZ plate and a mini prep was performed.

Result

pSB6A1-AraC(6)-lacZ construct : 94 [ng/µl]

Test Restriction Digest

The new miniprep as well as one of the wrong pSB6A1-AraC(6)-lacZ ones were restriction digested with EcoRI-HF and PstI.

Component	Amount [µl]
DNA	5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	32

Incubated 1 h at 37°C

Result

Expected bands: ? Kb

Fig.4.5 Test digest of pSB1C3-AraC-lacZ with EcoRI & PstI (loaded 20 µL)
l1:2log ladder, l2: pSB1C3-AraC-lacZ

The gel showed again these three bands (2.070 and 3.360 and ~4 Kb)

=> Colonies 8, 9 and 10 are not the desired construct.

Generation of Backbone pSB1C3-AraC-lacZ

Test Restriction Digest

In order find out why pSB6A1-AraC-lacZ shows wrong restriction pattern, parental pSB1C3-AraC-lacZ was restriction digested using KpnI as well as KpnI & BamHI.

Reagent	Amount [µl]
pSB1C3-AraC-lacZ	5
Enzymes	1.5 KpnI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	33.5
Expected band	5,436 bp (linerized)

Reagent	Amount [µl]
pSB1C3-AraC-lacZ	5
Enzymes	1.5 KpnI & 1.5 BamHI
Buffer NEB 3(10x)	5
BSA (10x)	5
ddH₂O	32
Expected bands	4.906 bp & 530 bp

Result

Expected bands: 5.436 bp and 4.906 bp & 530 bp

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

=> pSB1C3-AraC(6)-lacZ is not desired construct. Pick new colony and test digest.

Miniprep

A new colony was picked from pSB1C3-AraC(6)-lacZ plate and a mini prep was performed.

Result

pSB1C3-AraC(6)-lacZ construct : 203 [ng/µl]

Test Restriction Digest

The new miniprep as well as one of the wrong pSB6A1-AraC(6)-lacZ ones were restriction digested with EcoRI-HF and PstI.

Component	Amount [µl]
DNA	3
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	34

Incubated 1 h at 37°C

Result

Expected band: ? Kb

Fig.4.6 BB digested with EcoRI & PstI (loaded 20 µL)
l1:2log ladder, l2: digested pSB1C3-AraC-lacZ, l3: digested pSB6A1-AraC-lacZ

Gel showed again the three bands (2070 and 3360 and ~4 Kb).

=> pSB1C3-AraC(6)-lacZ is not desired construct. Start assembly all over again.

Test Restriction Digest pSB6A1-J04450

pSB6A1-J04450 was test digested to check for identity.

Reagent	Amount [µl]
pSB6A1-J04450	10
Enzymes	1.5 KpnI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	28.5
Expected band	5,091 bp - Linearized

Reagent	Amount [µl]
pSB6A1-J04450	10
Enzymes	1.5 KpnI & 1.5 BamHI
Buffer NEB 3 (10x)	5
BSA (10x)	5
ddH₂O	27
Expected bands	4,906 bp & 530 bp

Result

Fig.4.4 BB pSB6A1-AraC-lacZ test digested (loaded 50 µL)
l1:2log ladder, l2: pSB13-AraC-lacZ (8), l3: pSB6A1, l4-6: pSB6A1-AraC-lacZ digested with BpsI, l7:2log ladder, l8: pSB13-AraC-lacZ (8), l9: pSB6A1, l10-12: pSB6A1-AraC-lacZ digested with BpsI & BamHI

Sample	Expected bands with KpnI	Bands on gel with KpnI	Expected bands with KpnI & BamHI	Bands on gel with KpnI & BamHI
pSB1C3-AraC-lacZ	5.436 Kb (linerized)	10 Kb	4.906 Kb & 530 Kb	no band
pSB6A1-J04450	5.091 Kb (linearized)	no band	5.091 Kb (linearized)	no band
pSB6A1-AraC-lacZ (8, 9, 10)	7.388 Kb (linearized)	6 Kb & 10 Kb	4.607 Kb & 2.781 Kb	6Kb & 10 Kb

This means:

The chloramphenicol backbone has the right length.
The digested chloramphenicol backbone is also ok.
The digested fragment pSB6A1-AraC-lacZ (with PstI & EcoRI-HF) showed the 2 expected bands at 2,070 bp and 3,360 bp, but another band around ~4 Kb.

=> Something is not ok with this ligated construct and we have to start all over again.

Overview
Experiments

test

Amplification of 1

27-05 - 02-06-13

Generation of pSB6A1

Miniprep

Grow pSB6A1 from glycerol stock in 2 ml LB Amp ON at 37°C.
Miniprep using miniprep kit from Qiagen and dilute in 30 µl ddH₂O.

Result

Concentration 69.5 ng/µl

Digest

The pSB6A1 was generated from the parts registry and cut with EcoRI & PstI

Template DNA	BSA	NEBuffer2	Enzymes	ddH₂O	Total amount
15 µl (69.5 ng/µl)	5 µl	5 µl	2x 1.5 µl EcoRI-HF & PstI	22 µl	50 µl

The digest was incubated 45 min at 37°C.

Result

Expected band: 3985 bp (pSB6A1) and at 1106 bp (insert=J04450)

Fig.5.1 Generation of pSB6A1 for Backbone generation (loaded 50 µL of PCR)
l1:2-log ladder, l2-3:digested pSB6A1
expected band at 4 Kb was cut out

=> Expected bands are present. Backbone pSB6A1 was cut out and gel purified (c=4 ng/µl).

Generation of AraC Fragment

Gel Extraction

Gel extraction was performed with the gel extraction kit from Qiagen of gel slice (cut 24-05) and was eluted in 30 µl.

Result

The measured concentrations are shown in the table below and was stored at -20°C.

Sample	Concentration [ng/µl]
AraC	22.5

Generation of lacZ Fragment

Gel Extraction

Gel extraction was performed with the gel extraction kit from Qiagen of gel slice (cut 24-05) and was eluted in 30 µl.

Result

The measured concentrations are shown in the table below and was stored at -20°C.

Sample	Concentration [ng/µl]
lacZ	42.5

Generation of Backbone pSB6A1-AraC-lacZ

Ligation of pSB6A1 with AraC-lacZ

A ligation was performed of fragments for 1 h at RT.

Sample	Concentration [ng/µl]	Amount for ligation [µl]
pSB6A1	4	12.5
AraC-lacZ	22.5	3.5
T4-ligase	-	1
Buffer	-	2
ddH₂O	-	1
Final volume	-	20

The ligase was inactivated by heat shock for 5 min at 70°C.

Transformation

Afterwards, a transformation was performed with 15 µl of the ligation reaction in competent TOP10.
Cells were streaked on LB Amp plates and incubated ON at 37°C.

Induction

The following day, 5 white colonies were picked (because the red ones still have the mRFP insert J04450) and were incubated in 2 ml LB Amp with 20 µl Arabinose (10%) and 100 µl X-Gal (20 ng/µl).

Result

2 of the colonies turned blue

=> Perform miniprep.

Miniprep

Miniprep was performed according to Qiagen's instructions.

Result

Sample	Concentration [ng/µl]
pSB6A1-AraC-lacZ	99

DelH F1a

PCR Conditions F1a.W5.A

Reagent	DelH F1a	DelH F1a
Expected length [Kb]	5	5
Template	1 µl D. acidovorans	1 µl D. acidovorans
Primer fw 10 µM	DN01	DN01
Primer rev 10 µM	DN08	DN08
Phusion Master Mix (2x)	25 µl	25 µl
DMSO	2.5 µl	-
ddH₂O	20,5	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

The gel shows a lot unspecific bands for both DelH F1a samples.

=> Fragment was cut and gel purified.

DelH F1b

PCR Conditions F1b.W5.A

Reagent	DelH F1b
Expected length [Kb]	5
Template	1 µl D. acidovorans
Primer fw 10 µM	DN07
Primer rev 10 µM	DN02
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	68	5
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 5 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

Gel shows one band at the expected length of 5 Kb, but also other side bands below and a huge, bright band at 2 Kb.

=> Band was cut and gel isolated.

DelH F2

PCR Conditions F2.W5.A

Reagent	DelH F2
Expected length [Kb]	8
Template	1 µl glycerol stock
Primer 10 µM fw	0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl
DMSO	0 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:45 min
1	72	2:45 min
1	4	inf

Result

Expected length: 8 Kb

Fig.5.2 PCR of DelH fragment F1a, F1b & F2(loaded 50 µL of PCR)
l1:2-log ladder, l3-4:F1a,l5-6:F1b,l7-8:F2

There was a specific band at 8 Kb.

=> Fragment was cut and gel extracted.

Overview
Experiments

test

Amplification of 1

03-06 - 09-06-13

Generation of DelH plasmid pHM01

Elongation-PCR Conditions BB.W6.A

The restriction sites were added to pSB6A1-AraC-lacZ via PCR.

Reagent	pSB6A1-AraC-lacZ
Expected length [Kb]	7.4
Template	1 µl of 1:10 pSB6A1-AraC-lacZ miniprep
Primer fw 10 µM	DN05
Primer rev 10 µM	DN06
Phusion Master Mix (2x)	25 µl
DMSO	-
ddH₂O	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
14	98	1
	66↓	5
	72	2:00 min
16	98	1
	66	5 s
	72	2:00 min
1	72	2:30 min
1	4	inf

Result

Expected band: 7.4 Kb

Fig.6.1 PCR of pSB6A1-AraC-lacZ & digest of pSB6A1-AraC-lacZ (loaded 5 & 20 µL of PCR)
l1: 2log ladder, l2-3: PCR of BB, l4-5: digested BB of EcoRI & PstI
PCR and digest sho the expected band at 7.4 Kb but also unspecific side bands

Gel shows expected band.

=> Band was cut and gel extracted.

Test Restriction Digest

Isolated fragment was test digested to confirm identity.

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
pSB6A1-AraC-lacZ	99	5	1.5 EcoRI-HF & 1.5 PstI	5 NEB2 & 5 BSA	32	50

The test digest was incubated 1 h at 37°C.

Result

Expected band: ~4 Kb & 3.4 Kb

Fig.6.1 Digest of pSB6A1-AraC-lacZ (loaded 5 & 20 µL of PCR)
l1: 2log ladder, l2-3: PCR of BB, l4-5: digested BB of EcoRI & PstI
PCR and digest sho the expected band at 7.4 Kb but also unspecific side bands

Gel shows expected band.

=> Backbone is fine.

Restriction Digest of pSB6A1-AraC-lacZ for Ligation

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
pSB6A1-AraC-lacZ	99	12.5	1.5 KpnI-HF & 1.5 PacI	5 NEB4 & 5 BSA	24.5	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=24 ng/µl

Restriction Digest of DelH F1a for Ligation

Sample	Concentration [ng/µl]	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F1a	?	25	1.5 EcoRI-HF & 1.5 PacI	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=9 ng/µl

Restriction Digest of DelH F1b for Ligation

Sample	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F1b	25	1.5 EcoRI-HF & 1.5 SalI-HF	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=19 ng/µl

Restriction Digest of DelH F2 for Ligation

Sample	Volume for digest [µl]	Enzyme [µl]	Buffer [µl]	ddH₂O [µl]	Final volume [µl]
DelH F2	25	1.5 KpnI-HF & 1.5 SalI-HF	5 NEB4 & 5 BSA	12	50

Restriction Digest was purified with Qiagen nucleotide removal kit.

Result

c=9 ng/µl

Ligation of pHM01:DelH-pSB6A1-AraC-lacZ

Ligations was performed of all 4 fragments (digested and purified) for 1 h at RT in 2 different mixes.

Sample	Concentration [ng/µl]	Volume for Ligation [µl]
pSB6A1-AraC-lacZ	24	2
DelH F1a	9	6
DelH F1b	19	3
DelH F2	9	6
T4 ligase	-	1
Buffer	-	2
ddH₂O	-	-
Final volume	-	20

The ligase was inactivated by heat shock for 5 min at 70°C.
The reaction mix was purified with Qiagen nucleotide removal.

Result

Sample	Concentration [ng/µl]
1	20
2	30

Electroporation

Two electroporations were performed.

20 ng
30 ng

After an incubation time of 1 h in SOC-medium, cells were centrifuged and 10 µl plated on one LB Amp plate (with Arabinos and X-Gal) and 100 µl on another plate prepared with the same conditions.
Plates were incubated ON at 37°C.

Result

White colonies grew on the plates.

Colony PCR

6 colonies of plate E1 (colonies 1-6) and 6 colonies of plate E2 (7-12) as well as ligation mixes 1 & 2 were checked by PCR.

Reagent	DelH colonies
Expected length [bp]	663
Primer fw 10 µM	2 µl VF2
Primer rev 10 µM	2 µl DN07
Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time
1	95	120
12	95	60
	66 (touchdown -0.5°C)	30
	72	45
18	95	60
	62 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected length: 663 bp.

Fig.6.2 Colony PCR of DelH-construct (loaded 5 µL)
l1:2log ladder, l2-10:Colony PCR of colonies 1-9, l10:2 log ladder, l11-15:Colony PCR of colonies 1-9
l2-3: shows expected band at 663 bp

None of the colonies shows a band. Ligation mixes 1 and 2 show the expected band at ~600 bp.

=> The ligation worked, but none of the correct plasmids were present in the analyzed colinies.

Overview
Experiments

test

Amplification of 1

10-06 - 16-06-13

Characterization of DelH plasmid of 02-06

Template	15 x 1 µl of ligated plasmid
Expected length [bp]	663
Named	1-15
Primer fw 100 µM	15 x 0.2 µl VF2
Primer rev 100 µM	15 x 0.2 µl DN07
Dream-Taq Polymerase (2x)	15 x 10 µl
ddH₂O	15 x 8.6 µl

Cycles	Temperature [°C]	Time [s]
1	94	180
12	94	20
	66 (touchdown -0.5°C)	20
	72	45
18	94	20
	62	20
	72	45
1	72	5 min
1	4	inf

Re-PCR of DelH fragment F1a & F1b

Result

Expected band: 5 Kb.

Fig.7.1 Gel of Re-PCR of DelH-F1a and DelH-F1b (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1b
no specific band at expected 5 Kb

There are no specific bands at 5 Kb.

=> We therefore failed to reamplify DelH F1a and F1b from the PCR product.

=> Additionally, in the elctroporated colonies, there is no fragment F1a and F1b.

=> We need to design new forward primers for DelH F1a & F1b.

Amplification of DelH F1a

New Primers

Identifier	Order date	Note	Sequence
DN09:DelH_f1_fw_long	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGCGCCAAATCG
DN10:DelH_f1_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ATGGACCGTGGCCGCCTGC
DN11:DelH_f1_fw_short2	2013-06-11	Amplification of DelH F1a from the genome: works!!!!	GCCGCCTGCGCCAAATCG
DN12:DelH_f1_PacI_fw_short	2013-06-11	Amplification of DelH F1a from the genome: doesn't work	ttttttaattaatcacacaggaaagtactagATGGACCGTGGCCGCCTGC

PCR Conditions F1a.W7.A

Reagent	DelH_f1_fw_long	DelH_f1_fw_short	DelH_f1_fw_short2	DelH_f1_PacI_fw_short
Expected length [bp]	5 Kb	5 Kb	5 Kb	5 Kb
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer 10 µM fw	2.5 µl DelH_f1_fw_long	2.5 µl DelH_f1_fw_short	2.5 µl DelH_f1_fw_short2	2.5 µl DelH_f1_PacI_fw_short
Primer 10 µM rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev	1 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
ddH₂O	19 µl	19 µl	19 µl	19 µl

Because the annealing temperature of DelH_f1_fw_long is 77,4°C and of the primer DelH_EcoRI_rev is 69,6°C, a 2-step PCR was performed.

Cycles	Temperature DelH_f1_fw_long [°C]	Time [s]		Cycles	Temperature else [°C]	Time [s]
1	98	30		1	98	30
30	98	5		30	98	5
	-	-			66	5
	72	2:15 min			72	2:15 min
1	72	7 min		1	72	7:00 min
1	4	inf		1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.7.2 Gel of amplified DelH-1a fragment with different fw primern (loaded 20 µL)
l1 2 log ladder, l2F1a, l3 F1a
l2 DelH-1a fragment shows a specific band ~ 5 Kb

There is a specific band at 5 Kb for DN11. The other primers show only unspecific products.

=>The DN11 primer will be used. Using PCR conditions F1a.W7.A and short2 primer, the PCR was repeated to produce more product.

Overview
Experiments

test

Amplification of 1

17-06 - 23-06-13

Amplification of DelH F1a

Elongation-PCR Conditions F1a.W8.A

Reagent	Amount [µl]
Expected length [bp]	5
Template	1 µl PCR-product (16-06)
Primer 10 µM fw	2.5 µl DelH_f1_PacI_fw
Primer 10 µM rev	2,5 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	5
30	72	2:15 min
1	72	7 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.8.1 gel of amplified fragments (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1a
l2: DelH-F1a shows specific band = cut out

Gels shows expected band.

=> Band was cut and gel extracted.

Restriction Digest

DelH F1a was restricted with EcoRI & PacI.
Afterwards it was purified with nucleotide removal kit and DNA concentration was measured.

Result

Expected band: 5 Kb

Fig.8.2 Gel of digested F1a with (loaded 20 µL)
l1: 2 log ladder, l2-3: DelH-F1a digested

Gel shows expected band at ~5 Kb.

=> Restriction digest mix was purified by precipitation.

Purification of Restriction Digest

Add 1 ml isopropanol
Centrifuge 20 min full speed
Discard supernatant
Add 750 µl 70% ethanol
Centrifuge 5 min full speed
Discard supernatant
Dry for 10 min
Resuspend in 20 µl H₂O

Result

DNA-concentration was measured at the Nanodrop c=21 ng/µl.

Re-PCR Conditions F1a.W8.A

In order to increase the product yield, F1a was amplified from the PCR fragment produced in week 7 using PCR conditions F1a.W7.A and short2 primer.

Reagent	Amount [µl]
Expected length [bp]	5 Kb
Template	1 µl 1:10 dilution of purified DelH F1a (2.1 ng/µl)
Primer 10 µM fw	2.5 µl DelH_f1_short2_fw
Primer 10 µM rev	2.5 µl DelH_EcoRI_rev
Phusion Master Mix (2x)	25 µl
ddH₂O	19 µl

Cycles	Temperature A [°C]	Time [s]		Cycles	Temperature B [°C]	Time [s]
1	98	30		1	98	30
30	98	5		30	98	5
	-	-			66	5
	72	2:15 min			72	2:15 min
1	72	7 min		1	72	7 min
1	4	inf		1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Gel shows expected band at ~5 Kb.

=> Fragment was cut and gel isolated.

Generation of DelH plasmid 19-06

Ligation

Using 200 ng DNA

Fragment	Size [Kb]	Concentration [ng/µl]	Volume [µl] for ligation
F1a	5	261 (1:10 diluted => 26.1)	1.4
F1b	5	19	1.6
F2	8	9	4.5
Backbone	7.4	24	2

Reagent	Volume [µl] for ligation
Ligase	1
Buffer	2
Total DNA	10.3
ddH₂O	7.3

Using 600 ng DNA

Fragment	Size [Kb]	Concentration [ng/µl]	Volume [µl] for ligation
F1a	5	261 (1:10 diluted => 26.1)	8
F1b	5	19	7
F2	8	9	2
Backbone	7.4		5

Reagent	Volume [µl] for ligation
Ligase	2
Buffer	4
Total DNA	22
ddH₂O	22

Purification of Ligation

Add 1 ml isopropanol
Centrifuge 20 min full speed
Discard supernatant
Add 750 µl 70% ethanol
Centrifuge 5 min full speed
Discard supernatant
Dry for 10 min
Resuspend in 20 µl H₂O

Electroporation

As described in methods Electroporation of E. coli DH10β

One Eppi with DNA of ligation with 20 µl
Second Eppi with DNA of ligation with 50 µl (more DNA)
Streaked on LB Amp plates. Of each electroporated aliquot, one plate with 10 µl and another with 100 µl of the cells was spread.
Incubation ON at 37°C.

Characterization of DelH plasmid 19-06

Test Digest using SalI and PacI

Reagent	Amount [µl]
DNA	1
SalI	1
PacI	1
NEB4-buffer	2
BSA	2
ddH₂O	13

Result

Expected band: 10 Kb, 8 Kb, 7 Kb
There is nothing to see on gel, most probably due to too little amounts of DNA.

Colony-PCR

Only few colonies (~10) grew on both 100 µl plates.
Of 8 colonies from each 100 µl plate, a colony-PCR was performed.
Inocculation of PCR colonies into 1 ml LB Amp-Ara-XGal ON at 37°C.

Reagent	DelH colonies
Expected length [bp]	663
Primer fw 10 µM	2 µl VF2
Primer rev 10 µM	2 µl DN07
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.8.3 gel of colony PCR (loaded 5 µL)
l1: 2 log ladder, l2-6: colonies 1-5 screened with PCR conditions mentioned above
l2 shows expected band

Only colony 4 (second lane) shows expected band at ~600 bp. Yet, no blue color could be detected in ON culture, even in pellet (frozen for SDS Page).

=> This means, that our ligated plasmid was successfully transformed, but lacZ is not expressed.

Will run SDS-PAGE of transformed cultures and parental stock. Also inocculate cultures using higher concentrations of arabinose and X-Gal.

Stronger Induction of lacZ Expression

Inocculated single colonies from day before into 5 ml LB Amp-Ara-XGal using 2x amounts of arabinose and X-Gal stock solutions (maybe concentrations of stocks are too low or promoters need stronger induction).
Incubation ON at 37°C.

Result

No lacZ expression was observed.

Overview
Experiments

test

Amplification of 1

24-06 - 30-06-13

Characterization of DelH plasmid 19-06

SDS Page

Using NuPAGE Novex 10% Bis-Tris precast gel from Invitrogen with MOPS running buffer

3NuPAGE Novex 3-8% Tris-Acetate precast gel would have been more suitable considering expected 600 kDa DelH, but needed Tris-Acetate SDS buffer was not available.

Resuspended pellets in 100 µl SDS buffer (from Linda)
Boiled for 10 min @98°C
Ran for 90 min, 180 V
Stained for 40 min in Coomassie Buffer (50 ml acetic acid 100% + 225 ml ddH₂O, 1.5 g Coomassie in 225 ml methanol, mix both)
Washed in ddH₂O multiple times

Result

Fig.9.1 SDS PAGE
L1: Ladder L2: 6 µl of Konrad’s E. coli L3: 6 µl DelH colony 4 L4: 6 µl DelH colony 6 L5: 9 µl of Konrad’s E. coli L6: 9 µl DelH colony 4 L7: 9 µl DelH colony 6 L8: 15 µl of Konrad’s E. coli L9: 15 µl DelH colony 4 L10: 15 µl DelH colony 6 L11: empty L12: Ladder

None clear band at ~600 kDa visible. Maybe in highest amounts, but not reliable.

=> Probably no DelH expression in analyzed colonies.

Mini Prep

Picked colonies from LB Amp plates into 5 ml LB Amp (colonies 4, 6 and 9)
Incubation ON at 37°C
5 ml ON cultures were mini prepared and resuspended in 50 µl

Test Restriction Digest

5 µl of the mini prep were test digested

Reagent	Volume [µl]
Miniprep DNA	5
CutSmart buffer	2
EcoRI-HF, PacI, KpnI-HF	0.5 each
ddH₂O	10.75

Incubation at 37°C for 1 h

Result

Expected band pattern: 5 kp, 7.3 kp, 13 kp

Fig.9.2 Gel of amplified fragments (loaded 20 µL)
l1: 2 log ladder, l2:test digested DelH fragment
l2: no visible band

No clear bands visible.

=> DNA yield from mini prep was probably too low.

DNA Concentration

Colony	DNA concentration [ng/µl]
1	124.5
4	3.9
6	1.6
9	10.2

DNA measurement confirmed suspicion from test digest.

=>Thus, mini prep and test digest have to be repeated

Repetion of Mini Prep

Picked colonies from LB Amp plates into 5 ml LB Amp (colonies 4, 6 and 9) or from remaining ON culture (colony 1)
Incubation ON at 37°C
Colony 1 did not grow (also not on LB Amp plate), obviously lost plasmid
Mini preped remaining 3, eluted in 35 µl ddH₂O

DNA Concentration

Colony	DNA concentration [ng/µl]
4	38.5
6	42.0
9	49.0

Test Restriction Digest

Digested entire mini prep (using remaining from first mini for colony 1) for 2 h at37°C

Reagent	Volume [µl]
Mini prep	42
CutSmart	5
EcoRI-HF, PacI, KpnI-HF	1 each

Result

Expected bands: BB (7.3 Kb), DelH F2 (8 Kb), F1a + F1b (10 Kb)

Fig.9.3 miniprep resitriction digested (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1a
l2: DelH-F1a shows specific band = cut out

Unexpected bands at 3 Kb, but not desired ones.

=> Colonies do not contain desired plasmid and entire ligation has to be repeated.

Amplification of DelH F1b

PCR Conditions F1b.W9.A

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 100 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	68	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.4 gel of amplified DelH 1b - fragment (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1b
l2: DelH-F1b shows no band

No correct band visible.

=> Why could we not reproduce the previous amplification?

PCR Conditions F1b.W9.B

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
30	98	15 s
	68	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.5 gel of amplified DelH-1b-fragment (loaded 20 µL)
l1: 2 log ladder, l2: DelH-F1b
l2: DelH-F1b shows unexpected band at 2.3 Kb

Again, expected band not there.

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions F1b.W9.C

Reagent	DelH F1b
Template	1 µl DelH F1b Fragment
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
30	98	1 s
	68	5 s
	72	120
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb, Loaded 1 µl of PCR

Fig.9.9 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Fig.9.8 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Fig.9.7 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 5 Kb = was cut out

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 5 Kb

Highly specific band at 5 Kb, as well as additional smaller ones.

=> Band was cut. Run gel with remaining sample for gel extraction.

PCR Conditions F1b.W9.D

Reagent	DelH F1b
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f1_SalI_rev 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
30	98	1 s
	68	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: DelH F1b 5 Kb

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Amplification of DelH F2

PCR Conditions F2.W9.A

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 100 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	66	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.11 gel of amplified fragments (loaded 1 µL)
l1: 2log ladder, l2:F1b, l3: F2, l4: BB
shows band at 3 Kb

Unexpected bands at 3 Kb in lanes of DelH 2

=> Why could we not reproduce the previous amplification?

PCR Conditions F2.W9.B

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
12	98	15 s
	66 decrease by 0.5	15 s
	72	3:30 min
18	98	15 s
	66	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.12 gel of amplified fragments (loaded 1 µL)
l1:2log, l2: F1b, l3: F2, l4: BB
F2 shows no specific band

Unexpected bands at 1.5 Kb, 2.2 Kb, 4 Kb and 6 Kb. Desired 8 Kb band is present but hardly visible.

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions F2.W9.C

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb

Fig.9.9 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 19 µL)
l1:2log ladder, l2: F1a, l3:F2
l3: F2 shows specific band at 8 Kb and other ones

Fig.9.8 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 19 µL)
l1:2log ladder, l2: F1a, l3:F2
l3: F2 shows specific band at 8 Kb and other ones

Fig.9.7 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 1 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l2: F1a shows specific band at 8 Kb = was cut out

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 1 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l3: F2 shows specific band at 8 Kb and other ones

F2 shows specific band at 8 Kb and additional ones.

=> Band was cut. Run gel with remaining sample for gel extraction.

PCR Conditions F2.W9.D

Reagent	DelH 2
Template	1 µl D. acidovorans stock 29-04-13 1:10
Primer fw 10 µM	0.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	0.5 µl DelH_f2_KpnI_rev 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 1 µl of PCR

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Amplification of Backbone pSB6A1-AraC-lacZ

PCR Conditions BB.W9.A

Reagent	Backbone
Template	1 µl Backbone (pSB6A1-AraC-lacZ c = 24 ng/µl)
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 100 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 100 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
35	98	15 s
	66	5 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.11 Gel of amplified fragments of DelH and BB(loaded 1 µL)
l1:2log ladder, l5: F1b, l6: F2, l7: BB
no product

No band visible, amplification failed.

=> Why could we not reproduce the previous amplification?

PCR Conditions BB.W9.B

Reagent	BB
Template	1 µl Backbone (pSB6A1-AraC-lacZ c = 24 ng/µl)
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Phusion Ready Mix	25 µl
ddH₂O	23 µl

Cycles	Temperature [°C]	Time
1	98	30 s
12	98	15 s
	66 decrease by 0.5	15 s
	72	3:30 min
18	98	15 s
	66	15 s
	72	3:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig. 9.12 Gel of amplified DelH-fragments and BB l1:2log, l2: F1b,l3:F2, l4:BB

Unexpected band at 2.2 Kb

=> Adapt PCR conditions and ask for polymerase used last time, which is the one from the lab upstairs.

PCR Conditions BB.W9.C

Reagent	DelH 2
Template	1 µl pSB6A1-AraC-LacZ digested and purified 1:10
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.6 Gel of amplified DelH-fragments(F1a & F2) and Backbone (pSB6A1-AraC-lacZ) (loaded 20 µL)
l1:2log ladder, l2: F1a, l3:F2, l4: BB
l4: BB shows no expected band

Gel does not show expected fragment.

=> Make sure right template was used. Is the restricted and purified fragment suitable?

PCR Conditions BB.W9.D

Reagent	DelH 2
Template	1 µl pSB6A1-AraC-LacZ digested and purified 1:10
Primer fw 10 µM	0.5 µl AraCbb_KpnI_fw 10 µM
Primer rev 10 µM	0.5 µl AraCbbPacI_rev2 10 µM
Q5 Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	10 s
12	98	1 s
	66 decrease by 0.5	5 s
	72	2:30 min
18	98	1 s
	66	5 s
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.9.10 gel of amplified fragments using Q5 (loaded 1 µL)
l1:2log ladder, l5: fragment 1b, l6: fragment 2, l7: BB
no product

Neither of the PCRs yield any product.

=> Therefore, Q5 is no option for us!

Overview
Experiments

test

Amplification of 1

01-07 - 07-07-13

Amplification of DelH F1b

PCR Conditions F1b.W10.A

Reagent	DelH F1b
Template	1 µl DelH 1Fb Fragment
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	15
	68	15
	72	5 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.10.1 gel of amplified fragments (loaded 1 µL of PCR)
l1: 2log ladder, l2: F1b,l3: F2, l4: BB
no bands

No correct bands visible.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions F1b.W10.B

Reagent	DelH F1b
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	180
1	72	5 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 5 Kb

Fig.10.2 gel of amplified DelH fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log,l4-5:fragment 2 of DelH, l6-7: pSB6A1
l1: F1b shows no band

=> F1b was not amplified.

Amplification of DelH F2

PCR Conditions F2.W10.A

Reagent	DelH F2
Template	1 µl DelH 2 PCR product
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	15
	66 decrease by 0.5	15
	72	8 min
12	98	15
	66	15 s
	72	8 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 1 µl of PCR

Fig.10.1 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
l2: F2 shows no band

Gel does not show correct band.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions F2.W10.B

Reagent	DelH F2
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw 10 µM
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev 10 µM
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
12	98	1
	66	5
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 8 Kb, Loaded 50 µl of PCR

Fig.10.2 gel of amplified fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log, l4-5: 2,l6-7 pSB6A1-AraC-lacZ
l1: F1b shows no band

=> F2 was not amplified.

Amplification of Backbone

PCR Conditions BB.W10.A

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	66 decrease by 0.5	15
	72	8 min
12	98	15
	66	15
	72	8 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb, Loaded 1 µl of PCR

Fig.10.1 gel of amplified fragments (loaded 1 µL of PCR)
l1: 2log ladder, l2: F1b,l3: F2, l4: BB
no bands

No product.

=> Phusion is no option for us, not even for re-PCRs.

PCR Conditions BB.W10.B

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
12	98	1
	66	5
	72	2:30 min
1	72	10 min
1	4	inf

Using hot start at 98°C

Result

Expected band: 7.3 Kb

Fig.10.2 gel of amplified fragments (loaded 50 µL of PCR)
l1-2: F1b, l3: 2log,l4-5:fragment 2 of DelH, l6-7: pSB6A1
l1: F1b shows no band

=> BB was not amplified completely. It seems that there is no insert present or the conditions were not optimal. Repeat the PCR with other conditions.

PCR Conditions BB.W10.C

Reagent	Backbone
Template	1 µl psB6A1+AraC+Lacz 1:10
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Ready Mix	25 µl
ddH₂O	19 µl

Cycles-PCR	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:15 min
1	72	180
1	4	inf

Result

Expected bands: 7.3 Kb, Loaded 50 µl of PCR

Fig.10.4 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
specific bands at 7,3 Kb was cut out

Fig.10.3 gel of amplified fragments (loaded 50 µL of PCR)
l1: F1b, l2: 2, l3: pSB6A1
band at specific 7,3 Kb, but also unspecific ones

Expected band is there, but also unspecific ones.

=> Correct band was cut and gel extracted.

Generation of DelH Plasmid

Current Status

Fragment	Concentration [ng/µl]	Digested and Purified
F1a	267	check
F1b	9.8	-
F2	11 (gel extracted) and 369 (PCR purified)	-
pSB6A1-AraC-lacZ	53.5 and 38.5	-

Restriction Digest of Fragments

Fragment	Amount for Digest [ng]	Enzymes [µl]	Buffer [µl]
F1b	441	EcoRI-HF: 1 SalI-HF: 1	Cut smart 5.5
F2	495	KpnI: 1 SalI-HF: 1	Buffer 2.1: 5.5
pSB6A1-AraC-lacZ	1,599	KpnI: 1 PacI: 1	Buffer 1.1: 3.5

1 h at 37°C

Isopropanol Purification

Fragment	Concentration after Digest & Purification [ng/µl]	Sequences
F1a	267	File:Heidelberg PCR(DelH) restricted(KpnI+PacI) sequence.fasta.txt
F1b	3.5	(Entire) Sequence of DelH
F2	1.8
pSB6A1-AraC-lacZ	7.3	File:Heidelberg PCR(pSB6A1-AraC-lacZ) digest.fasta.txt File:Heidelberg PCR(pSB6A1-AraC-lacZ) sequence.fa.txt

Confirmation of DNA Concentration

Fragment	Concentration [ng/µl]	Date	µl on gel	Expected band size
F1a	261	19-06-13	1 µl	5 Kb
F1a	261	19-06-13	2 µl	5 Kb
F2	369	01-07-13	1 µl	8 Kb

Fig.10.5 concentration validation (loaded 1 µL of F1a & F2 PCR)
l1: F1a, l2: F2, l3: 2log
there are tiny bands showing the expected fragment for F2, F1a shows no band

Fragment F1a is not present, all others are fine.

=> Therefore, the next steps are:

1. Measurement of concentration = 40 ng/µl

2. PCR of the fragment F1a. As template, we use the purified PCR with the concentration of 40 ng/µl.

Restriction Digest of F2 and Backbone

Fragment	Volume for digest [ng]	Enzymes [µl]	Buffer [µl]
2	40*369 = 14.76 µg	KpnI: 1 SalI-HF: 1	Buffer 2.1: 4.8
pSB6A1-AraC-lacZ	40*38.5 = 1.54 µg	KpnI: 1 PacI: 1	Buffer 1.1: 1.8

1h at 37°C

Purification of Restriction Digest

Using nucleotide removal kit (Qiagen), eluted with 30 µl ddH₂O.

Fragment	Concentration [ng/µl]	µl available
DelH F2	30	25 µl
pSB6A1-AraC-lacZ	-11	25 µl

Amplification of DelH F1a

PCR Conditions F1a.W10.A

Reagent	DelH F1a
Template	0.5 µl of DelH F1a digested Fragment 1:5 (= 8 ng)
Primer fw 10 µM	2.5 µl DelH_f1_PacI_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	120
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.6 gel of amplified fragments (loaded 20 µL)
l1: F1a ,l2: 2log ladder,l3:F1b
no band visible

Gel does not show any bands.

=> We conclude, that the fragments we expected to be F1a cannot be amplified by PCR. Thus, they were not amplified in the PCR used as template.

PCR Conditions F1a.W10.B

Reagent	DelH F1a
Template	1 µl ‘‘D. acidovorans’’ glycerol stock
Primer fw 10 µM	2.5 µl DelH_f1_short2_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	2:00 min
1	72	7 min
1	4	inf

Result

See Confirmation of DNA Concentration

Amplification of DelH F1b

PCR Conditions F1b.W10.C

Reagent	DelH F1b
Template	1 µl DelH F1b digested Fragment
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	68	5
	72	120
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.6 gel of amplified fragments (loaded 20 µL)
l1: F1a ,l2: 2log ladder,l3:F1b
no band visible

There is no band visible.

=> We conclude, that the fragments we expected to be F1b cannot be amplified by PCR. Thus, they were not amplified in the PCR used as template.

Generation of DelH Plasmid

Confirmation of DNA Concentration

Fragment	Concentration (by Nanodrop)	µl on gel	µl loading dye	Digested and purified (V + A)	Date (of PCR or Purification)	Check on gel
F1a (PCR)	-	1	9* 1x	-	03-07-2013 (PCR)	+
F1a	40	2	9* 1x	V + A	19-06-2013	-
F1b	19	3	1* 6x	V + A	19-06-2013	-
F1b	3.5	10	2* 6x	V + A	02-07-2013 (V+A)	-
F2	0.5	10	2* 6x	V + A		-
F2	30.5	2	10* 1x	V + A (Nucleotide Removal)	03-07-2013	+
F2	(1:5 dilution of) 36.9	2	10* 1x	-	02-07-2013	+ (BackUP)
pSB6A1-AraC-lacZ	2.2	10	2* 6x	V + A	02-07-2013	+
pSB6A1-AraC-lacZ	(1:5 dilution of) 38.5	2	10* 1x	-	02-07-2013	+ (BackUP)
pSB6A1-AraC-lacZ	-11	5	1* 6x	V + A (Nucleotide Removal)	03-07-2013	+

Fig.10.7 gel of fragments (amplified by PCR) (loaded 20 µL)
l1: F1a, l2: F1a, l3: F1b (digested (D) & purified (P)), l4: F1b (D+P), l5: F2(D+P), l6: F2(D+P), l7: F2, l8: BB(D+P), l9: BB, l10: BB(D+P), l11: 2log
lane 2, 3, 4, 5 had no band

DelH F1a (40 ng/µl) was the fragment we used for the first ligation. It is not visible, thus, there was not enough little DNA. Since the screening primer binds to this part of DelH, we could not identify any positive clone.

=> The negative samples (with too little DNA concentration) are discarded.

Amplification of DelH F1a

PCR Conditions F1a.W10.C

Reagent	DelH F1a
Template	1 µl DelH F1a Fragment 03-07-2013
Primer fw 10 µM	2.5 µl DelH_Pac_fw
Primer rev 10 µM	2.5 µl DelH_EcoRI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles-PCR	Temperature [°C]	Time [s]
1	98	10
30	98	1
	66	5
	72	120
1	72	7 min
1	4	inf

Result

Fragment was gel extracted.

Amplification of DelH F1b

PCR Conditions F1b.W10.D

Reagent	DelH F1b	DelH F1b
Template	1 µl D. acidovorans	1 µl DelH F1b Fragment (19 ng/µl)
Primer fw 10 µM	2.5 µl DelH_EcoRI_fw	2.5 µl DelH_EcoRI_fw
Primer rev 10 µM	2.5 µl DelH_f1_SalI_rev	2.5 µl DelH_f1_SalI_rev
Phusion Ready Mix	25 µl	25 µl
ddH₂O	19 µl	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Result

Expected band: 5 Kb

Fig.10.9 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

No bands visible.

=> Fragment F1b could not be amplified from neither genomic DNA nor PCR fragment. Amplification will be repeated using DMSO in the mix.

PCR Conditions F1b.W10.E

Reagent	DelH F1b	DelH F1b	DelH F1b	DelH F1b
Template	1 µl D. acidovorans glycerol stock	1 µl Fragment (19 ng/µl)	1 µl D. acidovorans glycerol stock	1 µl PCR Fragment (19 ng/µl)
Primer fw 10 µM	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw
Primer rev 10 µM	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev	1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	6 µl	6 µl
DMSO	-	-	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:15 min
18	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Using hot start 98°C

Result

Expected band: 5 Kb

Fig.10.10 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

Only PCR of fragment 19 ng/µl + DMSO was successful. Maybe there is another pale band at the second PCR of DelH F1b.

=> Repeat both PCRs.

Result

PCR using conditions F1b.W10.E was repeated.
Expected band: 5 Kb,Entire PCR mix was loaded.

Fig.10.12 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Fig.10.11 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

PCR did not result in any fragments. Interestingly, both older PRCs resulted in a fragment at ~5 Kb and other lines, but the fragment from the genomic DNA is slightly larger.

=> Both fragments were cut and gel isolated, check correct length of F1b!

=> Perform PCR from the PCR fragment obtained from the genomic DNA.

Amplification of DelH F2

PCR Conditions F2.W10.C

2x 50 µl

Reagent	DelH F2
Template	1 µl Fragment "BackUP"
Primer fw 10 µM	2.5 µl DelH_f2_SalI_fw
Primer rev 10 µM	2.5 µl DelH_f2_KpnI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Result

Expected band: 8 Kb

Fig.10.9 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

Fragment 2 was successfully amplified.

=> It was cut and gel purified.

Preparation of new Template DNA

D. acidovorans glycerol stock was streaked onto LB plates and incubated ON at 37°C.
D. acidovorans did not grow, since LB media is not appropriate for them. Prepare new ACM media and plates and streak D. acidovorans.

Amplification of Backbone

PCR Conditions BB.W10.D

2x 50 µl

Reagent	Backbone
Template	1 µl Fragment "BackUP"
Primer fw 10 µM	2.5 µl AraCbb_KpnI_fw
Primer rev 10 µM	2.5 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	25 µl
ddH₂O	19 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Result

Expected band: 7.3 Kb

Fig.10.13 gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 fragment 1, lane 3 fragment 2
excised band of lane 3; lane 2 had no band

No band visible.

=> Repeat using DMSO.

PCR Conditions BB.W10.E

Reagent	Backbone	Backbone	Backbone
Template	1 µl of BackUP	1 µl V+A 2,2 ng/µl template	1 µl V+A 2,2 ng/µl template
Primer fw 10 µM	1 µl AraCbb_KpnI_fw	1 µl AraCbb_KpnI_fw	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbbPacI_rev2	1 µl AraCbbPacI_rev2	1 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	6 µl
DMSO	-	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	7 min
1	4	inf

Using hot start (in new cycler)

Result

Expected band: 7.3 Kb

Fig.10.10 gel of amplified fragments (loaded 20 µL)
l1-3:F1b, l4: 2log ladder, l5-7: BB
BB was not amplified

Gel does not show the expected fragment.

=> Next PCR for the Backbone should be done with longer elongation time and variations: think about using the a new colony of plate.

PCR Conditions BB.W10.F

Reagent	Backbone	Backbone	Backbone	Backbone
Template	1 µl Fragment 24 ng/µl	1 µl of Fragment pSB6A1 gel-purified 3-6 89 ng/µl	1 µl of digested Fragment 3-7 -11 ng/µl	1 µl of purified Fragment Isoprop 2.2 ng/µl
Primer fw 10 µM	1 µl DelH_f2_SalI_fw	1 µl AraCbb_KpnI_fw	1 µl DelH_f2_SalI_fw	1 µl AraCbb_KpnI_fw 1
Primer rev 10 µM	1 µl DelH_f2_KpnI_rev	1 µl AraCbbPacI_rev2	1 µl DelH_f2_KpnI_rev	1 µl AraCbbPacI_rev2
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	7 µl	7 µl	7 µl	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 decrease by 0.5	5
	72	180
18	98	1
	66	5
	72	180
1	72	7 min
1	4	inf

Result

Expected band: 7.3 Kb,Entire PCR mix loaded (pSB6A1-AraC-lacZ)

Fig.10.12 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Fig.10.11 gel of amplified fragments (loaded 20 µL)
l1/2: entire F1b, l3/4: older PCR of F1b, l5: 2log ladder, l6/7 BB
excised band of lane 6/7

Only PCRs from Fragment 24 ng/µl and Fragment 3-6 produced a nice fragment.

=> Bands were cut and gel isolated.

=> PCR amplification from restriction digested fragment did not work! This is unexpected, because actually, it should. Maybe exclude the previous restriction digested fragments "V+A" from ligation.

Preparation of new Template DNA

psB6A1-LacZ-AraC: 2 ml LB Amp were inocculated from the plate and incubated ON at 28°C (all other shakers occupied).
Mini prep was performed.
1 µl mini prep DNA was electroporated into E.coli DH10ß according to Electroporation of E. coli DH10β

Overview
Experiments

test

Amplification of 1

08-07 - 14-07-13

Amplification of DelH F1b

PCR Conditions F1b.W11.A

Reagent	DelH F1b - from purified F1b 05-07 (genome amplified)	DelH F1b - from purified F1b 05-07 (genome amplified)
Template	1 µl of PCR 1b (19 ng/µl)	1 µl D. acidovorans
Primer fw 10 µM	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw
Primer rev 10 µM	1 µl DelH_f1_SalI_rev 10	1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Result

Expected band: 5 Kb

Fig.11.1 gel of amplified fragment F1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F1b with DMSO

There is a specific band, but not at 5 Kb.

=> We cannot amplify F1b from a PCR fragment. Use fresh bacteria instead.

Preparation of fresh ACM media

Mix ingrediants according to Acidovorax complex medium
Autoclave
pH adjust to 7,3
Mix 500 ml media and 6 g agar
Autoclave again
Pour plates

Preparation of fresh D. acidovorans

Inocculate 5 ml ACM media with D. acidovorans
Incubate ON
Prepare glycerol stock
Streak some of culture on plates

PCR Conditions F1b.W11.B

Reagent	DelH F1b	DelH F1b
Template	Fresh colony of plate by DN from 10-07	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	1 µl delH_EcoRI_fw	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.2 gel of amplified fragment 1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F 1b with DMSO
l3 shows a slight band at 5 Kb

There is a weak band at the probe 1b WITH DMSO above 5 Kb.

=> Start a new PCR with 50 µl with the same conditions.

PCR Conditions F1b.W11.C

Reagent	DelH 1b
Template	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	2.5 µl delH_EcoRI_fw
Primer rev 10 µM	2.5 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	17.5 µl
DMSO	2.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb.

Fig.11.4gel of amplified fragment 1B(loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 band at 5 Kb was cut out

Fig.11.3 gel of amplified fragment 1B (loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 show expected band at 5 Kb and another lower band

The expected band at 5 Bk is weak, but visible. Note that there is sample left in the pocket.

=> The fragment was cut and gel extracted.

Generation of DelH plasmid

Restriction Digest

Of fragments F1a, F1b, F2 and backbone.

Fragment	DNA [µl]	ddH₂O [µl]	Enzymes [µl]	BSA [µl]	Buffer 4 [µl]
F1a (1)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1a (2)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1b (11.7 - 20 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F1b (11.7 - 50 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F2	20	17	1.5 SalI-HF & KpnI-HF each	5	5
BB (6-7 of IK - 14 ng/µl)	20	17	1.5PacI & KpnI-HF each	5	5
BB (6-7)	20	17	1.5 PacI & KpnI-HF each	5	5

Result

Loaded 5 µl of restriction digested fragments on gel. The result stands in the table below:

Fragment	Band	Conclusion	Next step
F1a purified on 12-07	strong bands at 1, 2 and 3 Kb weak band at wanted 5 KB	PCR purification of F1a step was not the right purifying step	load complete probe on gel and gel extract
F1b purified on 12-07	weak band at 5 Kb	maybe only low concentration	run PCR again
F2	no band	maybe too low concentration	run PCR again
BB	weak band at 7.4 Kb	maybe only low concentration	run PCR again

Gel Extraction of DelH F1a

Expected band: 5 KB, loaded entire F1a purified on 12-07 on gel

Fig.11.5gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

No band visible.

=> Gel extract earlier PCR from 06-07.

Expected band: 5 Kb

Fig.11.6gel of minipreped and PCR-amplified DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep of BB (pSB6A1), l4:PCR of BB (pSB6A1)

PCR shows expected band.

=> F1a was cut and gel extracted.

Amplification of DelH F1b

PCR Conditions F1b.W11.D

Reagent	DelH F1b
Template	1 µl F1b digested 12-07
Primer fw 10 µM	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	6µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.7gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR did not yield the specific band.

=> Use altered PCR conditions.

Amplification of DelH F2

PCR Conditions F2.W11.A

Reagent	DelH F2
Template	1 µl F2 digested 12-07
Primer fw 10 µM	1 µl delH_f2_SalI_fw
Primer rev 10 µM	1 µl delH_f2_KpnI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	5 s
30	98	1 s
	66	5 s
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Further optimization.

Amplification of Backbone

PCR Conditions BB.W11.A

Reagent	Backbone
Template	1 µl backbone digested 12-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2 10
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Repeat using fresh backbone DNA from miniprep.

Miniprep

Inocculation of 10 ml LB Amp with DH10ß (pSB6A1-AraC-lacZ)
Perform mini prep

PCR Conditions BB.W11.B

Reagent	Backbone
Template	1 µl Miniprep A of 10-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 (touchdown -0.5°C)	5
	72	3:00 min
18	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Results

Expected band: 7.4 Kb, loaded miniprep and PCR product.

Fig.11.8gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep A of BB, l4:PCR of BB

Miniprep shows weak band at ~7.4 Kb. PCR does not show expected band.

=> Prepare new mediprep of backbone (pSB6A1-AraC-lacZ)

Gibson Assembly Strategy

Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Overview
Experiments

test

Amplification of 1

15-07 - 21-07-13

Preparation of Primers

All primers were 1:10 diluted
Overview on annealing temperatures

Primer	short2	HM02	HM03	HM04	HM05	HM06	HM07	HM08	HM09	HM10
Annealing temperature [°C]	63	72.6	69.1	55.2	68.2	66.4	69.6	65.2	51.6 / 73.6	60.9 / 71.3

Preparation of fresh D. acidovorans

Liquid culture: 2x 5 ml ACM medium was inocculated with picked colonies of D. acidovorans from plate (made by DN)
Glycerol stock: was prepared from liquid culture

Amplification of DelH G1

PCR Conditions G1.W12.A

Reagent	DelH G1	DelH G1
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	short2	short2
Primer rev 10 µM	HM04	HM04
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	63 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	63	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 8.961 Kb

Fig.12.1gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1 without DMSO,l2:F1 with DMSO, l3:2log ladder, l4: F2 without DMSO, l5: F2 with DMSO

No bands visible.

=> Fragment 1 was not amplified. Next step is amplifying fragment 1 in two parts G1a & G1b.

Amplification of DelH G1a

PCR Conditions G1a.W12.A

Reagent	DelH G1a	DelH G1a
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	short2	short2
Primer rev 10 µM	HM02	HM02
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	63 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	64	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected Band: 4.309 Kb

Fig.12.3gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

Fig.12.2gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

PCR using DMSO looks well.

=> Fragment was cut and gel extracted.

Amplification of DelH G1b

PCR Conditions G1b.W12.A and B

Reagent	DelH G1b	DelH G1b
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	HM03	HM03
Primer rev 10 µM	HM04	HM04
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature A [°C]	Time [s]		Cycles	Temperature B [°C]	Time [s]
1	98	5		1	98	5
30	98	1		30	98	1
	64	5			57	5
	72	2:15 min			72	2:15 min
1	72	7 min		1	72	7 min
1	4	inf		1	4	inf

Result

Expected Band: 4.711 Kb

Fig.12.3gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

Fig.12.2gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a without DMSO,l2:F1a with DMSO, l3:F16 without DMSO at an anealing temperature 64°C,l5:F16 with DMSO at an anealing temperature 64°C,l6:1b-57 (without DMSO), l7: 1b-57 (with DMSO),l9 2 loga ladder,l10 Mediprep A of BB,l11 Mediprep B of BBF1a with DMSO

PCR using DMSO at an annealing temperature od 57°C looks fine.

=> Fragment was cut and gel extracted.

Amplification of DelH G2

PCR Conditions G2.W12.A

Reagent	DelH G2	DelH G2
Template	Fresh colony of plate (by DN)	Fresh colony of plate (by DN)
Primer fw 10 µM	2 µl HM05	2 µl HM05
Primer rev 10 µM	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	8 µl	7 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	67	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 9.611 Kb

Fig.12.1gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1 without DMSO,l2:F1 with DMSO, l3:2 log ladder,l4:F2 (without DMSO), l5: F2 (with DMSO)

Expected band is visible.

=> Fragment G2 was amplified with DMSO. Band was cut and gel extracted.

PCR Conditions G2.W12.B

Reagent	DelH G2
Template	Fresh colony of plate (by DN)
Primer fw 10 µM	2.5 µl HM05
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	25 µl
ddH₂O	17.5 µl
DMSO	2.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	3:30 min
18	98	1
	67	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 9.611 Kb

Fig.12.4gel of PCR of DelH-fragments (loaded 20 µL)
l1:PCR of Indigoidine,l2:2 log ladder, l3-4:G1b
l3-4 showed expected band at 9.6 Kb = was cut out

Gel shows nice band at expected length.

=> G2 was also amplified in 50 µl and was cut and gel extracted.

Amplification of DelH G0

PCR Conditions G0.W12.A

Reagent	DelH G0
Template	1 µl of glycerol stock
Expected length [Kb]	18.521
Primer fw 10 µM	2.5 µl short2
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 18.521 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~18 Kb.

=> Fragment G0 was cut and gel isolated. Repeat PCR to increase yield.

Result

Three 20 µl reactions were performed to increase yield of fragment G0.
Expected band: 18.521 Kb

Fig.12.8gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.7gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~18 Kb.

=> Fragment G0 was cut and gel isolated.

Amplification of DelH G1/2a

PCR Conditions G1/2a.W12.A

Reagent	DelH G1/2a
Template	1 µl of glycerol stock
Expected length [Kb]	13.083
Primer fw 10 µM	2.5 µl short2
Primer rev 10 µM	2.5 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	4	inf

Result

Expected band: 13.083 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~13 Kb.

=> Fragment G1/2a was cut and gel isolated.

Amplification of DelH G1b/2

PCR Conditions G1b/2.W12.A

Reagent	DelH G1b/2
Template	1 µl of glycerol stock
Expected length [Kb]	14.271
Primer fw 10 µM	2.5 µl HM03
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 14.271 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows expected band at ~14 Kb.

=> Fragment G1b/2 was cut and gel isolated.

Amplification of DelH G1b/2a

PCR Conditions G1b/2a.W12.A

Reagent	DelH G1b/2a
Template	1 µl of glycerol stock
Expected length [Kb]	14.271
Primer fw 10 µM	2.5 µl HM03
Primer rev 10 µM	2.5 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	3:30 min
1	72	10 min
1	4	inf

Result

Expected band: 14.271 Kb

Fig.12.6gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Fig.12.5gel of PCR of DelH-fragments (loaded 20 µL)
l1-4:DelH G0-G3 (18 Kb),l5:2 log ladder

Gel shows multiple bands, it is not clear, which one is correct.

=> Optimize temperatures.

Amplification of DelH G2b

PCR Conditions G2b.W12.A

Reagent	DelH G2b
Template	1 µl of glycerol stock
Expected length [Kb]	5
Primer fw 10 µM	2.5 µl HM07
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:00 min
1	72	5 min
1	4	inf

Result

Expected band: 5 Kb

Fig.12.8gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Fig.12.7gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Amplification of Backbone pSB6A1-AraC-lacZ

Test Restriction Digest of Midiprep

Midiprep	A	A	B	B
Enzymes	BamHI & Pst	BamHI & SalI	BamHI & PstI	BamHI & SalI
Wanted fragments [Kb]	3.317 & 4.071	3.794 & 3.594	3.317 & 4.071	3.794 & 3.594
Fragments present	1 band at ~6-7 Kb	3 bands: one bright one at ~4-5 Kb and two smaller ones at ~6 Kb and ~10 Kb	1 band at ~6-7 Kb	3 bands: one bright one at ~4-5 Kb and two smaller ones at ~6 Kb and ~10 Kb

Fig.12.8gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

Fig.12.7gel of PCR of DelH-fragments and restriction digest (loaded 20 µL)
l1-3:DelH G0(18 Kb),l5:1 Kb+ ladder, l5:Midiprep A digested with PstI & BamHI,l6:Midiprep A digested with SalI & BamHI, l7:Midiprep B digested with PstI & BamHI,l8:Midiprep B digested with SalI & BamHI, l9: 2 log ladder, l10: fragment of DelH - G3b

=> Don't trust the BB, because between 3 and 4 Kb there is no band. Backbone will be send for sequencing

=> Repeat entire cloning again?

Amplification of Backbone pSB6A1-lacZ-mRFP

As discussed, we are going to use another backbone. It is already in the parts registry: pSB6A1 + BBa_J04450 from Spring distribution 2012 (plate 1, well K1).

Transformation in E. coli TOP10

Chemical transformation of 3 µl of the plasmid
Incubation on ice, 15 min
Heat shock 42°C, 40 s
Incubation on ice again
Resuspended in 500 µl LB Amp for 30 min
Centrifuged (120, 5,000 rpm), removal of supernatant
Plated on LB Amp plate
Incubation ON at 37°C

Overview
Experiments

test

Amplification of 1

22-07 - 28-07-13

Amplification of Backbone pSB6A1-lacZ-mRFP

Miniprep

4 colonies were picked and inoculated in 4x 3 ml LB Amp
Incubated ON at 37°C
4x 3 ml were distibuted in 5x 2 ml eppis and centrifuged
Supernatant was discarded, cell pellet was used for miniprep
Two minipreps were pooled into 1 column and 180ipreps on another one (every eluation was performed with 50 µl)

Result

5 µl were loaded on a gel

=> Gel was not succesful

=> Miniprep didn't work and has to be repeated

Glycerol Stock

Glycerol stocks were prepared from liquid culture not used for miniprep.

Repetiotion of Miniprep

4x 2 ml of Top10 pSB6A1-lacZ-mRFP were minipreped with the Qiagen kit.

Result

Sample	Performed	Concentration (Nanovue)	P2 Buffer
pSB6A1-lacI-mRFP (1)	upstairs	88 ng/µl	from upstairs
pSB6A1-lacI-mRFP (2)	iGEM lab	62 ng/µl	new
pSB6A1-lacI-mRFP (3)	iGEM lab	104 ng/µl	new
pSB6A1-lacI-mRFP (4)	iGEM lab	60 ng/µl	old

Of each miniprep, 3 µl were loaded

Fig.13.1 Analytical gel for checking concentration of purified BB (PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1 2log ladder l2: pSB6A1-lacI-mRFP
bands at 5 Kb = is ok, because BB is not linear

At 3Kb and at 8 Kb, there are bands visible.

=> Minipreps are fine.

PCR Conditions BB.W13.A

Reagent	Backbone	Backbone
Template	Miniprep A	Miniprep A
Primer fw 10 µM	HM11	HM11
Primer rev 10 µM	HM12	HM12
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	7 µl
DMSO	-	-

Cycles	Temperature [°C]	Time [s]
1	98	10
12	98	1
	68 (touchdown - 0,5)	5
	72	1:15 min
18	98	1
	67	5
	72	1:15 min
1	72	5 min
1	4	inf

Result

Expected band: 5 Kb

Fig.13.3 gel of BB(PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1: BB amplified with HM11 & HM12, l2: BB amplified with HM11 & HM12,l3: 2log ladder
specific bands at 5 Kb on both lanes = was cut out

Fig.13.2 gel of BB(PSB6A1-lacI-mRFP) (loaded 3 µL of PCR)
l1: BB amplified with HM11 & HM12, l2: BB amplified with HM11 & HM12,l3: 2log ladder
specific bands at 5 Kb on both lanes = BB is ok

Specific expected band at 5 Kb

=> Fragment was cut and gel isolated. A: 22 ng/µl, B: 25 ng/µl

Generation of DelH Plasmid 26-07

Analysis of G0, G1 & G2b on Gel

Fig.13.4 analyse-gel for checking concentration of DelH fragments (loaded 3 µL of PCR)
l1 1Kb+ ladder l2: G0 complete DelH-fragment (DN11 & HM08), l3 G1/2a DelH-fragment (DN11 & HM06), l4: G2b DelH-fragment (DHM07 & HM08)
all bands are as expected = result shown in table below

Fragment	Size	Amount used [µl]	Amount used [ng] (by view)	Left for Gibson [µl] = [ng]	Concentration [ng/µl]
G0	18 Kb	8	5	52 = 35.5	0.68
G1	14 Kb	8	10	12 = 15	1.25
G2b	5 Kb	8	10	12 = 15	1.25

Overview on Fragments

Fragment	Concentration [ng/µl]
G0	0.68
G1	1.25
G2b	1.25
BB A	22
BB B	25

Gibson Assembly

Assembly #	Fragments	Amount used [µl]
1	G0 BB A	9.5 0.5
2	G0 BB A	8 2
3	1 G2b BB A	7 2.5 0.5

Incubated 1 hour at 50°C
Stored ON at -20°C

Purification of Gibson Mix

Purification performed with the long range gel extraction kit (because of 23 Kb size) of the entire sample (20 µl).
Performed the purification by calculating with 100 mg DNA (gel- step1)
Washing step with QX1 was not performed, because it is only to remove the residual agarose and we don't want to loose any DNA.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol
Streaked on LB Amp plates and incubated ON at 37°C

Result

There were no colonies on any of the plates. Ginson assembly and electroporation have to be repeated.

Generation of DelH Plasmid 28-07

NEB Protocol for Gibson Assembly

Optimized cloning efficiency is 50–100 ng of vectors with 2–3 fold of excess inserts. Use 5 times more of inserts if size is less than 200 bps. Optimized cloning efficiency is 50-100 ng of vectors with 2-3 fold of excess inserts. Use 5 times more of inserts if size is less than 200 bps.
Electrocompetent Cells Transformation Protocol:

Thaw electrocompetent cells on ice.
Transfer 50 μl of electrocompetent cells to a pre-chilled electroporation cuvette with 1 mM gap.
Dilute assembled products 3-fold with H2O prior electroporation. This can be achieved by mixing 5 μl of assembled products with 10 μl of H2O. Add 1 μ l of the diluted assembly product to electrocompetent cells.Mix gently by pipetting up and down or flicking the tube 4–5 times. Do not vortex. Place the mixture on ice for 30 minutes. Do not mix.
Mix gently by pipetting up.
Once DNA is added to the cells, electroporation can be carried out immediately. It is not necessary to incubate DNA with cells.Add 950 μl of room temperature SOC media* to tubes.
Add 950 μl of room temperature SOC media to the cuvette immediately after electroporation.
Place the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
Warm selection plates to 37°C.
Spread 100 μl of the cells onto the plates.
Incubate overnight at 37°C.

Gibson Assembly

Fragments	Concentraion [ng/µl]	Amount [µl]
G0	0.68	9
BB (8.8)	22	1
Gibson Master Mix	2x	10

Incubated 1 h at 37 °C in thermocycler
5 µl of mix added to 10 µl ddH₂O and stored at -20°C
10 µl stored for isoprop purification

Result

Remaining 5 µl were checked on a gel:
Expected band: 23 Kb

Fig.13.5 Analytical gel of backbone (pSB6A1-lacI-mRFP) and complete DelH fragment = G0 (loaded 5 µL of PCR)
l1:2log ladder, l2:BB,l3: G0
BB and DelH show the expected band at 18 Kb and 4.4 Kb

No product visible of correct size. There is a light band at ~1.5 Kb.

=> Most probably too little DNA loaded.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol
Streaked on LB Amp plates and incubated ON at 37°C

Result

There were few colonies on the plates. Red colonies were picked and screenied by colony-PCR, but none of them was positive. The Gibson assembly has to be repeated.

Preparation of Electrocompetent E.coli DH10ß

According to the protocol

Amplification of Backbone pSB6A1-lacZ-mRFP

Test Restriction Digest

Fragment	DNA [µl]	H₂O [µl]	Enzymes [µl]	Buffer 3.1 [µl]
BB A (22 ng/µl)	8 = 200 ng	9	NotI: 1	2

Incubated 1.5 h at 37 °C

Result

Expected bands: 4 Kb & 1 Kb

Fig.13.6test digest of Backbone (pSB6A1-lacZ-mRFP) (loaded 20 µL of PCR)
l1:2log ladder, l2:BB digested with NotI
digested BB show expected band at 4 Kb and 1 Kb => The backbone is ok.

Gel shows shows expeted bands at 4 Kb and 1 Kb.

=> Backbone is fine.

Overview
Experiments

test

Amplification of 1

29-07 - 04-08-13

Generation of DelH Plasmid 28-07

Purification of Gibson Mix

10 µl of the Gibson mix were isopropanol purified as described in the protocol.
5 µl of the Gibson reaction were mixed with 10 µl ddH₂O.

Electroporation

Electroporation into freshly prepared electrocompetent cell following the protocol.

E1	E2	E3
5 µl of Gibson + 10 µl H₂O	10 µl of isoprop purified Gibson assembly	no DNA

Grow 0.5 h with 400 µl SOC at 37°C
Add 9 ml LB Amp and incubate 3 h at 37°C
Incubate ON at 37°C on LB Amp plate as well as LB (no Amp) for control purposes

Result

There were few colonies on the plates. Red colonies were picked and screenied by colony-PCR, but none of them was positive. The Gibson assembly has to be repeated.

Generation of DelH Plasmid 01-08

Gibson Assembly

Fragment	Concentraion	Amount used [µl] (2 vials)	Amount used [µl]
G0	0,68 ng/µl	9	6
BB (8.8)	22 ng/µl	1	4
Gibson Master Mix	2x	10	10

Incubated 1 h at 50 °C in thermocycler

Electroporation

Electroporation #	Mix #	Amount of Mix [µl]	ddH₂O [µl]	Isopropanol	Amount electroporated [µl]
1	1	10	20	-	1
2	1	10	20	-	14
3	1	30	-	yes	20
4	2	5	10	-	1
5	2	5	10	-	29
6	2	15	-	yes	20
7	-	-	10	-	10

Plated on one LB agar plate each
Stored ON at 37°C

Colony-PCR Conditions CP.W14.A

Reagent	Electroporation 1	Electroporation 2	Electroporation 3	Electroporation 4	Electroporation 5	Electroporation 6
Expected length [bp]	663	663	663	663	663	663
Named	1	2	3	4	5	6
Template	5 colonies of E1	5 colonies of E2	5 colonies of E3	5 colonies of E4	5 colonies of E5	5 colonies of E6
Primer fw 10 µM	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2	1 µl VF2
Primer rev 10 µM	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev	1 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	8 µl	8 µl	8 µl	8 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.1 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1: 1, l2: 2,l3: 3, l4: 2log,l5: 4, l6: 5,l7: 6
no bands = no colony positive

Gel does not show any band.

=> None of the analyzed colonies is positive.

Colony-PCR Conditions CP.W14.B

Picked 20 colonies per plate and 5 colonies per PCR tube.

Reagent	Electr. 1	Electr. 1	Electr. 1	Electr. 2	Electr. 2	Electr. 2	Electr. 2
Expected length [bp]	663	663	663	663	663	663	663
Named	1a	1b	1c	2a	2b	2c	2d
Template	5 colonies of E1	5 colonies of E1	5 colonies of E1	5 colonies of E2	5 colonies of E2	5 colonies of E2	5 colonies of E2
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6µl	6 µl	6 µl	6 µl	6 µl

Reagent	Electr. 3	Electr. 3	Electr. 3	Electr. 3	Electr. 4	Electr. 4	Electr. 4	Electr. 4
Expected length [bp]	663	663	663	663	663	663	663	663
Named	3a	3b	3c	3d	4a	4b	4c	4d
Template	5 colonies of E3	5 colonies of E3	5 colonies of E3	5 colonies of E3	5 colonies of E4	5 colonies of E4	5 colonies of E4	5 colonies of E4
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6µl	6 µl	6 µl

Reagent	Electr. 5	Electr. 5	Electr. 5	Electr. 5	Electr. 6	Electr. 6	Electr. 6	Electr. 6
Expected length [bp]	663	663	663	663	663	663	663	663
Named	5a	5b	5c	5d	6a	6b	6c	6d
Template	5 colonies of E5	5 colonies of E5	5 colonies of E5	5 colonies of E5	5 colonies of E6	5 colonies of E6	5 colonies of E6	5 colonies of E6
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.3 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1: 2log, l2-5: 20 picked colonies from plate 4: every PCR tube has 5 colonies, l6-9:20 picked colonies from plate 5every PCR tube has 5 colonies,l10-14:20 picked colonies from plate 6 every PCR tube has 5 colonies
bands on lanes 4a, 4b, 6a, 6b, 6d at the expected 663 bp, so the next step is making PCRs of 1 colony per PCR of these probes

Fig.14.2 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-3:3 picked colonies from plate 1, every PCR tube has 5 colonies, l4-7:4 picked colonies from plate 2, every PCR tube has 5 colonies,l8: 2log,l9-13:4 picked colonies from plate 3 every PCR tube has 5 colonies
bands on lanes 3b, 3c, 3d, 4a, 4b, 6a, 6b, 6d at the expected 663 bp, so the next step is making PCRs of 1 colony per PCR of these probes

Gel shows bands for b, 3c, 3d, 4a, 4b, 6a, 6b, 6d at the expected 663 bp.

=> Make single colony-PCRs.

Colony-PCR Conditions CP.W14.C

1 µl of colony ON culture picked

Reagent	3c	3c	3c	3c	3c
Expected length [bp]	663	663	663	663	663
Named	3c 1	3c 2	3c 3	3c 4	3c 5
Template (1 µl)	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Reagent	4a	4a	4a	4a	4a
Expected length [bp]	663	663	663	663	663
Named	4a 1	4a 2	4a 3	4a 4	4a 5
Template (1 µl)	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Reagent	6b	6b	6b	6b	6b
Expected length [bp]	663	663	663	663	663
Named	6b 1	6b 2	6b 3	6b 4	6b 5
Template (1 µl)	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.14.5 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
'l1: 2log, l2-6: 5 seperate colonies which were together in 6b PCR earlier,
no bands = no colony positive

Fig.14.4 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
'l1: 2log, l2-6: 5 seperate colonies which were together in 3a PCR earlier, l7-11: 5 seperate colonies which were together in 4b PCR earlier,
no bands = no colony positive

=> No band is visible. There should be a band at at least one of each sample (for example 6B), because in the previous PCR we observed a band.

Because of the explained reason above we incubated 40 colonies seperately which might be positive ON at 37°C in 200 µl LB Amp. 200 µl of the ON cultire was mixed with 1.8 ml LB Amp for five colonies of each probe: 3b, 3c, 3d, 4a, 4b, 6a, 6b, 6d.

Overview
Experiments

test

Amplification of 1

05-08 - 13-08-13

Generation of DelH Plasmid 01-08

Colony-PCR Conditions CP.W15.A

From colonies inoculated on 04-08

Reagent	3c	3c	3c	3c	3c
Expected length [kb]	663	663	663	663	663
Named	3c 1	3c 2	3c 3	3c 4	3c 5
Template (1 µl)	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c	1 colonies of E3c
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5µl	5 µl	5 µl

Reagent	4a	4a	4a	4a	4a
Expected length [kb]	663	663	663	663	663
Named	4a 1	4a 2	4a 3	4a 4	4a 5
Template (1 µl)	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a	1 colonies of E4a
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Reagent	6b	6b	6b	6b	6b
Expected length [kb]	663	663	663	663	663
Named	6b 1	6b 2	6b 3	6b 4	6b 5
Template (1 µl)	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b	1 colonies of E6b
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.2 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-5: 5 seperate colonies which were together in 3a PCR earlier, l6: 2log
no bands = no colony positive

Fig.15.1 Gel of picked colonies with insert DelH-BB (loaded 20 µL of PCR)
l1-5: 5 seperate colonies which were together in 3a PCR earlier, l6: 2log, l7-11: 5 seperate colonies which were together in 3a PCR earlier,
no bands = no colony positive

None of the gels shows expected band.

=> None of the colonies is positive.

Miniprep

Of colonies 6b(1)-6b(5), 6a(1), 6a(2), 3c(3), a miniprep was performed.

Sample	Concentration [ng/µl]	µl avaiblable
6b(1)	33.8	18
6b(2)	33.4	18
6b(3)	36.9	18
6b(4)	59.6	18
6b(5)	18	18
6a(1)	60	18
6a(2)	62.3	18
3c(3)	40.9	18

Test Restriction Digest

Sample	Miniprep [µl]	CutSmart Buffer [µl]	NotI-HF [µl]	H₂O [µl]	Total [µl]
6b(1)	15	2	1	3	20
6b(2)	15	2	1	3	20
6b(3)	15	2	1	3	20
6b(4)	10	2	1	8	20
6b(5)	15	2	1	3	20
6a(1)	10	2	1	8	20
6a(2)	10	2	1	8	20
3c(3)	15	2	1	3	20

Result

Expected bands: 11,079 bp, 6,201 bp, 3,998 bp, 2,371 bp

Fig.15.3 test digest of listed colonies (loaded 20 µL of PCR)
l1-5: 5 seperate colonies of 6b, l6: 2log, l7 6a(1), l8 6a(2), l9 3c(3)
results are shown in table below

Expected bands	Present bands
11.079 bp	?
6.201 bp	no
3.998 bp	yes
2.371 bp	no

in silico PCR of BB shows the following result:

2 fragments generated:

1: 3.998 bp - From NotI[9] To NotI[4007]

2: 1.093 bp - From NotI[4007] To NotI[9]

But an additional band between 1-2 Kb is present!

=> Talk to Advisors, because it isn't what we expected. What could it be?

Possible next steps:

a) Wait for the new strain of D. acidovorans SHP1

b) Perform a re-PCR of minipreps (one with BB and one with DelH G0 fragment)

Generation of Backbone pSB6A1-lacI-mRFP

Restriction Digest with DpnI

After consulting the advisors, we decided not to continue the strategy with the old construct and wait with DelH until the new strain of D. acidovorans arrives. Until then, we digest the backbone (which is used also in following experiments) with DpnI to get rid of any remaining template.

Reagent	Amount [µl]
Gel extracted lineralized by PCR (template=10.4 Kb)	17
DpnI	1
CutSmart buffer	2
Total	20

1 h incubation at 37°C
20 min inactivation of enzyme by heat shock at 80°C for 20 min

Purification

As template, the PCR of 10,4 PCR, which was digested with DpnI on 06-08, was used.
Purification was performed with nucleotide removal kit (wrong column was used, but there was some yield at the nanodrop)

=> Again, checking on gel (2 µl + 8 µl 1xloading dye)

Fig.15.4 checking concentration of purified BB (PSB6A1-lacI-mRFP) (loaded 2 µL of PCR)
l1 2log ladder l2: pSB6A1-lacI-mRFP
l2 show expected band at 5 Kb

=> Concentration at nanodrop was 27.2 ng/µl

Amplification of DelH G0

PCR Conditions G0.W15.A

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	1 µl New strain culture SHP1 (resuspended pellet)
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18.521 Kb

Fig.15.5 amplified fragment DelH-complete (loaded 20 µL of PCR)
l1: G0, l21Kb+ ladder
no band at 18 Kb only a specific band at 5 Kb, but that is not useful

Gel does not show the expected band.

=> Further improve PCR conditions.

PCR Conditions G0.W15.B

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

=> Becaus it worked well we amplified 3x G0 with the same conditions.

PCR Conditions G0.W15.C

3x 20 µl PCR reactions were prepared

Reagent	Amount [µl]
Expected length [Kb]	18.521
Named	G0
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM08
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.15.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

Amplification of DelH G1/2a

PCR Conditions G1/2a.W15.A

Reagent	Amount [µl]	Amount [µl]
Expected length [Kb]	13.083	13.083
Named	G1/2a	G1/2a
Template	Picked colony	Picked colony
Primer fw 10 µM	1 µl short2	1 µl short2
Primer rev 10 µM	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10	10
ddH₂O	5	4
DMSO	1	0

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig.15.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

PCR Conditions G1/2a.W15.B

Reagent	Amount [µl]
Expected length [Kb]	13.083
Named	G1/2a
Template	Picked colony
Primer fw 10 µM	1 µl short2
Primer rev 10 µM	1 µl HM06
Phusion Flash Ready Mix	10
ddH₂O	5
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 13 Kb

Fig.15.9 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: band at 18 Kb was cut out l5-6: band at 13 Kb was cut out

Fig.15.8 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1-3:3x G0 (complete fragment amplified with DN11 & HM08), l4: 1kb+ ladder, l5-6:2x G1/2a (complete fragment amplified with DN11 & HM06)
l1-3: show the expected band at 18 Kb and l5-6: show the specific band at 13 Kb

Gel shows the expected bands.

=> Fragments were cut and gel extracted.

Amplification of DelH G2b

PCR Conditions G2b.W15.A

Reagent	Amount [µl]	Amount [µl]
Expected length [Kb]	5.472	5.472
Named	G2b	G2b
Template	Picked colony	Picked colony
Primer fw 10 µM	1 µl HM07	1 µl HM07
Primer rev 10 µM	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10	10
ddH₂O	5	4
DMSO	1	0

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	120
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig. 15.10: Gel of amplified DelH G2b fragment l1:2log, l2-3:G2b amplified

Summary of Gel Extracted Fragments

Concentrations (by nanodrop) are summarized in the following table and gel picture.

Fragment	Concentration [ng/µl]
G0	3.5
G1/2a	4.9
G2b	18.6

Fig.15.11 Analyse-gel of DelH-fragments (loaded 5 µL of G0 and G1/2a and 1 µl of G2b)
lane 1 1kb+ ladder, lane 2 G0 (complete DelH with DN11 & HM08), lane 3 G1/2a (part of DelH with DN11 & HM06), lane 4 G2b (part of DelH with HM07 & HM08)

Generation of DelH Plasmid 09-08

Gibson Assembly

We decided two assemble 2 different constructs and one control (only the backbone).

Construct	G0 [µl]	G1/2a [µl]	G2b [µl]	BB [µl]	2x Gibson Master Mix [µl]	Final amount [µl]
1	9	0	0	1	10	20
2	0	8	1	1	10	20
Control (C)	0	0	0	1 (+9 ddH₂O )	10	20

Incubated 1 h at 50°C

Electroporation

Of each Gibson assembly, 5 µl are diluted in 10 µl ddH₂O
The rest of the Gibson assembly is stored at -20°C

Conoly-PCR Conditions CP.W15.A

Picked 8 colonies from plates with 10µl and 100 µl construct 1, and plate with 100 µl of construct 2. 1 additional colony was picked from plate with 10 µl of construct 2 (because there were no more cells) and 1 colony of the control(100µl), and one colony of the control (100µl) with new electrocompetent cells.

In the following table construct 1 is named C1, and construct 2 = C2 and Control = Co

Reagent	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	1	2	3	4	5	6	7	8
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	9	10	11	12	13	14	15	16
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6µl	6 µl	6 µl	6 µl

Reagent	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl)	C2 (10 µl))
Expected length [bp]	663	663	663	663	663	663	663	663
Named	17	18	19	20	21	22	23	24
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C2 (10 µl)	C2 (100 µl)	Co (100 µl)	Co(100 µl)
Expected length [bp]	663	663	no product	no product
Named	24	25	26	27
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.12 screening PCR with DN07 & VF2 (loaded 1 µL of PCR)
l1:2log ladder,l2-17: colonies C1, l18-24: colonies C2, l25:2log ladder
None of the colonies showed expected band, instead, all have band at ~6 kb

Gel shows no banda at 663 bp. Instead, they show an unexpected band at ~6 Kb.

=> None of the colonies is positive.

Conoly-PCR Conditions CP.W15.B

Picked 20 colonies from plates with 10 µl and 100 µl construct 1 and construct 2 (80 colonies). 4 colonies were picked from the control (10 µl) and control (100 µl).

In the following table construct 1 is named C1, and construct 2 = C2 and Control = Co

Reagent	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (10 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)	C1 (100 µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	A	B	C	D	E	F	G	H
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	C2 (10µl)	C2 (10µl)	C2 (10µl)	C2 (10µl)	C2 (100µl)	C2 (100µl)	C2 (100µl)	C2 (100µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	I	J	K	L	M	N	O	P
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Reagent	Co (10µl)	Co (10µl)	Co (10µl)	Co (10µl)	Co(100µl)	Co(100µl)	Co(100µl)	Co(100µl)
Expected length [bp]	663	663	663	663	663	663	663	663
Named	C1	C2	C3	C4	C5	C6	C7	C8
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.15.13 screening PCR with DN07 & VF2 (loaded 1 µL of PCR)
l1-9: colonies A-I, l10:2log ladder, l11-17: colonies J-P, l12:2log ladder, l13-18: PCR performed with 6 colonies of the control plate
Neither the colonies A-P show the expected band nor the control shows any band

=> New Gibson Assembly will be performed

Gel shows no banda at 663 bp.

=> Neither the colonies A-P show the expected band, nor the control shows any band.

Generation of DelH Plasmid 11-08

Gibson Assembly

Because of the past results, we assume that the colonies can grow because the backbone religates. We also found out that the first overhang of the backbone has some homologity with a sequence at the end and we can assume that with Gibson, it primes itself.
So in the following step we will use less backbone. We prepared an 1:10 dilution of the backbone construct.

Reagent	Concentration [ng/µl]	Amount [µl] Mix A	Amount [µl] Mix B	Amount [µl] Mix C
G0	3.5	9	0	0
BB	1.8	1	1	1
Gibson Assembly Master Mix	2x	10	10	0

The time constant for the electroporation was unexpectedly low, hopefully high enough...

Overview
Experiments

test

Amplification of 1

12-08 - 18-08-13

Increasing Yield of DelH Fragments

PCR Conditions G0.G1/2a.W16.A

Reagent	G0	G0	G0	G1/2a	G1/2a
Expected length [Kb]	18	18	18	13.083	13.083
Named	G0	G0	G0	1	1
Template	Picked colony	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	1 µl short2	1 µl short2	1 µl short2	1 µl HM07	1 µl HM07
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start used

Result

Expected bands: 18 Kb (G0), 13 Kb (G1/2a)

Fig.16.1 gel of amplified DelH-fragment(loaded 20 µL of PCR)
l1-3: G0 (complete DelH-fragment with DN11 & HM08), l4-5: G1/2b (3/4 of the DelH fragment amplified with DN11 & HM06), l6: 1kb+ ladder
l2 shows the expected band at 18 Kb. l4-5 showed expected band at 13 Kb. All three bands were cut out.

Gel shows expected bands.

=> They were cut and gel isolated.

Generation of Plasmid DelH 11-08

Colony-PCR CP.W16.A

Reagent	Cells + 1 µl Gibson Assembly	Cells + 14 µl Gibson Assembly	Cells + 14 µl Gibson Assembly (ONLY Backbone)	Cells + 14 µl Gibson Assembly (ONLY Backbone)
Expected length [bp]	663	663	-	-
Named	D1	D14	B14(1)	B14(2)
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.2 gel of screening PCRs with DN07 & VF2 primer (loaded 20 µL of PCR)
l1: 2log ladder, l2: colony PCR of 1 µl Gibson transformed,l3: colony PCR of 14 µl Gibson transformed,l4-5: 2 colony PCRs of BB - 14 µl Gibson transformed, l6: 2log ladder
none of the colonies is positive, of course the BB shows not the expected band of 663 bp (for screening). The first colony shows a band at ~1.7 kb.

None of the colonies is positive, of course the BB shows not the expected band of 663 bp (for screening). The first colony shows a band at ~1.7 kb.

=> None of the colonies harbours DelH plasmid.

Colony-PCR CP.W16.B

Reagent	Cells + 10 µl Gibson Assembly pink	Cells + 10 µl Gibson Assembly pink	Cells + 10 µl Gibson Assembly white	Cells + 10 µl Gibson Assembly white
Expected length [bp]	663	663	663	663
Named	A	B	C	D
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5 °C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.3 Gel of colony PCR (loaded 10 µL)
l1: 2log ladder, l2-13 screening colonies A-D

Testing of Screening Primers

To test the reverse screening primer DN07 we amplify with the DreamTaqPolymerase and DN11 primer. As template, we use the complete DelH (18 Kb) and the first 3/4 of DelH (14 Kb).

Reagent	1 µl G0 of 23-07	1 µl G1/2a of 23-07
Expected length [bp]	323	323
Named	0	1
Primer fw 10 µM	2 µl DN11	2 µl DN11
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl
ddH₂O	5 µl	5 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	30
18	95	60
	65 (touchdown -0.5°C)	30
	72	30
1	12	inf

Result

Expected length= 323 bp for positive clones

Fig.16.4 Gel of amplified fragments (loaded 20 µL)
lane 1 2log ladder, lane 2 screening G0, lane 3 screening G1/2a

Gel shows expected bands.

=> Both PCRs were positive. Proof of functionality of DN07 screening primer and that both fragments are the expected DelH fragments.

Amplification of DelH G0

Gradient PCR Conditions G0.W16.B

To improve the PCR of the fragment with the length of 18 Kb, we run a gradient PCR between 68°C and 65°C.

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 1	G0 2	G0 3	G0 4
Template	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	98	5
30	98	1
	68 - 65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.5 amplified fragment of DelH (loaded 20 µL of PCR)
l1:1kb+ ladder, l2-5: G0 = complete DelH, l6-9: G1/2a, l10:1kb+ ladder
l2-5: show not the expected band at 18Kb. l6-9 show the expected band at 13.5 Kb and was cut out. But it shows also other unspecific bands.

Gel does not show expected band.

=> Further optimize PCR conditions.

PCR Conditions G0.W16.C

Because the amplification of DelH GO didn't work yesterday, we try it again with one picked colony and 1 µl of a glycerol stock at a constant annealing temperature of 65°C. 65°C was the temperature on which it worked the last time.

Reagent	G0	G0
Expected length [Kb]	18	18
Named	G0 1	G0 2
Template	Picked colony SPH1	1 µl of glycerol stock SPH1
Primer fw 10 µM	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	5 µl	4 µl
DMSO	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.6 gel of amplified DelH G0 fragment (loaded 20 µL of PCR)
l1: G0 amplified from picked colony, l2: G0 amplified from glycerol stock, l3: 1 kb+ ladder
l3 shows expected band at 18 kb and was cut

Gel shows expected band.

=> It was cut and gel extracted. Also, we will run again 3 samples with the same conditions.

PCR Conditions G0.W16.D

Reagent	G0	G0	G0
Expected length [Kb]	18	18	18
Named	G0 1	G0 2	G0 2
Template	1 µl of glycerol stock SPH1	1 µl of glycerol stock SPH1	1 µl of glycerol stock SPH1
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl
ddH₂O	4 µl	4 µl	4 µl
DMSO	1 µl	1 µl	1 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.16.7 gel of amplified DelH G0 in same conditions (loaded 20 µL of PCR)
l1: 1kb+ ladder, l2: G0 amplified with DN11 & HM08, l3: G0, l4: G0
l2-4show the expected band at 18 Kb and was cut

Gel shows expected fragments.

=> They were cut and gel extracted.

Amplification of DelH G1/2a

Gradient PCR Conditions G1/2a.W16.B

To improve the PCR of the fragment with the length of 18 Kb, we run a gradient PCR between 68°C and 65°C.

Reagent	G1/2a	G1/2a	G1/2a	G1/2a
Expected length [Kb]	13.083	13.083	13.083	13.083
Named	1 1	1 2	1 3	1 4
Template	Picked colony	Picked colony	Picked colony	Picked colony
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM06	2 µl HM06	2 µl HM06	2 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	5 µl	5 µl	5 µl	5 µl
DMSO	1 µl	1 µl	1 µl	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68 - 65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 13 Kb

Fig.16.5 amplified fragment of DelH (loaded 20 µL of PCR)
l1:1kb+ ladder, l2-5: G0 = complete DelH, l6-9: G1/2a, l10:1kb+ ladder
l2-5: show not the expected band at 18Kb. l6-9 show the expected band at 13.5 Kb and was cut out. But it shows also other unspecific bands.

Gel shows expected band of G1/2a, but also additional uspecific bands.

=> Fragment was cut and gel extracted.

Generation of Plasmid DelH 17-08

Electroporation

Remaining Gibson mix from 01.08 was electroporated.

Colony-PCR CP.W16.B

5 colony per PCR tube (but in different LB Amp Eppis)

Reagent	Electroporation from 17-08 10 µl	Electroporation from 17-08 100 µl
Expected length [bp]	663	663
Named	1 - 2	3 - 12
Template	2 colonies of 10 µl	10 colonies of 100 µl
Primer fw 10 µM	1 µl VF2	1 µl VF2
Primer rev 10 µM	1 µl Screen_delH_rev	1 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl
ddH₂O	8 µl	8 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65 (touchdown -0.5°C)	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.16.8 gel of screening minipreped colonies 1&2 from plate with 10 µl and colonies 3-12 from plate with 100 ml Gibson assembled construct with mRFP (loaded 20 µL of PCR)
l1: 2log ladder, l2: 1, l3: 2, l4: 3, l5: 4, l6: 5, l7: 6, l8: 7, l9: 8, l10: 9, l11: 10, l12: 11, l13: 12
l4-13 show expected band = positive?

Majority of colonies show expected band.

=> Grow ON, perform mini prep and test digests as well as PCRs of fragments from isolated DNA.

Overview
Experiments

test

Amplification of 1

19-08 - 25-08-13

Summary of Amplified DelH Fragments

Fragment	Concentration [ng/µl]
G0	6.4
G1/2a	8.5

Rather low yield. So we switched the strategy and try to increase the template of DelH by amplifying it in smaller and more fragments. Therefore, we used the following primers: FS64-FS71, HM08, DN07

Amplification of DelH G0

Re-PCR Conditions G0.W17.A

Reagent	G0
Expected length [Kb]	18
Named	G0 1
Template	1 µl G0 fragment (c= 6.4 ng/µl)
Primer fw 10 µM	2 µl short2
Primer rev 10 µM	2 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.1 gel of amplified DelH-G0 fragment from the fragment itself (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
l5: G0 was not amplified => not our fragment or without DMSO it is not so effective

Gel does not show expected band.

=> G0 was not amplified. Possibly change Mg²⁺ concentration.

PCR Conditions G0.W17.B

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 0.5	G0 1	G0 2	G0 N
Template	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans	1 µl glycerol stock D. acidovorans
Primer fw 10 µM	2 µl short2	2 µl short2	2 µl short2	2 µl short2
Primer rev 10 µM	2 µl HM08	2 µl HM08	2 µl HM08	2 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	4.5 µl	4 µl	3.5 µl	4 µl
DMSO	1	1	1	1
MgSO₄	0.5 µl	1 µl	1.5 µl	-

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.17.2 gel of amplified DelH-G0 with different MgSO₄(loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 0.5 µl MgSO₄, l3: G0 1 µl MgSO₄, l4: G0 1.5µl MgSO₄, l5: G0 N without MgSO₄
l5: G0 was amplified without DMSO => DMSO is important, but MgSO₄ is not improve the PCR reaction

Fragments were amplified, but yield not significantly increased.

=> DMSO is important, but MgSO₄ is not improve the PCR reaction.

Characterization of DelH Plasmid pHM03 17-08

For the miniprep, the cells were centrifuged at 13,000 rpm for 15 min
The cell pellet was resuspended in 200 µl P1 + 400 µl P2 and incubated for 120
Afterwards, 300 µl S3 were added and transferred into a new 2 ml eppi and centrifuged 20 min at 13,000 rpm
1 ml isopropanol was added and the normal isoprop-ethanol-preipitation
It was resuspended in 35 µl ddH₂O

Result

Miniprep of colony	Concentration [ng/µl]
3	1,868.5
4	1,688.1
5	1,069.2
6	1,778.6
7	2,105.7
8	1,219.7
9	1,083.1
10	1,031.7
11	2,175.3
12	1,449.4

PCR Conditions CP.W17.A

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature[°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.3 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show expected fragment

Colonies 3 to 12 show expected size.

=> Perform miniprep and test digest with colonies 3-12.

Test Restriction Digest

Of colonies 3, 4, 5, 6, 7

Component	Amount [µl]
DNA of M 3 to 12 (1:10)	19
CutSmart Buffer (10x)	.,2
Enzyme (SalI)	1
ddH₂O	-
Expected bands	14,180 & 9,469 bp

Incubated over night at 37°C and shaking

Result

Expected bands: 14.18 and 9.459 Kb

Fig.17.4 gel of test digest of the colonies 3-7 (loaded 20 µL of PCR)
l1:1 Kb+ ladder, l2:Digested miniprep of colony 3, l3:Digested miniprep of colony 4, l4:Digested miniprep of colony 5, l5:Digested miniprep of colony 6, l6:Digested miniprep of colony 7
l2-6:show not the expected fragment, but a band at ~ 4.8 Kb. Also observed pale bands at 20 Kb and ~ 3.8 Kb

None of the colonies shows expected restriction fragments. Additionally, there are pale bands at +20 Kb and ~3.8 Kb, but not the expected bands.

=> Possible explanation: colonies harbor reconjugated backbone AND something else involving DelH.

PCR Conditions CP.W17.B

M3 = Miniprep of DelH-pSB6A1(colony 3)

Template	1 µl of 1:1000 diluted M3 (pink)	1 µl of 1:1000 diluted M4 (slightly pink)	1 µl of 1:1000 diluted M5 (slightly pink)	1 µl of 1:1000 diluted M6 (pink)	1 µl of 1:1000 diluted M7 (pink)	1 µl of 1:1000 diluted M 8	1 µl of 1:1000 diluted M 9	1 µl of 1:1000 diluted M10	1 µl of 1:1000 diluted M11	1 µl of 1:1000 diluted M12
Expected length [bp]	663	663	663	663	663	663	663	663	663	663
Named	3	4	5	6	7	8	9	10	11	12
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev	2 µl Screen_delH_rev
Dream-Taq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH-G0 [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.17.5 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel shows unexpected fragments at ~3 Kb.

=> Clones are negative despite of latest results. Current strategy does not work out. Development new strategy.

New Gibson Strategy

Gibson Strategy without mRFP

Try a new construct without mRFP, so that we can exclude the red clones from the screening. Therefore we are going to use a new reverse primer for the Backbone which includes only the terminator of the mRFP, but not the mRFP. The primers for the Backbone are HM11 & HM17. The construct is named pHM04 and shown in week 16 were the idea was specified. For first approach pHM04, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology. In the second strategy pHM05, we will additionally introduce a tetracycline resistance, to ensure integration of the insert.

Vector Maps and Primers

1st strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.

Identifier	Order date	Note	Sequence
HM17:DelH_Terminator_BB_fw	16-08-2013	Amplification of Backbone pSb6A1-lacI-mRFP	ATTGGCGCTGGAGTACGCGCTGGACTGA aggcatcaaataaaacgaaaggctcag

2nd strategy: DelH & tetracycline resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.

Identifier	Order date	Note	Sequence
HM14:DelH_tetR_fw	2013-08-16	Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH	ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev	2013-08-16	Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1	Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw	2013-08-16	Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance	Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag

Amplification of Tetracycline Fragment

Preparation of Tetraycline Medium

Weight 100 mg of tetracycline and dissolve it in 10 ml ethanol = stock solution
Add 500 µl of stock solution in 100 ml LB and mix

Transformation of Tetrazyklin Backbone

For the new strategy we need a tetracycline resistance (length ~1.2 Kb) of the pSB1T3 Backbone (2013 Distribution, Plate 5, well 7A, insert: BBa_J04450) [http://parts.igem.org/Part:pSB1T3:Design|pSB1T3]
The primers are already designed and shown in the table above
With these primers, we amplify the tetracycline resistance and include an overlap to DelH end and the backbone pSB6A1 excluding the mRFP
For the transformation I incubated 10 min at room temperature the well 7A of plate 5 with 10 µl ddH₂O

PCR Conditions TR.W17.A

Reagent	pSB1T3	pSB1T3
Template	picked colony 1	picked colony 2
Primer fw 10 µM	1 µl HM14	1 µl HM14
Primer rev 10 µM	1 µl HM15	1 µl HM15
Phusion Ready Mix	10 µl	10 µl
ddH₂O	8 µl	8 µl

Cycles	Temperature DelH [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	30
18	98	1
	67	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.6 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from colony, l3: tetracycline resistance amplified from colony 2
l2-3: show no band = maybe annealing temperature to high

Gel does not schow any band.

=> Try amplification with lower annealing temperature.

PCR Conditions TR.W17.B

Reagent	pSB1T3
Template	picked colony
Primer fw 10 µM	1 µl HM14
Primer rev 10 µM	1 µl HM15
Phusion Ready Mix	10 µl
ddH₂O	8 µl
DMSO	-

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.7 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: 2 log, l2: tetracycline resistance amplified from new picked colony 1, l3: tetracycline resistance amplified from new picked colony 2,
l2-3: show no band

Gel does not show expected band.

=> Repeat amplification with miniprep, therefore miniprep the 3 colonies containing pSB1T3.

PCR Conditions TR.W17.C

Reagent	pSB1T3	pSB1T3	pSB1T3
Template	Minipreped pSB1T3	Minipreped pSB1T3	Minipreped pSB1T3
Primer fw 10 µM	2 µl HM14	2 µl HM14	2 µl HM14
Primer rev 10 µM	2 µl HM15	2 µl HM15	2 µl HM15
Phusion Ready Mix	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	55 (touchdown -0,5°C)	5
	72	30
18	98	1
	55	5
	72	30
1	72	5 min
1	4	inf

Result

Expected band: 1.468 Kb

Fig.17.8 gel of amplified tetracycline resistance (loaded 20 µL of PCR)
l1: tetracycline resistance amplified from minipreped colony 1, l2: tetracycline resistance amplified from minipreped colony 2, l3: tetracycline resistance amplified from minipreped colony 3,l4: 2 log,
l1-3: show expected band = was cut

Gel does show expected band.

=> Fragment was cut and gel extracted (c= 132.1 ng/µl).

Amplification of Backbone

PCR Conditions BB.W7.A

With new primers (HM16 & HM17)

Reagent	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3.08	1 µl BB 3.08
Primer fw 10 µM	2 µl HM11	2 µl HM11
Primer rev 10 µm	2 µl HM16	2 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O 5µl	5 µl

Cycles	Temperature DelH BB [°C]	Time [s]
1	98	5
12	98	1
	69 (touchdown -0,5°C)	5
	72	75
18	98	1
	68	5
	72	75
1	72	5 min
1	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.9 gel of amplified BB (loaded 25 µL of PCR)
l1: BB amplified with HM16, l2: BB amplified with HM17
l1:specific band as expected = was cut out

Gel shows specific band for amplification using HM16.

=> Fragment wa scut and gel extracted. For HM17, run a two-step PCR because of it's high annealing temperature. Also we are going to rise the amplification time to 1:30 min.

PCR Conditions BB.W7.B

Reagent	BB with tetracycline & without mRFP	BB without mRFP	BB with tetracycline & without mRFP	BB without mRFP
Template	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08	1 µl BB 3,08
Primer fw 10 µM	2 µl HM11	2 µl HM11	5 µl HM11	5 µl HM11
Primer rev 10 µM	2 µl HM16	2 µl HM17	5 µl HM16	5 µl HM17
Phusion Flash Ready Mix	10 µl	10 µl	25 µl	25 µl
ddH₂O	5 µl	5 µl	14 µl	14 µl

Cycles	Temperature (20 µl = sample 1 & 2) [°C]	Time	Temperature (50 µl = sample 3 & 4) [°C]	Time [s]
1	98	5	98	5
12	98	1	98	1
	69 (touchdown -0,5°C)	5	-
	72	90	72	90
18	98	1	98	1
	68	5	-
	72	90	72	90
1	72	5 min	72	5 min
1	4	inf	4	inf

Result

Expected band: ~ 4.4 Kb

Fig.17.10 gel of amplified BB with different primers (loaded 20 µL of PCR)
l1: BB amplified with HM16 by 2-step PCR, l2: BB amplified with HM17by 2-step PCR, l3: BB amplified with HM16, l4: BB amplified with HM17, l5: DelH-G0
all 4 samples (l1-4) showed a specific band at 4.4 Kb = was cut

All samples show expected length.

=> Fragments were cut and gel extracted.

Sample	Concentration [ng/µl]
BB-16	76.7
BB-17	51.3

Restriction Digest with DpnI

Incubated at 37°C for 2.5 h

Sample [µl]	Buffer [µl]	Enzyme [µl]
18 BB-16	2.1 CutSmart Buffer	1 DpnI
18 BB-16	2.1 CutSmart Buffer	1 DpnI

Afterwards, a purification was performed with the nucleotide removal kit

Generation of DelH Plasmid pHM04 23-08

Summary of Fragments

Fragment	Concentration [ng/µl]	Date
G0	6.4	22-08
G1/2a	8.5	22-08
G2b	18.6	Example
BB	Example	22-08

Gibson Assembly

Mix name	DelH G0	DelH G1/2a	DelH G2b	BB17	Gibson Master Mix [µl]	Final volume [µl]
E1	9	-	-	0.5	10	20
E2	-	7	2.5	0.5	10	20

Incubate the Gibson Assembly for 1 h at 50°C

Electroporation

Sample	Electroporated with	Plated out	Cuvette "exploded"
1	1 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
2	14 µl of E1 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
3	1 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	-
4	14 µl of E2 (5 µl Gibson + 10 µl ddH₂O)	22.08.2013	v
5	20 µl of E1 (purified by isoprop-precipitation)	22.08.2013	-
6	20 µl of E2 (purified by isoprop-precipitation)	22.08.2013	- (no pellet observed)

Colony-PCR CP.W17.C

50 colonies of plate 5 (= isoprop purified E1 => G0-complete in Backbone)
10 colonies of plate ...
2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	50 x 1 PC S5	50 x 1 PC S5	4 x 1 PC S3	4 x 1 PC S3
Expected length [bp]	663	2,500	663	2,500
Named	A -J (5 colonies per tube)	A -J (5 colonies per tube)	1-4	1-4
Primer fw 10 µM	10 x 1 µl VF2	10 x 1 µl HM13	4 x 1 µl VF2	4 x 1 µl HM13
Primer rev 10 µM	10 x 1 µl DN07	10 x 1 µl VR2	1 µl DN07	1 µl VR2
Dream-Taq Polymerase (2x)	10 x 10 µl	10 x 10 µl	4 x 10 µl	4 x 10 µl
ddH₂O	10 x 8 µl	10 x 8 µl	4 x 8 µl	4 x 8 µl

Cycles	Temperature Screening start[°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.11 colony PCR of Gibson assembled DelH-BB with mRFP (loaded 20 µL of PCR)
l1:
l3-12:show an unexpected fragment at ~ 3Kb

Gel does not show expected bands.

=> Screen 10 minipreped colonies of the plate 5 and pick another 10 colonies of plate 1, 2, 3 and 6 (on plate 4 are no colonies).

Colony-PCR CP.W17.D

2 different screening are performed
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	10 x 1 PC S1	10 x 1 PC S1	10 x 1 PC S2	10 x 1 PC S2	10 x 1 PC S3	10 x 1 PC S3	10 x 1 PC S6	10 x 1 PC S6	10 x 1 µl of minipreped colony	10 x 1 µl of minipreped colony
Expected length [bp]	663	2.5	663	2.5	663	2.5	663	2.5	663	2.5
Named	1A-E (2 colonies per tube)	1F-J (2 colonies per tube)	2A-E (2 colonies per tube)	2F-J (2 colonies per tube)	3A-E (2 colonies per tube)	3F-J (2 colonies per tube)	6A-E (2 colonies per tube)	6F-J (2 colonies per tube)	.............	....................
Primer fw 10 µM	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13	5 x 1 µl VF2	5 x 1 µl HM13
Primer rev 10 µM	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2	5 µl DN07	5 µl VR2	5 x 1 µl DN07	5 x 1 µl VR2
Dream-Taq Polymerase (2x)	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl	5 x 10 µl
ddH₂O	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 8 µl	5 x 6 µl	5 x 6 µl

Cycles	Temperature Screening start [°C]	Time [s]	Temperature Screening end [°C]	Time [s]
1	95	120	95	120
12	95	60	95	60
	68 (touchdown -0.5°C)	30	60 (touchdown -0.5°C)	30
	72	45	72	2:30 min
12x/ 34x	95	60	95	60
	65	30	60	30
	72	45	72	2:30 min
1	72	5 min	72	5 min
1	12	inf	12	inf

Result

Expected band: 663 bp (screening start), 2.5 Kb (screening end)

Fig.17.13 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VR2 and HM13 (loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

Fig.17.12 colony PCR of Gibson assembled DelH-BB without mRFP with the screening primer VF2 and DN11(loaded 1 µL of PCR)
l1:2log ladder l2-24: PCR of picked colonies from plate 1,2,3,5,6
no band at 663 bp observed

None of the gels shows expected fragment.

=> Overthink strategy.

Overview
Experiments

test

Amplification of 1

26-08 - 01-09-13

Generation of DelH Plasmid pHM05 26-08

Overview on Fragments

Fragment	Concentration [ng/µl]	Date
G0	6.4	22-8
G1/2a	8.5	22-08
G2b	18.6	09-08
BB	40.6	22-08
TetR	132.1	26-08

Gibson Assembly

Mix name	DelH-G0	DelH-1/2a	DelH-G2b	BB17	TetR (1:10)	GibsonMasterMix	Final volume
0	8.5 µl	-	-	0.5 µl	1 µl	10 µl	20 µl
1	-	6.5 µl	2 µl	0.5 µl	1 µl	10 µl	20 µl

Incubate the Gibson Assembly for 1 h at 50°C in Thermocycler

Electroporation

In the next step, we purify 10 µl with Isoprop purification protocol and another 5 µl we dilute with ddH₂O (10 µl)

Sample	Amount	Used in Elektroporation
0 A	5 µl + 10 µl ddH₂O	1 µl 14 µl
0 B	20 µl isoprop purified	20 µl
1 A	5 µl + 10 µl ddH₂O	1 µl 14 µl
1 B	20 µl isoprop purified	20 µl

Colony-PCR CP.W18.A

10 colonies of plate 1-8 (names are explained in the following table)
PC = picked colony
S5 = Sample 5 (watch names above on construct DelH-BB)

Template	10 x 1 PC S5	50 x 1 PC S5	4 x 1 PC S3	4 x 1 PC S3
Expected length [bp]	663	663	663	663
Named	A -J (5 colonies per tube)	A -J (5 colonies per tube)	1-4	1-4
Primer fw 10 µM	10 x 1 µl VF2	10 x 1 µl VF2	4 x 1 µl VF2	4 x 1 µl VF2
Primer rev 10 µM	10 x 1 µl DN07	10 x 1 1 µl DN07	1 µl DN07	1 1 µl DN07
Dream-Taq Polymerase (2x)	10 x 10 µl	10 x 10 µl	4 x 10 µl	4 x 10 µl
ddH₂O	10 x 8 µl	10 x 8 µl	4 x 8 µl	4 x 8 µl

Cycles	Temperature Screening start [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
14	95	60
	65	30
	72	45
1	72	5 min
1	12	inf

Result

Expected band: 663 bp

Fig.18.3 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l2-5: colony PCRs from Del-rest Team, l6-13: colony PCRs from colonies 32,33,35,39,41,42,46
there is no specific bright band at the expected band of 663 bp

Fig.18.2 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l27-50: colony PCRs from colonies 26-50
colony 32,33,35,39,41,42,46 shows a shadow specific band at ~600 bp, we expect 663 bp

Fig.18.1 colony PCR of Gibson assembled DelH-BB without mRFP & tetR (loaded 7 µL of PCR) with DN07 & VF2
l1: 2log ladder, l2-26: colony PCRs from colonies 1-25
l16colony 15 shows a shadow specific band at ~600 bp, we expect 663 bp

Colonies 15, 32, 33, 35, 39, 41, 42 and 46 show a shadow specific band at ~600 bp, slightly too low. => ?????

Amplification of DelH G0

Gradient-PCR Conditions G0.W18.A

Reagent	G0	G0	G0	G0
Expected length [Kb]	18	18	18	18
Named	G0 65	G0 66	G0 67	G0 68
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl
DMSO	1	1	1	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65/66/67/68	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.5 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 amplified at 65°C, l3:G0 amplified at 66°C, l4:G0 amplified at 67°C, l5: G0 amplified at 68°C,
l4: G0 at 67°C was cut out

Fig.18.4 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 amplified at 65°C, l3:G0 amplified at 66°C, l4:G0 amplified at 67°C, l5: G0 amplified at 68°C,
l2-5: show slightly band at expected 18 Kb, the 5 Kb band is observed at every temperature, the best temperature seems to be 67°C

Gel shows unspecific band at 5 Kb. G0 was best amplified at 67°C.

=> Fragment was cut and gel isolated.

Re-PCR Conditions G0.W18.B

Reagent	G0	G0
Expected length [Kb]	18	18
Named	G0	G0 1
Template	1 µl gel extracted G0 from 22-08	1 µl gel extracted G0 from 26-08
Primer fw 10 µM	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	6 µl	6 µl
DMSO	1	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 , l3: G0 , l4: G1/2a
a slight band can be observed at 18 Kb, but 5 Kb is much more amplified

A slight band can be observed at 18 Kb, but 5Kb is much more amplified.

=> By NCBI-Blast we found out that primer HM08 can also bind inside of DelH with 6 mismatches and the forward primer DN11 can also bind with 4 mismatches inside the DelH = possible explanation for 5 Kb.

=> Change the amplification conditions.

PCR Conditions G0.W18.C

Reagent	G0	G0	G0
Expected length [Kb]	18	18	18
Named	0	1	2
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM08	1 µl HM08	1 µl HM08
Phusion II Polymerase (Hot Start)	0.2 µl	0.2 µl	0.2 µl
dNTPs	0.4 µl	0.4 µl	0.4 µl
GC buffer (5x)	4 µl	4 µl	4 µl
ddH₂O	12.4 µl	11.4 µl	10.4 µl
DMSO	0 µl	1 µl	2 µl

Cycles	Temperature [°C]	Time [s]
1	98	30
30	98	10
	65	20
	72	5:00 min
1	72	10 min
1	12	inf

Result

Expected band: 18 Kb

Fig.18.7 gel of amplified DelH-fragment with different DMSO concentrations and a GC-buffer (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 without DMSO , l3: G0 with 1 µl DMSO, l4:G0 with 2 µl DMSO,
only l4 with 2 µl DMSO shows any band, but not the expected at 18 Kb, only the band at 5 Kb.

Only PCR with 2 µl DMSO shows any band, but not the expected at 18 Kb, only the band at 5 Kb.

=> Further improve PCR condtions.

Amplification of DelH G1/2a

Re-PCR Conditions G1/2a.W18.A

Reagent	G1/2a
Expected length [Kb]	18
Named	G1/2a
Template	1 µl gel extracted G0 from 22-08
Primer fw 10 µM	1 µl DN11
Primer rev 10 µM	1 µl HM06
Phusion Flash Ready Mix	10 µl
ddH₂O	6 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	65	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 18 Kb

Fig.18.6 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G0 , l3: G0 , l4: G1/2a
a slight band can be observed at 18 Kb, but 5 Kb is much more amplified

Expected fragment was amplified, but gel shows numerous side bands.

=> Fragment was cut and gel isolated.

Gradient-PCR Conditions G1/2a.W18.A

Reagent	G1/2a	G1/2a	G1/2a	G1/2a
Expected length [Kb]	13	13	13	13
Named	1	2	3	F
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl gel extracted G1/2a fragment
Primer fw 10 µM	1 µl DN11	1 µl DN11	1 µl DN11	1 µl DN11
Primer rev 10 µM	1 µl HM06	1 µl HM06	1 µl HM06	1 µl HM06
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	5 µl	4 µl	6 µl
DMSO	1	2	3	1

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	67	5
	72	4:45 min
1	72	10 min
1	12	inf

Lid preheated at 98°C
No hot start

Result

Fig.18.7 gel of amplified DelH-fragment (loaded 20 µL of PCR)
l1: 1Kb+ ladder, l2: G1/2a with 1 µl DMSO, l3:G1/2a with 2 µl DMSO, l4:G1/2a with 3 µl DMSO, l5: G1/2a with 1 µl DMSO amplified from the fragment itself
no band at 18 Kb

=> There is no band at 18 Kb visible - entire DelH fragment could not be amplified.

Amplification of DelH FS64 - FS71

PCR Conditions FS64-FS71.W18.A

Reagent	DN11-FS66	FS67-FS68	FS69-HM08	FS69-FS70	FS71-HM08	FS67 -HM08
Expected length [Kb]	4.7	4.0	9.7	7.0	2.8	14.0
Named	1	2	3	4	5	6
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DN11	2.5 µl FS67	2.5 µl FS69	2.5 µl FS69	2.5 µl FS71	2.5 µl FS67
Primer rev 10 µM	2.5 µl FS66	2.5 µl FS68	2.5 µl HM08	2.5 µl FS70	2.5 µl HM08	2.5 µl HM08
Phusion Flash Ready Mix	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	3 µl	3 µl	3 µl	3 µl	3 µl	3 µl
DMSO	1	1	1	1	1	1

Cycles	Temperature DN11-FS66 [°C]	Time [s]
1	98	5
12	98	1
	68↓	5
	72	1:25 min
18	98	1
	66	5
	72	85
1	72	6 min
1	10	inf

Cycles	Temperature [°C]	Time FS67 - FS68	Time FS69-HM08	Time FS69-FS70	FS67 -HM08	Time FS71-HM08
1	98	5	5	5	5	5
12	98	1	1	1	1	1
	66↓	5	5	5	5	5
	72	70	3:00 min	2:10 min	4:38 min	52
18	98	1	1	1	1	1
	64	5	5	5	5	5
	72	70	3:00 min	2:10 min	4:38 min	52
1	72	5 min	10 min	5 min	5 min	5 min
1	10	inf	inf	inf	inf	inf

Lid preheated at 98°C
No hot start

Result

Expected bands: DN11-FS66 = 4.7 Kb, FS67-FS68 = 4.0 Kb, FS69-HM08 = 9.7 Kb, FS69-FS70 = 7.0 Kb, FS71-HM08 = 2.7 Kb, FS67-HM08 = 14 Kb

Fig.18.8 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2: DelH amplified with DN11 & FS66, l3:DelH amplified with FS67 & FS68, l4:DelH amplified with FS71 & HM08,
l2: shows expected band at 4.7 Kb, 4.0 Kb and 2.7 Kb => all 3 bands were cut.

Gel shows expected fragments of DN11-FS66, FS67-FS68 and FS71-HM08

=> Bands were cut. Run gel with remaining sample for gel extraction.

=> Optimize remaining PCRs.

Amplification of DelH DN11-FS66

PCR Conditions DN11-FS66.W18.A

Reagent	4x DN11 - FS66
Expected length [Kb]	4.7
Named	1
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl DN11
Primer rev 10 µM	2.5 µl FS66
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68↓	5
	72	85
18	98	1
	66	5
	72	85
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 4.7 Kb

Fig.18.9 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

Amplification of DelH FS67-FS68

PCR Conditions FS67-FS68.W18.A

Reagent	4x FS67-FS68
Expected length [Kb]	4.0
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS67
Primer rev 10 µm	2.5 µl FS68
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66↓	5
	72	1:10 min
18	98	1
	64	5
	72	70
1	72	5 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 4.0 Kb

Fig.18.10 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

Amplification of DelH FS71-HM08

PCR Conditions FS71-HM08.W18.A

Reagent	FS71-HM08
Expected length [Kb]	2.8
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS71
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature A [°C]	Time	Temperature B [°C]	Temperature C [°C]
1	98	5	98	98
12	98	1	98	98
	68↓	5	-	69
	72	52	72	72
18	98	1	98	98
	66	5	-	69
	72	52	72	72
1	72	6 min	72	72
1	10	inf	10	10

Lid preheated at 98°C
No hot start

Result

Expected band: 2.8 Kb

Fig.18.11 Gel of amplified DelH-fragments(with different new primer combinations) (loaded 20 µL)
l1:2log ladder, l2-5: DelH amplified with DN11 & FS66, l6-9:DelH amplified with FS67 & FS68, l10:DelH amplified with FS67 & HM08, l11:DelH amplified with FS71 & HM08
l2-5: shows expected band at 4.7 Kb, l6-9: at 4.0 Kb, l10 doesn't show band at 14 Kb, l11:show band at 2.7 => all specific bands were cut out

Bands could not be used, because too much UV light was applied.

PCR Conditions FS71-HM08.W18.B

Reagent	FS71-HM08
Expected length [Kb]	2.8
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS71
Primer rev 10 µM	2.5 µl HM08
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	72.3	5
	72	52
30	98	1
	66	5
	72	52
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Result

Expected band: 2.8 Kb

Fig.18.12 Gel of amplified DelH-fragments(with different FS71 & HM08) (loaded 20 µL)
l1:2log ladder, l2: used constant 68°C annealing, l3:used touch down PCR with 70°C annealing
l2 and l3 show specific band = was cut

Both condistions resulted in the expected fragment.

=> Fragments were cut and gel extracted.

=> Run new PCR with 72.3°C constant annealing temperature because of the slight side bands.

Amplification of DelH FS69-FS70

PCR Conditions FS69-FS70.W18.A

Reagent	FS69-FS70
Expected length [Kb]	7.0
Named	FS69-FS70
Template	1 µl D. acidovorans glycerol stock
Primer fw 10 µM	2.5 µl FS69
Primer rev 10 µM	2.5 µl FS70
Phusion Flash Ready Mix	10 µl
ddH₂O	3 µl
DMSO	1

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66↓	5
	72	2:10 min
18	98	1
	64	5
	72	2:10 min
1	72	6 min
1	10	inf

Lid preheated at 98°C
No hot start

Characterization of Amplified DelH Fragments

Test Restriction Digest

Fragment	Fragment length [Kb]	Digestes with following enzymes	Expected bands [Kb]
DN11-FS66	4.7	EcoRV	3.7 & 0.9
FS67-FS68	4.0	NotI	2.7 & 1.3
FS69-FS70	7.0	SalI	5.5 & 1.6
FS71-HM08	2.8	NotI & HindIII	1.3 & 1.1 & 0.3

Fragment	Amount in digest	Enzyme	Buffer	ddH₂O	Final amount
DN11-FS66	5 µl	1 µl EcoRV	2 µl 3.1 buffer	10.9 µl	20 µl
FS67-FS68	5 µl	1 µl NotI	2 µl 3.1 buffer	10.9 µl	20 µl
FS69-FS70	5 µl	1 µl SalI-HF	2 µl CutSmart buffer	12 µl	20 µl
FS71-HM08	5 µl	1 µl NotI-HF & HindIII-HF	2 µl CutSmart buffer	11 µl	20 µl

Result

Expected banda are listed above.

Fig.18.14 Test restriction digest
l1:2log ladder, l2: DN11-FS66 (EcoRV), l3:FS67-FS68 (NotI) l4:FS69-FS70 (SalI), l5:FS71-HM08 (NotI & HindIII)

The test digest showed that the first fragment is cut, because the band is around 3.7 Kb, but the third and fourth lane on the gel picture show the complete non-digested fragment and on line 5 the FS71-HM08 fragment is not visible.

=> check again the digests.

Generation of DelH Plasmid pHM04 and pHM05 30-08

Gibson Assembly

Fragment	Concentration [ng/µl]	Amount with BB16 & tetR [µl]	Amount with BB17 [µl]	Amount with mRFP BB of pHM03
DN11-FS66	172.5	1.67	1.47	1.67
FS67-FS68	120.7	2.03	1.79	2.03
FS69-FS70	211.3	2.03	1.79	2.03
FS71-HM08	146	1.18	1.04	1.18
BB16	40.3	2.54	0	0
tetR (1:10)	13.2	0.56	0	0
BB17	23.0	0	3.91	0
BB+mRFP (pHM03)	0	0	0	3.08

Electroporation of pHM04

10 µl H₂O were added to 5 µl of the Gibson assembly mix. 1 µl and 14 µl were electroporated into electrocompetent DH10ß. Cells were incubated at 37°C for 1 h and streaked (10% vs. 90%) on LB Amp plates and stored ON at 37°C.

Colony-PCR Conditions CP.W18.B

14 colonies (#7 was left out) were picked and screened for correct integration of first DelH fragmenta s well as grown in 500 µl LB Amp.

Template	DelH construct pHM04 30-08
Expected length [bp]	663
Named	Colonies 1 - 15
Primer 10 µM fw	2 µl VF2
Primer 10 µM rev	2 µl DN07
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	66 (touchdown -0.5°C)	30
	72	2:30 min
18	95	60
	65	30
	72	2:30 min
1	72	5 min
1	12	inf

Result

Expected band: 663 bp

Fig.18.15 Colony PCR for sceening if first DelH fragment was integrated in backbone.
l1:1Kb plus ladder, l2-l7: colonies 1-6, l8-l12: colonies 8-12, l13-l14: 1Kb plus ladder, l15-l7: colonies 13-15

Colonies 1, 3, 4, 6, 12 and 15 show positive band.

=>Of the 250 µl liquid culture, screening PCRs for the correct insertion of the last DelH fragment were performed. To the remaining 250 µl, 8 ml LB Amp were added. Colonies 1 and 3 did not grow and were excluded from further analysis.

Colony-PCR CP.W18.C

Template	pHM04 30-08
Expected length [Kb]	2.5
Named	Colonies 1 - 15
Primer 10 µM fw	2 µl HM13
Primer 10 µM rev	2 µl VR
Dream-Taq Polymerase (2x)	10 µl
ddH₂O	6 µl

Cycles	Temperature [°C]	Time [s]
1	95	120
12	95	60
	65 (touchdown -0.5°C)	30
	72	2:30 min
18	95	60
	65	30
	72	2:30 min
1	12	inf

Results

Expected band: 2.5 Kb

Fig.18.16 Colony PCR for sceening if last DelH fragment was integrated in backbone.
l1:2log ladder, l2: colony 6, l3: colony 12, l4: colony 4, l5: colony 15

Colonies 4, 6, 12 and 15 show positive band. => Of 2 ml of the cultures, glycerol stocks were prepared. 3 ml were mini preped and test digested. The remaining 3 ml were stored.

Test Restriction Digest of Colony S4

Clone	Concentration [ng/µl]	Amount in digest	Enzyme	Buffer	ddH₂O	Final amount
pHM04 S4	400 ng/µL	1 µl	1 µl EcoRV	1 µl CutSmart buffer	8 µl	10 µl
pHM04 S4	400 ng/µL	1 µl	1 µl NotI	1 µl CutSmart buffer	8 µl	10 µl
pHM04 S4	400 ng/µL	1 µl	1 µl SalI-HF	1 µl CutSmart buffer	8 µl	10 µl

Result

Expected bands are shown in table below.

Clone	Clone length [bp]	Digestes with following enzymes	Expected bands [bp]
pHM04 S4	22,937	EcoRI	17,829 & 5,108
pHM04 S4	22,937	NotI	11,079, 6201, 3,998 & 1,628
pHM04 S4	22,937	PvuI	11,621, 8628 & 2,685

Fig.18.17 Test restriction digest of pHM04
l1:2log ladder, l2: pHM04 (EcoRI), l3:pHM04 (NotI) l4:pHM04 (PvuI)

The expected bands were not there. So the colony seems not to have the entire DelH-plasmid. .

Overview
Experiments

test

Amplification of 1

02-09 - 08-09-13

Characterization of DelH Plasmid pHM04 30-08 Clone 12

Maxiprep

1 ml of an ON culture DH10ß-DelH were inocculated in 200 ml LB Amp and cultured ON at 37°C.
Maxi prep was performed by upscaling of mini precipitation protocol.

Result

The maxi prep yielded 6x 180 µl.

Maxi prep	Concentration [µg/µl]
1	5.40
2	5.37
3	5.42
4	5.40
5	5.38
6	5.42

Sequencing showed a mutation at the beginning of DelH

Next steps

=> Sequencing the other 3 positive colonies => hopefully one of them has no mutation at the beginning of DelH

=> Sequence D. acidovorans, maybe the organism SPH1 was not perfectly sequenced => amplify with FS35 & DN07

Characterization of DelH Plasmid pHM04 30-08 Clones 4, 6, 15

Sequencing

Miniprep performed
Send in for sequencing => no reliable result
Maxiprep performed => Clone 4: c= 5.51 µg/µl, Clone 6: c= 3.71µg/µl, Clone 15: c= 4.65 µg/µl
Send in for sequencing with DN07 again

Result

Sample	Alignment File
Midi-col 4	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt
Midi-col 6	sequencing insufficient
Maxi-col 15	sequencing insufficient

Electroporation

Because the sequenced DelH colony 12 has a mutation at the beginning of the coding DNA, we are sequencing the other colonies and parallel we transformed with the rest of the same Gibson Mix (15 µl) used for the electroporation before (colonies 4, 6, 12, 15). In advance, we purified it via isoprop purification protocol.

Sample	Isoprop purified Gibson Mix	Colonies grown?
A	10 µl	yes
B	20 µl	yes (a lot more than on sample A)

Colony-PCR conditions CP.W19.A

There were 30 colonies screened. 3 per tube and in total 10 colonies of sample A & 20 colonies of sample B

Template	3 PC of S-A	3 PC of S-A	4 PC of S-A	3 PC of S-B	3 PC of S-B	4 PC of S-B	3 PC of S-B	3 PC of S-B	4 PC of S-B
Expected length [bp]	663	663	663	663	663	663	663	663	663
Named	1-3	4-6	7-10	11-13	14-16	17-20	21-23	24-26	27-30
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07
iTaq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	60
	68 (touchdown -0.5°C)	30
	72	45
18	95	60
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.19.1 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:2log, l2:colonies 1-3, l3:colonies 4-6, l4:colonies 7-10, l5:colonies 11-13, l6:colonies 14-16, l7:colonies 17-20, l8:colonies 21-23, l9:colonies 24-26, l10:colonies 27-30
l4, l5,l8,l10:show the specific band at 663 bp

Some of the colony mixes show positive band.

=> Screen again colonies 7-10, 11-13, 17-20, 27-30 in a single PCR tubes.

Colony-PCR conditions CP.W19.B

Template	7	8	9	10	11	12	13	17	18	19	20	27	28	29	30
Expected length [bp]	663	663	663	663	663	663	663	663	663	663	663	663	663	663	663
Named	7	8	9	10	11	12	13	17	18	19	20	27	28	29	30
Primer fw 10 µM	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2	2 µl VF2
Primer rev 10 µM	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07	2 µl DN07
iTaq Polymerase (2x)	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
ddH₂O	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl	6 µl

Cycles	Temperature DelH [°C]	Time [s]
1	95	120
12	95	30
	68 (touchdown -0.5°C)	30
	72	45
18	95	30
	65	30
	72	45
1	12	inf

Result

Expected band: 663 bp

Fig.19.3 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:50 bp ladder, l2:colonies 18, l3:colonies 19, l4:colonies 20, l5:colonies 27, l6:colonies 28, l7:colonies 29, l8:colonies 30
l3 and l7 show the expected band at 663 bp = col 19 & 29

Fig.19.2 colony PCR of Gibson assembled DelH-BB without mRFP (loaded 20 µL of PCR)
l1:50 bp ladder, l2:colonies 7, l3:colonies 8, l4:colonies 9, l5:colonies 10, l6:colonies 11, l7:colonies 12, l8:colonies 13, l9:colonies 17
l2 and l8show the expected band at 663 bp = col 7 & 13

Colonies 7,13, 19 & 29 show a definit result

=> Add medium and perform a mediprep the next day for sending in for sequencing.

Midiprep

Performed with 300 µl P1, 600 µl P2 and after incubating for 180 450 µl S3. Protocol was performed with isoprop/ethanol purification.

Sample	Concentration [ng/µl]
Midi-col 7	2628.5
Midi-col 13	2379.3
Midi-col 19	2846.6
Midi-col 29	2846.6

Test Restriction Digest

We performed a test digest with EcoRI-HF of the screened samples col 7, col 13, col 19, col 29. We expect a band of 17.9 Kb and 4.9 Kb.

Sample	Concentration [ng/µl]	Amount in restriction digest	EcoRI-HF [µl]	CutSmartBuffer [µl]	ddH₂O [µl]	Total amount [µl]
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	1	2	16.5	20
Midi-col 13	2379.3	0.5 µl = 1189.65 ng	1	2	16.5	20
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	1	2	16.5	20
Midi-col 29	2846.6	0.5 µl = 1423.3 ng	1	2	16.5	20

Incubation time: 1 h at 37 °C

Result

Expected bands: 17.9 Kb and 4.9 Kb

Fig.19.4. Test digest of pHM04 from different colonies with EcoRI-HF (loaded 20 µL of PCR)
l1:1kb+ ladder,l2:colony 7,l3:colony 19,l4:colony 29,l5:colony 13,
l2-3:show the expected bands at ~5 Kb and ~18 Kb

Colonies 7 & 13 show a definit result

=> Add medium and perform a mediprep the next day for send in for sequencing.

Sequencing

The colonies 7 & 19 were sent in MWG for sequencing. There for we prepared 15 µl of the plasmid (midiprep) with a concentration of 50-100 ng/µl and added 2 µl DN07 primer (10µM)

Sample	Concentration [ng/µl]	Amount for sequencing	ddH₂O added up to 15 µl	Final concentration [ng/µl]
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	14.5	87.62
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	14.5	94.89
Maxi-col 4	5500	2 µl of 1:10 dilution = 1100 ng	13	73.3

Result

Sample	Alignment File
Midi-col 7	File:Heidelberg Sequencing Result pHM04 DN07 colony 7.clustal.txt
Midi-col 19	File:Heidelberg Sequencing Result pHM04 DN07 colony 19-2.clustal.txt
Maxi-col 4	File:Heidelberg Sequencing Result pHM04 DN07 colony 04.clustal.txt

Test Restriction Digest

We performed a test digest with EcoRI-HF and PvuI-HF of the screened samples col 4, col 7, col 19. We expect a band of 17.9 Kb and 4.9 Kb for the digest with EcoRI-HF and bands of 11.5 Kb, 8.5 Kb and 2.6 Kb.

Sample	Concentration [ng/µl]	Amount in restriction digest	Enzyme	CutSmartBuffer [µl]	ddH₂O [µl]	Total amount [µl]
Midi-col 4	5500	0.25 µl = 1375 ng	EcoRI-HF 1 µl	2	16.75	20
Midi-col 4	5500	0.25 µl = 1375 ng	PvuI-HF 1 µl	2	16.75	20
Midi-col 7	2628.5	0.5 µl = 1314.25 ng	PvuI-HF 1 µl	2	16.5	20
Midi-col 19	2846.6	0.5 µl = 1423.3 ng	PvuI-HF 1 µl	2	16.5	20

Incubation time: 1:20 h at 37 °C

Result

Expected band: 17.9 Kb and 4.9 Kb (EcoRI-HF) and 11.5 Kb, 8.5 Kb and 2.6 Kb (PvuI)

Fig.19.5. Test digest of pHM04 from different colonies with EcoRI-HF and PvuI (loaded 20 µL of PCR)
l1:1kb+ ladder,l2:colony 4 EcoRI,l3:colony 4 PvuI,l4:colony 7 PvuI,l5:colony 19 PvuI,
l2-3:show the expected bands

Colony 7 is the only colony which is positiv for all restriction digests.

=> Electroporate plasmid together with DelRest plasmid, as well as the Methylmanolyl-CoA plasmid.

Sequencing of D. acidovorans

PCR Conditions DA.W19.A

For being sure that the mutation at the beginning of DelH is not some mistake in the sequenced genome we amplify this part with one primer binding the delG (FS35) and the screening primer binding at the beginning of DelH (DN07) and let it sequence with GATC.

Template	1 µl glycerol stock of D. acidovorans	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5	6.5
Named	TD	2step
Primer fw 10 µM	2 µl FS35	2 µl FS35
Primer rev 10 µM	2 µl DN07	2 µl DN07
Phusion Flash (2x)	10 µl	10 µl
ddH₂O	4 µl	4 µl
DMSO	1 µl	1 µl

Cycles	Temperature A [°C]	Time [s]	Temperature B[°C]	Time [s]
1	98	10	98	10
12	98	1	98	1
	68 (touchdown -0.5°C)	5	-	-
	72	130	72	120
18	98	1	98	1
	66	5	-	-
	72	130	72	120
1	72	10 min	72	10 min
1	12	inf	12	inf

Result

Expected band: 6.5 Kb

Fig.19.7 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:2log, l3-4PCR of 2 step, l5-6 PCR of 68 td
l3-6:show expected band at 7 Kb = was cut

Fig.19.6 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:2log, l3-4PCR of 2 step, l5-6 PCR of 68 td
l3-6:show expected band at 7 Kb

Gel shows expected band.

=> Fragments were cut but not extracted, because side bands were cut too.

=> Run again PCR with 72.3 °C annealing temperature.

PCR Conditions DA.W19.B

Template	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5
Named	FS35-DN07
Primer fw 10 µM	2 µl FS35
Primer rev 10 µM	2 µl DN07
Phusion Flash (2x)	10 µl
ddH₂O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	72.3	5
	72	120
1	72	10 min
1	12	inf

Result

Expected band: 6.5 Kb

Fig.19.9 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb = was cut

Fig.19.8 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb

Gel shows expected band at ~7 Kb.

=> The fragment was cut and gel purified. Nevertheless the bands were rather weak, so the PCR was repeated.

PCR Conditions DA.W19.C

Template	1 µl glycerol stock of D. acidovorans
Expected length [Kb]	6.5
Named	FS35-DN07
Primer fw 10 µM	2 µl FS35
Primer rev 10 µM	2 µl DN07
Phusion Flash (2x)	10 µl
ddH₂O	4 µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
	72.3	5
	72	120
1	72	10 min
1	12	inf

Result

Expected band: 6.5 Kb

Fig.19.11 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb = was cut out

Fig.19.10 Amplified fragments of DelG-DelH-beginning (loaded 20 µL of PCR)
l1:1kb plus ladder, l2-4PCR with 72.3°C annealing :show expected band at 7 Kb

Gel shows expected fragment.

=> The fragment was cut and gel purified.

=> Send in for sequencing with DN07.

Retrieved from "http://2013.igem.org/Team:Heidelberg/Delftibactin/DelH"