From 2013.igem.org

(Difference between revisions)

Revision as of 13:02, 3 October 2013

Del H. This bitchy 18 kbp fragment.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Week 1

In order to transfer the gold precipitating NRPS from D. acidovorans to E.coli, the necessary modules will be amplified from the D. acidovorans genome and assembled as plasmids. Due to its large size of 18 kb, the module DelH will be expressed on a separate plasmid. A strategy was developed, primers designed accordingly and necessary BioBricks retrieved from the distribution. The D. acidovorans was obtained from the DSMZ and cultured in Acidovorax complex medium.

Week 2

Using the designed primers DelH_f1_PacI_fw and DelH_f1_SalI_rev, the first PCRs to amplify DelH F1 as well as DelH_f2_SalI_fw and DelH_f2_KpnI_rev to amplify DelH F2 were performed and conditions optimized. Additionally, necessary backbone fragments pSB6A1 and lacZ were generated by restriction digest. New BioBricks to obtain the AraC promotor (I13453 and K206000) were chosen.

Week 3

Since the reverse backbone primer DN08:AraCbb_PacI_rev did not work, a new one (DN06:AraCbb_PacI_rev2) was ordered, together with the colony PCR screening primers DN07:Screen_DelH_rev and DN13:Screen_DelH_fw to check for correct ligation of the DelH fragment F1.

Week 4

The elongation of the pSB6A1-AraC-lacZ backbone turned out to be difficult. So in week 4, we performed different restriction digests both with our final backbone pSB6A1-AraC-lacZ and with the former construct pSB1C3-AraC-lacZ to verify the identity of the backbone. Besides, the amplification of the DelH fragment F1 was planned: it will be amplified in 2 subfragments - fragment F1a and fragment F1b (both 5 kb in size).

Week 5

This week, we started over with the assembly of the backbone pSB6A1-AraC-lacZ: digesting AraC, lacZ and PSB6A1 based on the previously amplified fragments. The amplification of DelH was continued and we succesfully amplified all three fragments and gel-extracted them.

Week 6

Since all DelH-fragments required for the final construct as well as the backbone were assembled in week 5, we tried to assemble the final plasmid pHM01. Therefore, every fragment was digested with two distinct enzymes, and then ligated. The ligated plasmid pHM01 was purified and electroporated in two separate DH10ß aliquots. The screening via colony-PCR was negative, so none of the transformed E.coli received the correct plasmid.

Week 7

In week 7, we reamplified the DelH fragments used for the transformation in week 6. We found that amplification of fragments F1a and F1b was not reproducible. Therefor, we designed new primers for DelH, which will allow to amplify the beginning of DelH in a more efficient and specific manner. The overview summarizes the primers we ordered and their performance in amplificating DelH F1a. Primer DN11 yielded best results and will be used in the next experiments.

Week 8

After improving the amplification of the first subfragment of DelH (fragment 1a with the primer DN11), we used a higher concentration in the ligation assembling the pHM01 plasmid. The transformation of E.coli DH10ß cells was performed with electroporation. Four colonies were positive in the screening-PCR, but did not express lacZ (no blue color). To qualitatively determine DelH expression, we plan to conduct SDS-PAGEs of cell lysate derived from DelH transformed cells. Also, we will induce the transformed bacteria with higher concentrations of arabinose and X-Gal.

Week 9

SDS-PAGE of cell lysate derived from DelH-transformed with subsequent coomassie staining did not yield a band at the expected protein size of ~600 kDa. The result was confirmed on DNA level, as the restriction digest of the DNA prepped from colonies of the transformed cells did not show the expected pattern. To perform a new assembly of plasmid pHM01, the fragments of DelH and the backbone had to be reamplified. The amplifications of the DelH fragments were successful (confirmed by gelelectrophoreses), but the backbone caused difficulties and we were not able to amplify it.

Week 10

After unsuccessful assembly attempts of pHM01, we tried to verify the previously amplified fragments. Two difficulties were encountered: On the one hand, the concentrations of the fragments were too low and could not be detected by gelelectrophoresis; on the other hand, a re-amplification of the fragments with the appropriate primers was not successful. For the DelH 1b fragment, the PCR products of the amplification from genomic DNA were slightly larger than the reamplifications.

Week 11

Based on this week's experiments and in silico analysis of the fragments DelH F1a, F1b and F2, we discarded the restriction digest and ligation strategy for the assembly of the DelH plasmid. Instead, we chose Gibson assembly as an alternative method, developed a strategy and designed primers accordingly.

Week 12

We started amplifying the Gibson fragments using different PCR approaches. Since we were not able to amplify G1 by PCR, we decided to divide G1 into the subfragments G1a and G1b, for which we had already designed and ordered primers. The amplification of fragment G2 worked well and yielded sufficient DNA amounts for subsequent steps. Alternatively, we also produced the entire DelH G0 as one fragment, as well as further subfragments DelH G1/2a, G1b/2 and G2b. Amplification of G1b/2a did not work out. Due to the failure of the restriction digest strategy, we further analyzed the backbone pSB6A1-AraC-lacZ, which we decided to discard. Instead, we choose to use pSB6A1 and BBa_J04450, which is already available in the parts registry.

Week 13

In order to realize the new strategy using the already existing backbone from the parts registry pSB6A1-lacZ-mRFP, we designed two new primers for the backbone amplification and created a map of pHM03. The plasmid for the backbone was obtained from the registry, transformed into E.coli and miniprepped. The Gibson fragment of the backbone was successfully amplified, together with Gibson fragments DelH G0, G1 and G2b.

Week 14

In week 14, we screened numerous colonies from last week's Gibson assembly (28-07) for plasmids containing DelH G0, G1/2a and 2b by screening-PCR. None of the analyzed colonies carried the correct plasmid. We performed another Gibson assembly (01-08) and screened numerous clones. We found few possibly correct ones that will be further analyzed next week. Additionally, the new D. acidovorans strain SPH1, whose sequence is available in GenBank, was ordered. We will amplify all fragments from the genome of D. acidovorans SPH1 as soon as it arrives.

Week 15

We screened colonies from last weeks Gibson assemblies (01-08) for plasmids containing DelH G0 as well as G1/2a and 2b. None of the screening-PCRs yielded the expected DNA bands. Therefore, we amplified the Gibson fragments again and performed further Gibson assemblies. Yet again, we could not detect positive colonies by colony-PCR.

Week 16

We further characterized the DelH plasmid created by Gibson assembly. None of the screened colonies yielded definit positive results. Selection of red colonies was not clear, and PCR screened colonies were all negative. In order to avoid high background during screening of the colonies, we decided to run two different strategies. First, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology (pHM04). In the second strategy (pHM05), we will additionally introduce a tetracycline resistance to select for the insert via antibiotic resistance. In addition to the primers for the new strategies, we designed a new screening primer at the end of DelH.

Week 17

A possible explanation for the failed Gibson assemblies could be a religation of the backbone fragment pSB6A1 allowing E.coli to survive. In this case, transformed bacteria will still express mRFP. This week, our aim is to design a new construct without mRFP (pHM04), by which we will be able to exclude red colonies from the screening. For this strategy, we are going to use a new reverse primer for the backbone still including the terminator of mRFP, but omitting mRFP itself. The primers for the backbone amplification are HM11 & HM17.

Week 18

Since the assembly strategy for pHM04 did not yield positive clones (see experiments week 17), we will follow the idea to introduce a tetracycline resistance to the ampicillin backbone as an additional selection marker for successful assembly. With this approach, positive clones can be easily determined by their white phenotype (exclusion of mRFP) and their ability to grow on plates containing tetracycline. Furthermore, we decided to amplify DelH in various fragments to increase Gibson assembly efficiency. Therefore, we also ordered new screening primers. The primers were designed as shown in the following table.

Week 19

After successful electroporation, we screened numerous clones by colony-PCR and test restriction digest (PvuI-HF). Midiprepped DNA dervied from clones positive for both methods were sent for sequencing. By sequencing of the transition sequence from the end of the pSB6A1 backbone without mRFP (pHM04) to the beginning of DelH, the assembly success of the Gibson assembly can be determined (Primer: reverse DN07 primer or VF2).Sequencing results showed truncating mutation at the beginning of DelH (in the primer region) for all clones.

Week 20

As in week 19, the screening-PCRs showed colonies positive for the DelH contatining plasmid, whereas the restriction digest reveiled many of the screening results to be false positive. The remaining miniprepped colonies were sent in for sequencing. Sequencing results showed again truncating mutation at the beginning of DelH (in the primer region) for all clones.

Week 21

None of the analyzed clones showed a correct sequence, which lead as to the assumptions following assumptions. First, we suspect DelH to be toxic for E.coli, thus only clones carrying the mutant DelH-plasmid survive. Second, we consider the low quality of the gibson primers as a possible explanation for the high number of mutations in the assemblies. To circumwent the latter problem, we will order HPLC purified primers. Additionally, we tried to eliminate the mutations in DelH clones I 6b and 15 by mutagenesis. Herefore, primers were ordered.

Week 22

So far, we failed to obtain a single correct DelH clone. We suspect the DelH module to be toxic for E. coli when transformed without the other parts of the Del cluster, thus DelH-transformed cells would select for mutated plasmids. In order to reduce the selection pressure, we used E. coli BL21 DE3, known for increased expression of the lac repressor. This strategy also did not result in any correct clone. One reason might be, that the E. coli BL21 DE3 strain we obtained was actually a BL21 DE3 pLys strain, which itself is already Chloramphenicol resistant, thus not useful for screening and amplification of the DelH construct coded for on a chloramphenicol vector. We obtained the correct E. coli BL21 DE3 strain as well as NEB E. coli turbo cells, which significantly overexpress the lac repressor. We found the lacZ-controlled expression of the latter to be very leaky when compared to E. coli BL21 DE3. Since the Gibson assembly of DelH using the HPLC purified primers also exclusively resulted in mutated clones, we developed two new cloning strategies to avoid expression of DelH. The first strategy uses a weak promoter and ribosomal binding site, the second introduces DelH in a ccdB helper construct. Lastly, we continued working on the mutagenesis approach to eliminate the mutation in clone C5. It was sent for sequencing...

Week 23

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Browse gallery

Methods:

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .

Overview
Lab book

Schematic representation of DelH cluster and structure of delftibactin.

Restriction Digest and Ligation Strategy

PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
Transformation of E. coli TOP10 with DelH plasmid
Characterization of positive (blue) colonies by colony PCR

Vector Maps, Primers and BioBricks

Vector map of the pHM01:DelH plasmid.

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin
pSB1AK3	I732019	Spring 2012	4	12G	lacZ reporter gene	Kanamycin, Ampicillin
pSB2K3	I0500	Spring 2012	1	14N	AraC promoter	Kanamycin
pSB6A1	J04450	Spring 2012	1	1K	Backbone for DelH	Ampicillin
pSB1C3	J04450	Spring 2012	1	3A	Backbone for Indigoidine	Chloramphenicol

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting SalI	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Part of the registry	Plate of 2012	Well	Resistance
pSB4K5 (insert=J04450)	1	5G	Kanamycin
pSB6A1 (insert=J04450)	1	1K	Ampicillin
lacZ (I732019) in pSB1AK3	4	12G	Kanamycin, Ampicillin
AraC (I0500) in pSB2K3	1	14N	Kanamycin
pSB1C3 (insert=J04450)	1	3A	Chloramphenicol

Added 10 µl H₂O to each well
Incubated for 10 min at RT
Thawed 5x chemical competent E.coli Top10
3 µl of plasmid DNA were added
Incubated for 10 min on ice
Heat shock for 40 s at 42.2°C
Incubated for 10 min on ice
Added 500 µl LB Medium
Incubated at 37°C for 40 min
Centrifuged 120 at 5,000 rpm, supernatant discarded
Pellet resuspended in remaining medium
Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
Incubated for 2 days at RT
One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above

Result

All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.

Amplification of DelH Fragments

Design of Primers

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Overview
Lab book

BioBricks

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB1A3	I13453	Spring 2012	1	1F	AraC promoter	Ampicillin
pSB1A3	K206000	Spring 2012	4	8G	AraC promoter	Ampicillin

06-05 - 12-05-13

Amplification of BioBricks

Miniprep of BioBricks

Miniprep was performed using Qiagen kit and eluted in 35 µl ddH₂O.
From 500 µl of liquid culture, a glycerol stock was prepared as described in Preparing glycerol stocks.

Result

DNA concentration was determined using nanovue.

Sample	Concentration [ng/µl]
pSB4K5	21
pSB6A1	47
lacZ	45
pSB1C3	23

Generation of Plasmid Backbones

Restriction Digest of BioBrick pSB6A1

Component	Amount [µl]
PSB6A1 DNA	32.5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	4.5

Result

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified DelH fragment 1 , l6-7:amplified DelH fragment 2,l8:2log, l9: P3 (pSB1C3)

The fragments of plasmids pSB4K5 and pSB1C3 show the expected pattern.

=> BioBrick backbone was cut and gel isolated.

Generation of LacZ Fragment

Restriction Digest of BioBrick pSB1AK3 Conditions A

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB3 buffer (10x)	5
Enzymes (XbaI and PstI)	1.5 each
ddH₂O	4.5

Incubation for 1 h at 37°C

Result

The restriction mix was loaded onto a 1% agarose gel using 6 µl gene ruler marker.

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified F1 for Backbone (pSB6A1), l6-7:amplified fragment 2 for Backbone (lacZ),l8:2log, l9: P3 (pSB13)

The fragments show the expected pattern.

=> LacZ insert were cut and gel isolated.

Restriction Digest of BioBrick K173004(lacZ) Conditions B

Component	Amount [µl]
pSB1AK3 DNA	8.3
BSA (10x)	5
NEB4 buffer (10x)	5
Enzymes (XbaI & SalI-HF)	1.5 each
ddH₂O	28.7

Purification was performed with Qiagen Nucleotide removal Kit and eluted in 38.5 µl ddH₂O

Result

2.5 µl were measured with the Nanovue. The measurement proved the failure of miniprep.

Restriction Digest of BioBrick K173004(lacZ) Conditions C

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB 3 buffer (10x)	5
Enzyme (PstI)	1.5
ddH₂O	-

Result

Fig.2.2 Gel of cut lacZ (loaded 20 µL)
, l1-2: lacz & pSB1AT,l3:2log ladder
=> lacZ was cut out

=>The band was too high on gel and discarded, because we cannot be sure if it really is lacZ or the backbone of the lacZ plasmid.

Generation of AraC Fragment

Amplification of BioBricks containing I13453 and K206000

The transformation was performed as described on 03-05 and incubated ON at 37°.

Amplification of DelH F1

PCR Conditions F1.W2.A

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1
	62	5
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 10 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l1:2log ladder, l5-6:DelH-F2
no specific band at 10 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.B

Reagent	DelH-fragment1	DelH-fragment1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.4 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2:DelH-F1 amplified from DNA, l3:DelH-F1 amplified from cells
no specific band at 10 Kb

PCRs showed only unspecific bands.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.C

Reagent	DelH F1	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10	10
Template	1 µl D. acidovorans normal	1 µl D. acidovorans normal	1 µl D. acidovorans 1:25	1 µl D. acidovorans 1:25
DelH_f1_PacI_fw	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
DelH_f1_SalI_rev	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
DMSO	-	-	2.5 µl	2.5 µl
ddH₂O	23 µl	23 µl	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.5 Gel of DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2-9: F1 with different conditions => l9 shows the best match

PCR with DMSO and 1:10 diluted primer looked best.

=> Gel extraction performed.

Amplification of DelH F2

PCR Conditions F2.W2.A

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1 s
	62	5 s
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 8 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l4:2log ladder, l5-6:DelH-F2
no specific band at 8 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F2.W2.B

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
30	72	2:45 min
1	72	5 min
1	4	inf

Results

Expected band: 8 Kb

Fig.2.6 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:DelH-F1 amplified from DNA, l2:DelH-F1 amplified from cells, l3:2log ladder
no specific band at 8 Kb

Gel shows the expected specific band at 8 Kb.

=> DelH F2 was thus successfully amplified from the glycerol stock.

Overview
Lab book

Schematic representation of DelH cluster and structure of delftibactin.