Team:ETH Zurich/Experiments

From 2013.igem.org

(Difference between revisions)
Line 55: Line 55:
<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg
<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg
<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg
<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg
 +
<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.
<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.
</td>
</td>
Line 68: Line 69:
<tr>
<tr>
-
<td>3</td>
+
<td>4</td>
<td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td>
<td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td>
-
<td>BBa_J09855-BBa_E0840 construct with the pLac promoter replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction site. <br> </td>
+
<td>BBa_J09855-BBa_E0840 construct with the pLac promoter replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.
-
<td>[[File:Pla4.png|225px]]<br>[[File:Pla5.png|225px]]</td>
+
<br>Oligos:
 +
<br>5’- Ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
 +
<br>5’- gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
 +
<br>5’- AATCTCTAGTATTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTCT
 +
<br>5’- AGCTTTAATTTTATTAATTATTCTGTATGTGTCGTCGGCATTTATGTTTTTCATCTAGTATTTCTCCTCTTT
 +
</td>
 +
<td>[[File:Pla6.png|300px]]</td>
</tr>
</tr>
 +
 +
<tr>
 +
<td>5</td>
 +
<td>Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell</td>
 +
<td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from [http://parts.igem.org/Part:BBa_J23118 BBa_J23118]</td>
 +
<td>[[File:Pla7.png|225px]]</td>
 +
</tr>
 +
</table>
</table>

Revision as of 10:36, 4 October 2013

Header2.png
80px-Eth igem logo.png

Contents

Final Circuit

For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the OHHL signal. PhoA is expressed constitutively as well as reporter for safe cells. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.



Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.



Cloned Constructs

To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.

Fluorescent protein reporter constructs
Description Cloning Maps
1 Receiver cell construct for GFP diffusion experiments [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI) 300px][File:Pla2.png
2 Library of the Receiver cell constructs Using the BBa_J09855-E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities

Primers used:

5'-tatactagagacnnntaggatcgtacag
5'-gatcgtannngtttacgcaagaaaatg
5'-tagagacnnntaggatcgtannngtttacgcaagaaaatg
5'-tagagaccnntaggatcgtanangtttacgcaagaaaatg
5'-tagagacctntaggatcgtacangtttacgcaagaaaatg


Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.

Pla3.png
3 Receiver cell construct for GFP experiments without the LuxR generating part [http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI) Pla4.png
Pla5.png
4 Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness BBa_J09855-BBa_E0840 construct with the pLac promoter replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.


Oligos:
5’- Ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
5’- gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
5’- AATCTCTAGTATTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTCT
5’- AGCTTTAATTTTATTAATTATTCTGTATGTGTCGTCGGCATTTATGTTTTTCATCTAGTATTTCTCCTCTTT

Pla6.png
5 Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from [http://parts.igem.org/Part:BBa_J23118 BBa_J23118] Pla7.png



LuxI generating constructs
Description Cloning Maps
4 Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Map4b.png
Map4a.png
5 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23118 BBa_J23118] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Map4b.png
Map4a.png
Map5c.png
6 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23110 BBa_J23110] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Map4b.png
Map4a.png
Map5c.png
7 Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments [http://parts.igem.org/Part:BBa_J23114 BBa_J23114] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI) Map4b.png
Map4a.png


LuxR generating constructs
Description Cloning Maps
8 constitutive LuxR generating biobrick [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] Map8.png
9 constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations [http://parts.igem.org/Part:BBa_F2621 BBa_F2621] Map9.png
10 constitutive LuxR generating construct, repressible through LacI [http://parts.igem.org/Part:BBa_R0010 BBa_R0010] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_I0462 BBa_I0462] insert (XbaI, PstI) Map10.png
11 constitutive LuxR generating construct, with negative feedback-loop at high OHHL concentrations [http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_I0462 BBa_I0462] insert (XbaI, PstI) Map11.png
12 auto-inducible LuxR generating construct with positive feedback loop [http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_I0462 BBa_I0462] insert (XbaI, PstI) Map12.png
13 negatively regulated pLuxL-LacI construct to improve leakiness of LuxR system [http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert (SpeI,PstI) Map13.png



pLux constructs
Description Cloning Maps


Hydrolase constructs
Description Cloning Maps
Aes coding region with RBS in SB1C3 backbone BBa_K1216002




Groupparts / Biobricks

In the following table you can find all all the biobricks that were submitted by our group.


<groupparts>iGEM013 ETH_Zurich</groupparts>