Team:Heidelberg/Delftibactin/DelH

From 2013.igem.org

Revision as of 19:59, 1 October 2013 by Nils.kurzawa (Talk | contribs)

Del H. This bitchy 18 kbp fragment.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Methods:

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Part of the registry Plate of 2012 Well Resistance
pSB4K5 (insert=J04450) 1 5G Kanamycin
pSB6A1 (insert=J04450) 1 1K Ampicillin
lacZ (I732019) in pSB1AK3 4 12G Kanamycin, Ampicillin
AraC (I0500) in pSB2K3 1 14N Kanamycin
pSB1C3 (insert=J04450) 1 3A Chloramphenicol
  • Added 10 µl H2O to each well
  • Incubated for 10 min at RT
  • Thawed 5x chemical competent E.coli Top10
  • 3 µl of plasmid DNA were added
  • Incubated for 10 min on ice
  • Heat shock for 40 s at 42.2°C
  • Incubated for 10 min on ice
  • Added 500 µl LB Medium
  • Incubated at 37°C for 40 min
  • Centrifuged 120 at 5,000 rpm, supernatant discarded
  • Pellet resuspended in remaining medium
  • Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
  • Incubated for 2 days at RT
  • One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above

Result

All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.

Amplification of DelH Fragments

Design of Primers

Identifier Order date Note Sequence
DN01:DelH_f1_PacI_fw 03-05-2013 Amplification of DelH F1, with RBS and adding PacI restriction site TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev 03-05-2013 Amplification of DelH F1 until SalI restriction site TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw 03-05-2013 Amplification of DelH F2 starting at SalI restriction site TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev 03-05-2013 Amplification of DelH F2, adding KpnII restriction site TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG


Amplification of 1

13-05 - 19-05-13

Amplification of DelH F1

Gel Purification

45 µl of DelH F1 PCR (08-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH2O.

Result

Sample Concentration [ng/µl]
DelH F1 7
=> Because the concentration is so low, a re-PCR of the PCR product (08-05) is going to be done.


re-PCR Conditions F1.W3.A

Reagent DelH F1
Expected length [Kb] 10
Template 1 µl 1:10 gel purified F1
Primer 10 µM fw 0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev 0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x) 25 µl
DMSO 2.5 µl
ddH2O 20.5 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1
66 5
72 3:30 min
72 3:30 min
1 4 inf

Result

Expected length: 10 Kb

Fig.3.1 PCR of DelH fragment 1 (loaded 20 µL)
l1:fragment 1 of DelH, l2: 2log ladder

Different unspecific bands were observed.

=> Test digest to confirm identity.


Test Restriction Digest

PCR product of DelH-F1 BSA NEBuffer 4 Enzymes ddH2O Total amount
18 µl 5 µl 5 µl 2x 1.5 µl SalI-HF & PacI 19 µl 50 µl


Afterwards, purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F1.


PCR Conditions F1.W3.B

Reagent DelH F1 DelH F1 DelH F1
Expected length [Kb] 10 10 10
Template Picked colony Picked colony Picked colony
Primer 10 µM fw 0.5 µl DelH_f1_PacI_fw 0.5 µl DelH_f1_PacI_fw 0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev 0.5 µl DelH_f1_SalI_rev 0.5 µl DelH_f1_SalI_rev 0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x) 25 µl 25 µl 25 µl
DMSO 1.5 µl 2.5 µl 5 µl
ddH2O 21.5 µl 20.5 µl 18 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1 s
66 5 s
72 3:30 min
1 72 3:30 min
1 4 inf

Result

Expected length: 10 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2-4: fragment 1 of DelH, l5: fragment 2 of DelH

There is only an unspecific band at the second PCR of F1 with 2.5 µl DMSO.

=> Repeat using DMSO and altered PCR program.


PCR Conditions F1.W3.C

Reagent DelH F1 DelH F1
Expected length [Kb] 10 10
Template 1 µl glycerol stock 1 µl glycerol stock
Primer 10 µM fw 0.5 µl DelH_f1_PacI_fw 0.5 µl DelH_f1_PacI_fw
Primer 10 µM rev 0.5 µl DelH_f1_SalI_rev 0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x) 25 µl 25 µl
DMSO 2.5 µl 2.5 µl
ddH2O 20.5 µl 20.5 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1 s
66 5 s
72 3:30 min
1 72 3:30 min
1 4 inf

Result

Expected length: 10 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH, l4: fragment 1 of DelH, l5: fragment 2 of DelH

There was no band visible.

=> Repeat using DMSO and altered PCR program.


Amplification of DelH F2

Gel Purification

45 µl of DelH F1 PCR (07-05) product were run on a 0,8% agarose gel (1 h with 135V). Gel extraction was performed using gel extraction kit of Qiagen, and diluted in 25 µl ddH2O.

Result

Sample Concentration [ng/µl]
DelH F2 6
=> Because the concentration is so low, a re-PCR of the PCR product (07-05) is going to be done.


Re-PCR Conditions F2.W3.A

Reagent DelH-fragment2
Expected length [Kb] 8
Template 1 µl 1:10 gel purified F2
Primer 10 µM fw 0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev 0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x) 25 µl
DMSO 2.5 µl
ddH2O 20.5 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1 s
66 5 s
72 3:30 min
72 3:30 min
1 4 inf

Result

Expected length: 8 Kb

Fig.3.4 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 2 of DelH

Specific band was observed.

=> Test digest to confirm identity.


Test Restriction Digest

PCR product of DelH-F1 BSA NEBuffer 4 Enzymes ddH2O Total amount
18 µl 5 µl 5 µl 2x 1.5 µl SalI-HF & KpnI-HF 19 µl 50 µl


Afterwards, a purification with the nucleotide removal kit was performed, but due to using wrong column, there was no product left.

=> Repeat amplification of DelH F2.


PCR Conditions F2.W3.B

Reagent DelH F2
Expected length [Kb] 8
Template Picked colony
Primer 10 µM fw 0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev 0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x) 25 µl
DMSO 0 µl
ddH2O 23 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1
66 5
72 2:45 min
1 72 2:45 min
1 4 inf

Result

Expected length: 8 Kb

Fig.3.2 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There is no band visible.

=> Repeat using altered PCR program.


PCR Conditions F2.W3.B

Reagent DelH F2
Expected length [Kb] 8
Template 1 µl glycerol stock
Primer 10 µM fw 0.5 µl DelH_f2_SalI_fw
Primer 10 µM rev 0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x) 25 µl
DMSO 0 µl
ddH2O 23 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1
66 5
72 2:45 min
1 72 2:45 min
1 4 inf

Result

Expected length: 8 Kb

Fig.3.3 PCR of DelH fragment 1 (loaded 20 µL)
l1:2log ladder, l2: fragment 1 of DelH, l3: fragment 2 of DelH

There was a specific band at 8 Kb

=> Fragment was cut and gel extracted.


Generation of Backbone pSB6A1-AraC-lacZ

Miniprep of Amplified Parts

DH10ß containing I13453 and K20600 (for AraC) and backbone pSB1AK3 (lacZ) were grown ON at 37°C and minipreped.

Result

Sample Concentration [ng/µl]
lacZ 42.5
AraC (5) 26.5
AraC (6) 34.5

Restriction Digest

  • AraC was cut with EcoRI-HF and SpeI buffered in NEB4
  • LacZ was cut with XbaI and PstI buffered in NEB3
Reagent Amount [µl]
DNA 22.5
Enzymes 1.5 each
Buffer (10x) 5
BSA (10x) 5
ddH2O 14.5
  • Incubated for 1h at 37°C
  • Purified with Qiagen Kit and diluted in 20 µl ddH2O

Result

Sample Concentration [ng/µl]
lacZ 33.5
AraC (5) 19.5
AraC (6) 25.5


Ligation of pSB6A1, AraC and lacZ

Reagent Amount [µl]
pSB6A1 1.5
lacZ 4
AraC 3
Ligase 1.5
Buffer 2
ddH2O 8.5
  • Incubated at RT for 45 min
  • Chemical transformation of competent DH10ß
  • Streaked on LB Amp plates
  • Incubation ON at 37°C


Miniprep of pSB6A1-AraC-lacZ

  • One colony each was picked and grown in 2 ml LB Amp ON
  • Cultures were minipreped.

Result

Sample Concentration [ng/µl]
pSB6A1-AraC-lacZ (5) 57
pSB6A1-AraC-lacZ (6) 73


Restriction Digest of Backbone pSB6A1-AraC-lacZ

  • AraC-lacZ was cut from pSB6A1-AraC-lacZ using PstI & EcoRI-HF
Reagent Amount [µl]
Miniprep DNA 10
Enzymes 1.5 each
Buffer NEB 2(10x) 5
BSA (10x) 5
ddH2O 27
  • Incubated for 1 h at 37°C
  • Purified with Qiagen kit and diluted in 20 µl ddH2O

Result

Sample Concentration [ng/µl]
pSB6A1-AraC-lacZ (5) D+P 18
pSB6A1-AraC-lacZ (6) D+P 26


Ligation of AraC-lacZ with pSB1C3

Reagent Amount [µl]
DNA of pSB1C3 10
DNA of AraC-lacZ (6) 5
Ligase 1
Buffer 2
ddH2O 2
  • Incubated at RT for 50 min
  • Heat inactivation at 70°C for 5 min
  • 10 µl were used for a chemical transformation in TOP10 and plated on LB Chlor
  • Incubation ON at 37°C


Conlony-PCR Conditions BB.W3.A

Reagent psB1C3-AraC-lacZ (5)
Expected length [Kb] ?
Template Picked colony of psB1C3-AraC-lacZ (5)
Primer 10 µM fw 0.5 µl
Primer 10 µM rev 0.5 µl
Phusion Master Mix (2x) 25 µl
DMSO -
ddH2O 24 µl
Cycles Temperature [°C] Time [s]
1 98 10
30 98 1
66 5
72 1:30 min
1 72 1:30 min
1 4 inf

Result

Expected length:

Fig.3.5 PCR of BB psB1C3-AraC-lacZ(loaded 20 µL)
l1:2log ladder, l2: psB1C3-AraC-lacZ
no yield

There was no fragments visible.

=> Is picked coloniy negative or did entire ligation not work out?


Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Amplification of 1

Something completely different

test

Retrieved from "http://2013.igem.org/Team:Heidelberg/Delftibactin/DelH"