From 2013.igem.org

Revision as of 12:13, 4 October 2013 by Nils.kurzawa (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Del Rest. Creating a 32 kb plasmid.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Week 10

This week the project "DelRest" was launched, which aims at creating a single, 32 kb plasmid enabling the expression of most genes from the D. Acidovorans Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we decided to use Gibson cloning. ???This weeks goal was amplify the pSB4K5 backbone from the partsregistry with primers giving the intended overlaps as well as the desired genes from our host organism D. Acidovorans .??? Therefore, Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a Gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed cloning strategy and primer design.

Week 11

During the past week we managed to amplify a fragment of 11 kbp encoding the genes DelA-F from genomic DNA of D. Acidovorans. We were further able to amplify the backbone fragment from pSB4K5 carrying the desired overlaps to the corresponding fragments to be amplified from the Del cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. Unfortunately, the amplification of DelF-G and DelO-P turned out to be more difficult than expected. Since our initial plan, which required the amplification of DelO-P using a Gibson primer which introduces an overlap to DelL and furthermore introduces an artificial ribosom binding site did not work out, we changed our strategy. We orderd shorter versions of all our Gibson primers. Using these shorter primers not bearing any overlaps to other fragments, we will try to amplify the desired genes in order to obtain a specific template for the reamplification with the primers carrying the needed overlaps. Furthermore, we will optimize the PCR conditions for the amplification of the DelF-G fragment.

Week 12

By the end of last week we found out, that the short primers we had ordered did not improve amplification of the missing fragments from D. Acidovorans. Additionly, further analysis of the Delftibactin cluster, led to the discovery of a predicted promoter present in front of DelO-P potentially essential for DelO-P expression. Therefore, we not only decided to design new primers for the amplyfication of DelF-G, but also modifie the entire strategy concerning the DelO-P fragment. To ensure the expression of DelO-P in our target organism E.coli we decided to amplify DelO-P together with its putative promoter. In consequence, we ordered new primers for DelO-P and also for the last DelA-G fragment in order to introduce the required new overhang to the new DelO-P fragment. The correlating primers can be found in our new vector map.

Week 13

In the previous week, several of the newly ordered primer pairs improved our PCRs for DelO-P and DelF-G. However, results were not convincing enough to use these amplicons for Gibson assembly. Therefore, we spend this week optimizing the PCRs for the abovementioned fragments. In addition we validated the amplicon of DelG with restriction digest. Validation of the other PCR products did not succeed, mostly due to very low amount of DNA. ???already successfully obtained last week by restriction digest.???

Week 14

We were still struggeling with getting the correct amplicons for the fragments encoding DelF-G as well as DelO-P. Furthermore, the restriction digests of the already successfully amplified fragments needed to be repeated using higher amounts of DNA, as results of the previous test digests were rather inconclusive. Furthermore, samples of these fragments were send for sequencing.

Week 15

Single read sequencing of the PCR amplified fragments DelA-E, DelL as well as the backbone pSB4K5 was carried out by GATC. We blasted the obtained seqeuences against the reference sequence based on the D. acidovorans SPH-1 strain available on NCBI. Although our sequence matched to the reference sequence, we found a significant number of missmatches, which was too diverse and high to be simply explained by random mutations introduced by our polymerase during PCR (note: we used a high-fidelity proofreading polymerase suitable for GC-rich templates and long amplicons). We thus hypothesized that the SPH-1 strain based on which our cloning strategy was designed might have a significant number of single-nucleotide polymorphisms in the Del cluster compared to the D. acidovorans DSM-39 strain, which we used as template for all PCRs (note: there is no complete genomic sequence available for the DSM-39 strain on NCBI). We further hypothesized, that this difference in sequence between the DSM-39 strain used as PCR template and the SPH-1 strain based on which our primers were designed could explain our troubles with the PCR amplifications of DelF-G and DelO-P. In consequence, we ordered the SPH-1 strain from the DSMZ in order to obtain a suitable template for our PCRs. This solved all our PCR problems right away and we were able to get all amplicons required for cloning the DelRest construct within this week. Furthermore, we successfully validated our amplicons by restriction digest and sequencing.

Week 16

Last week we successfully amplified all the fragments needed to complete the DelRest cloning. Therefore, we went ahaed and performed Gibson assembly in order to assembel the final pFSN plasmid carrying bearing the DelRest genes. The assembly mix was transformed into E. coli DH10beta electrocompetent cells. Screening PCRs showed that the assembly was successful, calling for futher validation of the clones.

Week 17

From colonies which were positive for screening last week, we rescued 3 plasmids. Test restriction digest were conducted and showed our clones to be correct.

Week 18

We send one of our DelRest constructs that showed the right restriction pattern in the test digest for sequencing. As it would be quite costly to sequence the whole 32 kb plasmid, we focused on the ligation sites between the different assembly fragments, which are most prone to insertion of errors. Although all insert fragments sequenced, including the ligation sites between DelA and DelF, DelO-P and DelL, were 100 % correct, wee detected a mutation within the mRFP cds (note: we wanted to use mRFP in order to confirm expression from our DelRest plasmid). FACS analysis of E. coli bearing the DelRest construnct confirmed that mRFP expression was impaired, likely due to the corresponding mutation. However, as mRFP was only meant to be a general expression control on our construct, we did not start correcting out construct by mutagenesis. Instead, we started preparing samples for an SDS page in order to directly proof the expression of the Del genes by Coomassie staining.

Week 19

As the Coomassie staining we carried out last week did not display all expected bands clearly, likely the low amount of protein loaded onto the corresponding SDS page, the SDS page was repeated. ???? Was the SDS Gel repeated ???? As we could confirm the sccessful cloning and functioning of the DelRest expression plasmid named pFSN (for Florian-Sophie-Nils :)) the DelRest subproject was succssfully completed and the personal resources of the DelRest group were shifted to the DelH group.

Methods:

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_16 used for assembly of the desired genes from D. acidovorans genome and the partsregistry backbone pSB4K5 .

In order to transfer the delftibactin NRPS cluster from D. acidovorans in E. coli for efficient production of delftibactin, we designed the plasmid pFSN. It comprises the above listed genes as inserts. Furthermore, it includes an IPTG-inducible promoter, an origin of replication, compatible to those of the plasmids pDelH and pIK8.6 (required for delftibactin expression in E. coli) expression plasmids as well as a kanamycin resistance marker. The choice of the ori was critical, as three plasmids PFSN, pDelH and PIK8.6 would have to be cotransformed in order to obtain the final E. coli delftibactin production strain and all three plasmids needed to be stabely propagated.
Additionally, mRFP was added as last cds behind the DelRest genes onto the pFSN construct in oder to have an easy control for expression of the DelRest genes located in front of mRFP.

In the Delftibactin cluster the genes DelA, DelB, DelC, DelD, DelE, DelF and DelG are encoded as a single polycistronic operon. However, it is most likely not possible to amplify the entire coding sequence of DelA to DelG in one single PCR amplicon, as its corresponding size of 22.8 kb in combination with the complex GC-rich sequence is most likely not suitable for commonly available polymerases and PCR protocols. Consequently, we will use various primer combinations to amplify the genes in different sub-fragments. These will be assemled again using Gibson cloning

DelO and DelP are encoded in reverse-complementary direction on the Delftibactin cluster. However, in our construct these two genes will be assembled in the same orientation as the other ones and thereby added to the DelA-G operon. As DelO and DelP are also located next to each other and they will therefor be amplified together as a single 2.7 kb amplicon

DelL is the somehow lonesome rider, not surrounded by any of our desired del genes and will thus also be amplified seperately (fragment size 1.4 kb).
As complications are most likely to occure for the very long PCR amplicons, we will start with the huge DelA-G region and optimize PCR conditions for the corresponding amplicons.

We decided to use the DSM-39 substrain of Delftia acidovorans as our genomic template since our reference paper from Johnston et al. (2013) showed the gold precipitation expreiments using this substrain. The only full-length genomic sequence available for D. acidovorans is, however, the SPH-1 substrain sequence. Nevertheless, as the abovementioned paper also based their analysis on the SPH-1 strain sequence, we also based our primer designs on the available SPH-1 substrain genomic sequence, hoping the Del cluster sequence would be highly conserved among different D. acidovorans strains.

Plasmid backbone part from the partsregistry

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_01: pSB4K5_DelA_rv	20-13-06-28	Amplification of pSB4K5 from the iGEM Distribution. Gibson Primer with overhang to DelA introducing the RBS BBa_B0035	TCGCGGCGATCCGGTACTGCGCCTCTGTTGAACATCTGATATTCT CCTCTTTAATCGACAGATTGTGTGAAATTGTTATCCGCTCAC
FS_02: DelAG_1_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTCAACAGAGGCGCAGTACCGGATC
FS_03: DelAG_1_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTCGGAGACGATGTGGTGCATCAC
FS_04: DelAG_2_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CTGCAGGCCAATGAGCACATCCTG
FS_05: DelAG_2_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CACAGGTGGTAGATGGCGTC
FS_06: DelAG_3_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	ATTGCGAGGACTTGCTCGATG
FS_07: DelAG_3_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTTGCTGCAGCGCCAGCACATCGAG
FS_08: DelAG_4_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTACGGCCTATCACATCAGCG
FS_09: DelAG_4_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAAGCTCAGCAGGTTGGGCGAGACG
FS_10: DelAG_5_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAATTTTGTTCCACCACCTGCTG
FS_11: DelAG_5_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome. Gibson Primer with overhang to DelOP	CTTGAGCAGGCGCAGTACCTCGGAGGGCGGTCGGCTGGCGTTTTCCATGATTCAGG TTTCCTGTGTGAAGCTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_11: DelAG_5_short_rv	2013-08-02	Amplification of DelA-G from Delftia acidovorans genome.	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_12: DelOP_fw	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome.	GAATCATGGAAAACGCCAGCCGAC
FS_13: DelOP_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	CAATGTTGGAGGGGCCGAAGCCGATGCCGATCAGCGGGTGGGTTTGCATGGAAGGT CCTTTCATTGGGTCGATGCGTCCAGTGTCACACCGTGGTGTCTGCAGGCG
FS_13: DelOP_short_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_14: DelL_fw	2013-06-28	Amplification of DelL from Delftia acidovorans genome.	CAAACCCACCCGCTGATCGGCATC
FS_15: DelL_mRFP_pSB4K5_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	GAAACGCATGAACTCTTTGATAACGTCTTCGGAGGAAGCCATCTAGTATTTCTCCTC TTTCTCTAGTATCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_16: mRFP_pSB4K5_fw (Del)	2013-06-28	Amplification of pSB4K5 from iGEM Distribution. Gibson Primer	GCTTCCTCCGAAGACGTTATC

Amplification of Del Genes from DSM-39 genome

Goals

This week primers FS_01 to FS_16 arrived. As the aim of this week is to amplify the backbone pSB4K5 with Gibson overlaps matching our initial and very last insert fragment, we will firstly use the pSB4K5 backbone including the mRFP cassette as template for this purpose. Furthermore amplification of the desired genes from the Del-cluster of D.acidovorans DSM-39 will be carried out in parallel.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-F	FS_02 and FS_05
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
	DelG	FS_08 and FS_11
DelO DelP DelL	DelO-P	FS_12 and FS_13
DelO DelP DelL	DelL	FS_14 and FS_15
pSB4K5	pSB4K5	FS_01 and FS_16

06-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

PCR for amplification of del fragments E-G and A-E, AE+=PCR AE with DMSO, AE-=PCR without DMSO, M= Marker; wanted amplicon sizes are: AE=5.3kb, EG=11.0

Reaction

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	1
FS_03: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

PCR for amplification of del fragments AE and EG, cut

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30 min
18	98	1
	63	5
	72	2:30 min
1	72	10 min
1	4	inf

Results:

Amplification worked with 5% DMSO
Repeat Amplification with the same protocol to increase concentration when DNA is extracted from gel slices

03-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelA-F and DelF-G, 03-07-13; run at 130 V, 0.8 % gel (TAE)

Gel after removing the DelA-F-fragment, 03-07-13.

Reaction

µL 1st PCR	what	µL 2nd PCR
1	D. acidovorans DSM-39	1
2.5	FS_02 (1/10)	2.5
2.5	FS_05 (1/10)	2.5
25	Phusion Master Mix	25
-	DMSO	2.5
19	dd H₂O	19

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAE worked

bands were cut out and DNA purified using QIAquick Gel Extraction Kit

sample has to be purified before further use since contamination with propanol was present

04-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

Gel electrophoresis of the PCR products of DelA-F (first three lane (counted from left)) and DelF-G (4th till 6th lane), 04-07-2013

Gel after removing DelA-F-fragment, 04-07-2013

Reaction

what	µL 2nd PCR
D. acidovorans DSM-39	1
FS_02 (1/10)	2.5
FS_05 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAE worked

bands were cut out and DNA purified using QIAquick Gel Extraction Kit resulting in a final concentratio of 10ng/µL

PCR will be repeated and gel slices purified with QIAX II Gel Extraction Kit, which is specifically designed to deliver higher yields when purifying fragments with sizes over 10 kbp

05-08-2013

Amplification from FS_02 to FS_07; 16.4 kb

Gel electrophoresis of DelA-G

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
6	98	1
	66 ↓ 0.5	5
	72	5min 40s
24	98	1
	60	5
	72	5min 40s
1	72	17 min
1	4	inf

Results:

amplification of DelAG did not work
repeat PCR with higher annealing temperature to increase specifity

06-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

PCR for amplification of del fragments E-G and A-E, AE+=PCR AE with DMSO, AE-=PCR without DMSO, M= Marker; wanted amplicon sizes are: AE=5.3kbp, EG=11.0

PCR for amplification of del fragments AE and EG, cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelEG worked but another unexpected product was amplified as well

band was cut out avoiding contamination with other product and DNA purified using QIAquick Gel Extraction Kit

03-07-2013

Amplification from FS_06 to FS_09; 8.5 kb

Amplification of DelA-F and DelF-G run at 130 V, 0.8 % gel (TAE)

Gel after removing the DelA-F-fragment.

Reaction

µl 1st PCR	what	µl 2nd PCR
1	D. acidovorans DSM-39	1
2.5	FS_06 (1/10)	2.5
2.5	FS_09 (1/10)	2.5
25	Phusion Master Mix	25
-	DMSO	2.5
19	dd H₂O	19

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	2:30 min
1	72	10 min
1	4	inf

Results:

Amplification of DelFG did not work
PCR will be repeated with a lower annealing temperature of 68°C (touchdown)

Amplification from FS_06 to FS_09; 8.5 kb

Gel electrophoresis of the PCR products of DelA-F (first three lane (counted from left)) and DelF-G (4th till 6th lane)

Gel after removing DelA-F-fragment

Reaction

what	µl 2nd PCR
D. acidovorans DSM-39	1
FS_06 (1/10)	2.5
FS_09 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelFG did not work, many different side product occured, PCR will be repeated with other primers

Amplification from FS_06 to FS_11; 11.6 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_11: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

05-07-2013

Amplification from FS_06 to FS_07; 5.2 kb

Reaction

Gel electrophoresis of DelF-G, Backbone, DelF-G (5.1 kb), DelG (6.4 kb).

after Gel excision

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
14	98	1
	62 ↓ 0.5	5
	72	3:20 min
16	98	1
	60	5
	72	3:20 min
1	72	12 min
1	4	inf

05-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

Gel electrophoresis of DelF-G, Backbone, DelF-G (5.1 kb), DelG (6.4 kb).

after Gel excision

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	1
FS_11: (1/10)	1
Phusion Master Mix	10
dd H₂O	6
DMSO	1

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
14	98	1
	62 ↓ 0.5	5
	72	3:20 min
16	98	1
	60	5
	72	3:20 min
1	72	12 min
1	4	inf

Results:

A weak band was visible, but it was on the wrong height.
Accidently the band was cut anyway.
Either the primers did not bind or the DNA still had to many secondary structures --> the consequence is to change the annealing temperature.

07-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07); lane1=Marker, lanes2-4=DelAE (5.3kbp), lanes5-10=pSB4K5 (4.2kbp), lanes11-13:DelG (6.4kbp); run at 100 V, 0.8 % gel (TAE)

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07), cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2.5
FS_11: (1/10)	2.5
Phusion Master Mix	25
dd H₂O	19
DMSO	2.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30 min
18	98	1
	63	5
	72	2:30 min
1	72	10 min
1	4	inf

Results:

There was no band visible on the gel.
Either the primers did not bind or the DNA still had to many secondary structures --> the consequence is to change the annealing temperature.

04-07-2013

Amplification from FS_12 to FS_13; 2.7 kb

Gel eletrophoresis of PCRs of DelF-G, DelO-P and DelL

Reaction

what	µl
D. acidovorans DSM-39	1
FS_12: (1/10)	1
FS_13: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	40
1	72	420
1	4	inf

Results:

Amplification of DelOP did not work
Amplification will be repeated to exclude that pipetting errors were the reason for the failure

04-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

Gel eletrophoresis of PCRs of DelF-G, DelO-P and DelL

Reaction

what	µl
D. acidovorans DSM-39	1
FS_14: (1/10)	1
FS_15: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	40
1	72	7 min
1	4	inf

Results:

Amplification worked very well, we had a bright band on the right height.
Band was cut out and DNA purified using QIAquick Gel Extration Kit.

06-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

PCR for amplification of del fragment L, L+=PCR delL with DMSO, L-=PCR without DMSO, M= Marker run at 135 V, 0.8 % gel (TAE); wanted amplicon size is: 1.4 kbp

Reaction

what	µl
D. acidovorans DSM-39	1
FS_14: (1/10)	1
FS_15: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

PCR for amplification of del fragment L, cut

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	42
18	98	1
	63	5
	72	42
1	72	12 min
1	4	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

05-07-2013

Amplification from FS_01 to FS_16; 4.2 kb

Gel electrophoresis of DelF-G, Backbone, DelF-G (5.1 kb), DelG (6.4 kb).

after Gel excision

Reaction

what	µl
Template pSB4K5	1
FS_16: (1/10)	1
FS_01: (1/10)	1
Phusion Master Mix	10
dd H₂O	6
DMSO	1

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
14	98	1
	62 ↓ 0.5	5
	72	3:20 min
16	98	1
	60	5
	72	3:20 min
1	72	12 min
1	4	inf

Results:

Amplification worked well and band was at expected height. Nevertheless the gel band did not run properly on the gel.

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_16 used for assembly of the desired genes from the D. acidovorans genome as well as the partsregistry backbone pSB4K5 .

We had various problems with the amplification of the fragments located in theregion DelF-G and DelO-P. For these particular PCRs long primers containing the Gibson overlaps had to be used. As these long primers often form complex secondary structures decreasing annealing efficiency we designed short version of these primers, having the same sequence region complementary to the genomic target, but lacking any longer overhangs. Consequently these primesrs will serve only for amplification of the desired genes from the genome of D. Acidovorans to obtain specific templates. This specific template afterwards will be used to introduce the designated overlap using the long primers again. In total 3 short primer versions FS_11s, FS_13s and FS_15s were ordered.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_11: DelAG_5_short_rv	2013-05-07	Amplification of DelAG from Delftia acidovorans. Gibson Primer	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_13: DelOP_short_rv	2013-05-07	Amplification of DelOP from Delftia acidovorans. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-05-07	Amplification of DelL. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG

Amplification of Del Genes from DSM-39 genome

Goals

The PCRs which worked in the previous week will be repeated to obtain higher product yields, as high concentrations of the long amplicons are needed for a successfull Gibson Assembly. Furthermore we will try to establish PCRs for the obtained short Primers and thereby provide specific templates for the second amplification step using the corresponding primers introducing the required Gibson overlaps. Amplifications of the sequence region DelF-G will be tried with different protocols to optimize PCR conditions, as we did not obtain any amplicons at all last week. Therefore it is likely that these primers are only able to bind in a very small frame of annealing temperature or even that the used primer combination do not posses a common annealing temperature and therefore amplification with the desired combinations is not possible.

As the amplification of DelO-P also turned out to be difficult, we decided to try a backup strategy which not only includes the desired genes DelO and DelP but also DelL and, since they are located between DelP and DelL, DelM and DelN. These two genes would increase our amplicon size by only 2.2 kb, but we hoped that on the other hand the corresponding primers would work better.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelE-G	FS_04 and FS_11s
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
		FS_06 and FS_11s
	DelG	FS_08 and FS_11s
		FS_10 and FS_11
		FS_10 and FS_11s
DelO DelP DelL	DelO-P	FS_12 and FS_13
	DelO-P	FS_12 and FS_13s
	DelL	FS_14 and FS_15
	DelL-P	FS_13 and FS_15s
pSB4K5	pSB4K5	FS_01 and FS_16

Re-PCRs
Gene(s)	Fragment	Primer combination	Successful?
DelF DelG	DelF-G	Primer FS_06 and FS_09
DelO DelP DelL	DelL-P	Primer FS_13_short and FS_15_short

08-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07); lane1=Marker, lanes2-4=DelAE (5.3kb), lanes5-10=pSB4K5 (4.2kb), lanes11-13:DelG (6.4kb); run at 100 V, 0.8 % gel (TAE)

Reaction

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	2.5
FS_03: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	19

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07), cut

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30 min
18	98	1
	63	5
	72	2:30 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAE worked
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

12-07-2013

Amplification from FS_02 to FS_07; 16.4 kb

PCR for amplification of DelAG (12.07;FS02+FS07); lane6=Ladder log2, lane7=Ladder 1kb base ruler, lane8=DelAG(12.07;FS02+FS_07) run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	5:30
18	98	1
	66	5
	72	5:30
1	72	15min
1	12	inf

Results:

only a smear occured, no specific product was amplified
PCR will be repeated with a lower, constant annealing temperature

09-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions I

Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Conditions II

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
5	98	1
	68	5
	72	3 min
25	98	1
	72	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelEG did not work

11-07-2013

Amplification from FS_04 to FS_11s; 17.5 kb

PCR for amplification of DelLP, DelFG and DelEG; lane1=Ladder log2, lane2=delLP(11.07), lane3=DelFG(11.07), lane4=DelEG (Phusion flash, 11.07), lane5=DelEG (Phusion II,11.07), lane6=1kb ladder plus; DelLP=6.4kbp, DelFG=5.3kbp, DelEG=16.4kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	1
FS_11_short: (1/10)	1
Phusion flash Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	5:30
18	98	1
	66	5
	72	5:30
1	72	15min
1	12	inf

Results:

Amplification of DelEG did not work
Experiment will be repeated with NEB Phusion II Polymerase as Phusion II is not provided as mastermix and therefore GC-buffer can be used

Amplification from FS_04 to FS_11; 17.5 kb; Phusion II

PCR for amplification of DelLP, DelFG and DelEG; lane1=Ladder log2, lane2=delLP(11.07), lane3=DelFG(11.07), lane4=DelEG (Phusion flash, 11.07), lane5=DelEG (Phusion II,11.07), lane6=1kb ladder plus; DelLP=6.4kbp, DelFG=5.3kbp, DelEG=16.4kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	1
FS_11_short: (1/10)	1
Phusion II	0.2
DNTP	0.4
Buffer	4
DMSO	0.6
dd H₂O	11.8

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	30
12	98	5
	68 ↓ 0.5	30
	72	8:10
18	98	5
	66	30
	72	8:10
1	72	15min
1	17	inf

Results:

Amplification of DelEG did not work
it seems not to be possible to amplify the desired 17 kbp fragent with the chosen primers and the given template, primercombination will be changed in further amplification attempts

14-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

PCR for amplification of DelEG (FS04-FS07, 14.07); lane1=log2 Marker, lane2=DelEG (protocol 68touchdown), lane3=DelEG (protocol 72touchdown); desired amplicon size=11kbp run at 100 V, 0.8 % gel (TAE)

PCR for amplification of DelEG (FS04-FS07, 14.07) after excision; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Cycler incubation room right

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3:00 min
18	98	1
	66	5
	72	3:00 min
1	72	10 min
1	12	inf

Conditions II

Cycler incubation room left

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	3:00 min
18	98	1
	68	5
	72	3:00 min
1	72	10 min
1	12	inf

Results:

Amplification of DelEG worked with a touchdown PCR starting from 70°C annealing temperature
band was cut out and DNA purified using QIAquick Gel Extraction Kit
PCR will be repeated to increase the amount of DNA and gather the concentrations necessary for Gibson Assembly

09-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

Analytical gel of PCR for amplification of DelG (09.07) and DelOP (reaction 2) (09.07); lane1=Marker, lane2= delG (6.4), lane3=DelOP (2.7kbp); run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08 (1/10)	1
FS_11_short (1/10)	1
Phusion Master Mix	10
dd H₂O	6
DMSO	1

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:30
24	98	1
	63	5
	72	2:30
1	72	10min
1	4	inf

Results:

A weak band was visible at the right height.
Band was cut out and DNA purified using QIAquick Gel Extration Kit.
Concentration after gel extration was too low
Maybe increasing the temperature further will result in higher yield.

13-07-2013

Amplification from FS_10 to FS_11s; 3.3 kb

PCR for amplification of Del G (13.07;FS10-FS11short)+ Gel extraction of FS_06 to FS_09 (13.07); lane1=Gel extraction of FS_06 to FS_09 (room temp.), lane2=Gel extraction of FS_06 to FS_09 (50°C), lane3=Del G (13.07;FS10-FS11short), lane4=log2 ladder, lane5 see Indigoidine, lane6=Gel extraction of FS_06 to FS_09 (room temp.); run at 100 V, 0.8 % gel (TAE)

2µl per lane of Gel extracted fragment FS06 to FS09 (13.07); lane3=log2 marker, lane4=tube1-6, lane5=tube7-12

Reaction

what	µl
D. acidovorans DSM-39	1
FS_10: (1/10)	2
FS_11_short: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	4
DMSO	1

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	70	5
	72	1:10 min
1	72	5 min
1	12	inf

Results:

No band was visible on the gel.
The PCR conditions of the 09-07-2013 should be further optimized.

Amplification from FS_10 to FS_11(s); 3.3 kb

PCR for amplification of Del G (13.07;FS10-FS11); run at 100 V, 0.8 % gel (TAE)

Gel extracted fragements FS10-FS11short and FS10-FS11long (each 1µl); run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_10: (1/10)	2
FS_11 (short or long): (1/10)	2
Phusion flash Master Mix	10
dd H₂O	4
DMSO	1

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:10 min
18	98	1
	66	5
	72	1:10 min
1	72	5 min
1	12	inf

Results:

Bright bands were visible in both, the PCR with the short and the long primer.
The PCR with the short primers worked better than the one with the long primer.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.
Concentration after gel extraction with primer FS_11short=6ng/µl in 18µl
Concentration after gel extraction with primer FS_11long=4ng/µl in 18µl

11-07-2013

Amplification from FS_13s to FS_15s; 6.4 kb

PCR for amplification of DelLP, DelFG and DelEG; lane1=Ladder log2, lane2=delLP(11.07), lane3=DelFG(11.07), lane4=DelEG (Phusion flash, 11.07), lane5=DelEG (Phusion II,11.07), lane6=1kb ladder plus; DelLP=6.4kbp, DelFG=5.3kbp, DelEG=16.4kbp; run at 100 V, 0.8 % gel (TAE)

Gel after excision

Reaction of DelLP

what	µl
D. acidovorans DSM-39	1
FS_13_short: (1/10)	1
FS_15_short: (1/10)	1
Phusion flash Master Mix	10
dd H₂O	6
DMSO	1

Conditions of Del LP

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:10
18	98	1
	66	5
	72	2:10
1	72	10min
1	12	inf

Results:

There was a very weak band visible on the right height.
The band was cut out anyway, as we wanted to use it as template for a Re-PCR
The DNA was purified using QIAquick Gel Extration Kit.

12-07-2013

Re-PCR of DelLP (FS_13s to FS_15s; 6.4 kb; 11-07-2013)

PCR for amplification of DelFG (12.07;FS6+FS11) and re-amplification of DelLP(12.07;FS13short+FS15short); lane1=Ladder log2, lane2=DelFG(12.07;FS6+FS11long), lane3=DelFG(12.07;FS6+FS11short), lane4=DelLP, lane5=1kb ladder plus; DelLP=6.4kbp, DelEG=11.6 kbp; run at 100 V, 0.8 % gel (TAE)

Reaction of DelLP

what	µl
Gel extracted fragment LP (11-07-2013)	2
FS_13_short: (1/10)	1
FS_15_long: (1/10)	1
Phusion flash Master Mix	10
dd H₂O	5
DMSO	1

Conditions of Del LP

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:10
18	98	1
	66	5
	72	2:10
1	72	10min
1	12	inf

Results:

The Re-PCR did not work, no bands were visible on the gel.

09-07-2013

Amplification I from FS_12 to FS_13; 2.7 kb

Analyticals gel older fragments + PCR for amplification of del fragments DelL (08.07), and DelOP (09.07); lane1=Marker, lanes2-7= DelAF (11.4kbp), BB psB4K5 (4.4kbp), DelOP (2.7kbp), DelG (6.4kbp), DelL (1.4kbp), DelAE (5.3kbp), DelEG (11.0kbp), lanes8-10=DelL (1.4kbp), lanes11-13:DelOP (2.5kbp); run at 100 V, 0.8 % gel (TAE)

Analyticals lane1=Marker, lanes2-7= DelAF (11.4kbp), BB psB4K5 (4.4kbp), DelOP (2.7kbp), DelG (6.4kbp), DelL (1.4kbp), DelAE (5.3kbp), DelEG (11.0kbp) + PCR for amplification of del fragments DelL (08.07), and DelOP (09.07), cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_12: (1/10)	1
FS_13: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	40
1	72	7 min
1	12	inf

Results:

Amplification of DelOP did not work
PCR was repeated, Annealing was carried out as touchdown starting from 68°C

Amplification II from FS_12 to FS_13; 2.7 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_12: (1/10)	1
FS_13short: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	6
8	98	1
	68 ↓ 0.5	5
	72	50
24	98	1
	72	5
	72	50
1	72	11min
1	4	inf

Results:

Amplification of DelOP did not work
PCR will be repeated with the newly ordered short version of primer FS_13, testing different DMSO settings

10-07-2013

Amplification from FS_12 to FS_13(s); 2.7 kb

PCR for amplification of DelOP, DelFG and DelG; +=with DMSO, -=without DMSO, L=both primers are the long primers, S= one Primer is one of the short primers; lane1=Marker, lane2=delOP(04.07,L+), lane3=DelOP(10.07,L+), lane4=DelOP(10.07,L-), lane5=DelOP(10.07,S+), lane6=DelOP(10.07,S-), lane7=DelFG(10.07,+), lane8=DelFG(10.07,-), lane9=DelOP(09.07,S+), lane10=DelG(09.07,S+); expected amplicon sizes: DelOP=2.5kbp, Del DelFG=ca 5kbp, DelG=6.4kbp; run at 100 V, 0.8 % gel (TAE)

Gel after excision

Reaction of DelO-P (2.6 kb)

4 reactions with different conditions: with/without DMSO, short/long Primer FS13

what	µl
D. acidovorans DSM-39	1
FS_12: (1/10)	1
FS_13(long or short): (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

Conditions of Del O-P

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	40
1	72	420
1	12	inf

Results:

None of the Amplification neither with primer FS_13 nor with FS_13short worked out, nevertheless did addition of DMSO change the amplification result
PCR will be carried out as 2-step in another more precise cycler
PCR will be set up with as touchdown PCR, annealing starting at 68°C
Furthermore a modified version of the forward primer will be order. This primer (FS_22) includes a recently in the Del Cluster predicted promotor as well as a likewise predicted ribosome binding site

08-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

Analyticals gel older fragments + PCR for amplification of del fragments DelL (08.07), and DelOP (09.07); lane1=Marker, lanes2-7= DelAF (11.4kbp), BB psB4K5 (4.4kbp), DelOP (2.7kbp), DelG (6.4kbp), DelL (1.4kbp), DelAE (5.3kbp), DelEG (11.0kbp), lanes8-10=DelL (1.4kbp), lanes11-13:DelOP (2.5kbp); run at 100 V, 0.8 % gel (TAE)

Analyticals lane1=Marker, lanes2-7= DelAF (11.4kbp), BB psB4K5 (4.4kbp), DelOP (2.7kbp), DelG (6.4kbp), DelL (1.4kbp), DelAE (5.3kbp), DelEG (11.0kbp) + PCR for amplification of del fragments DelL (08.07), and DelOP (09.07), cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_14: (1/10)	2.5
FS_15: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	42
18	98	1
	63	5
	72	42
1	72	12 min
1	4	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

08-07-2013

Amplification from FS_01 to FS_16; 4.2 kb

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07); lane1=Marker, lanes2-4=DelAE (5.3kbp), lanes5-10=pSB4K5 (4.2kbp), lanes11-13:DelG (6.4kbp); run at 100 V, 0.8 % gel (TAE)

PCR for amplification of del fragments DelAE (08.07), pSB4K5 (08.07) and DelG (07.07), cut

Reaction

(2x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
14	98	1
	62 ↓ 0.5	5
	72	3:20 min
16	98	1
	60	5
	72	3:20 min
1	72	12 min
1	4	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

10-07-2013

Amplification I from FS_06 to FS_07; 5.2 kb

PCR for amplification of DelOP, DelFG and DelG; +=with DMSO, -=without DMSO, L=both primers are the long primers, S= one Primer is one of the short primers; lane1=Marker, lane2=delOP(04.07,L+), lane3=DelOP(10.07,L+), lane4=DelOP(10.07,L-), lane5=DelOP(10.07,S+), lane6=DelOP(10.07,S-), lane7=DelFG(10.07,+), lane8=DelFG(10.07,-), lane9=DelOP(09.07,S+), lane10=DelG(09.07,S+); expected amplicon sizes: DelOP=2.5kbp, Del DelFG=ca 5kbp, DelG=6.4kbp; run at 100 V, 0.8 % gel (TAE)

Gel after excision

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	2:10 min
18	98	1
	63	5
	72	2:10 min
1	72	10 min
1	4	inf

Results:

Amplification did not work, not product is visible
PCR will be repeated with lower annealing temperature to increase primer binding

Amplification II from FS_06 to FS_07; 5.2 kb

PCR for amplification of DelFG II; lane1= Marker, lane2= touchdown with DMSO, lane3= touchdown without DMSO, lane4=constant anealing with DMSO, lane5= constant without DMSO ; expected amplicon size: DelFG=ca.5kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
30	98	1
	58	5
	72	2:30 min
1	72	10 min
1	12	inf

Results:

Amplification of DelFG did not work
PCR will be repeated with higher annealing temperature as reaction might not have worked due to secondary structures of primers

Amplification III from FS_06 to FS_07; 5.2 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_07: (1/10)	1
Phusion Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	60 ↓ 0.5	5
	72	2:30 min
18	98	1
	58	5
	72	2:30 min
1	72	10 min
1	12	inf

11-07-2013

PCR for amplification of DelLP, DelFG and DelEG; lane1=Ladder log2, lane2=delLP(11.07), lane3=DelFG(11.07), lane4=DelEG (Phusion flash, 11.07), lane5=DelEG (Phusion II,11.07), lane6=1kb ladder plus; DelLP=6.4kbp, DelFG=5.3kbp, DelEG=16.4kbp; run at 100 V, 0.8 % gel (TAE)

Gel after excision

Amplification from FS_06 to FS_07; 5.2 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	1
FS_07: (1/10)	1
Phusion flash Master Mix	10
DMSO	1
dd H₂O	6

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:30
18	98	1
	66	5
	72	2:30
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work
other primers will be designed in order to amplify the desired sequence from D. acidovorans

12-07-2013

Amplification from FS_06 to FS_11(s); 11.6 kb

PCR for amplification of DelFG (12.07;FS6+FS11) and re-amplification of DelLP(12.07;FS13short+FS15short); lane1=Ladder log2, lane2=DelFG(12.07;FS6+FS11long), lane3=DelFG(12.07;FS6+FS11short), lane4=DelLP, lane5=1kb ladder plus; DelLP=6.4kbp, DelEG=11.6 kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	2
FS_11 (long or short): (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Attention: 4 cycles were accidently carried out with an elongation time of 3:00 min

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
11	98	1
	73 ↓ 0.5	5
	72	5:00
19	98	1
	68	5
	72	5:00
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work, neither with the short nor with the long version of FS_11, consequently PCR will be repeated with different primers

13-07-2013

Amplification from FS_06 to FS_09; 8.5 kb

PCR for amplification of DelFG (13.07; FS6-FS9); run at 100 V, 0.8 % gel (TAE)

PCR for amplification of DelFG (13.07; FS6-FS9) after excision

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

a gradient PCR combined with touchdown was carried out. 12 wells, gradient in the annealing temperature from 74°C - 66°C, resulting in a gradient of 73°C - 65°C in the constant program

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	74 ↓ 0.5 to 65 ↓ 0.5	5
	72	3:00 min
18	98	1
	73 to 65	5
	72	3:00 min
1	72	10 min
1	12	inf

Results:

Amplification of DelFG worked, though several other bands occured, indicating low primer specifity
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
final concenctration after QIAquick Nucleotide Removal Kit: 5ng/µl in 18µl

14-07-2013

Re-Amplification from FS_06 to FS_09; 8.5 kb; 13-07-2013

PCR for amplification of DelFG (14.07) run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Template of gel extraction (13-07-2013)	1
FS_06: (1/10)	5
FS_09: (1/10)	5
Phusion flash Master Mix	25
DMSO	2.5
dd H₂O	11.5

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	71 ↓ 0.5	5
	72	3:00 min
18	98	1
	70	5
	72	3:00 min
1	72	10 min
1	12	inf

Results:

Amplification of DelFG did not work, no product was detectable

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_241 used for assembly of the desired genes from the D. acidovorans genome and the partsregistry backbone pSB4K5 .

As we discovered that there is a predicted promoter located right in front of DelO, we decided to include this promotor into our construct. This should ensure that the genes DelO, DelP and DelL are still expressed in the case that there is a terminator by the end of DelG. For this we designed primer FS_22 which binds right at the predicted promoter. However, this also meant, that we had to change the reverse primer for the DelG fragment in order to enable Gibson assembly of these fragments next to each oterh. Furthermore we created new primers for amplifying DelE, DelF and DelG as we were not successful in amplifying these fragments so far. These primers now offer more potential fragment combinations which can be tested. We hope to get the missing fragments with this new strategy.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_21: DelF_fw	2013-07-13	Amplification of DelF from Delftia acidovorans Gibson Primer	GACGCCATCTACCACCTGTG
FS_22: DelOP_short_fw	2013-08-02	Amplification of DelOP from Delftia acidovorans inlcuding the recently predicted endogenous Promotor for DelOP Gibson Primer	GATGACGCAGGGCGGCGGAATTTGTTCATC
FS_23: DelG_long_rv	2013-07-13	Amplification of DelG from Delftia acidovorans Gibson primer with overhang to DelOP element including the recently predicted endogenous Promotor	GATGAACAAATTCCGCCGCCCTGCGTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_24: DelAE_rv	2013-07-13	Amplification of DelAE from Delftia acidovorans Gibson Primer	CAGAAGAATTCCCAGAAGGAGATGTCGAAG
FS_26: DelFG_rv	2013-07-13	Amplification of DelFG from Delftia acidovorans Gibson Primer	GAATTCATCCACGATGATCTGCATG

Amplification of Del Genes from D. acidovorans DSM-39 genome

Goals

This week we will try to amplify the sequence region of DelF-G with several combinations of primers including both, the intial primers and the recently ordered ones beeing FS_20, FS_21, FS_22, FS_23, FS_24 and FS_26. Furthermore we will continue opimtizing our protocol for the amplification of DelO-P. To evaluate whether the very weak bands on the corresponding agarose gels represent the intended amplicons, we decided to carry out re PCR and test restriction digests.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	Primer FS_02 and FS_03
	DelE-G	Primer FS_04 and FS_07
	DelF-G	Primer FS_20 and FS_07
		Primer FS_20 and FS_09
		Primer FS_21 and FS_09
	DelG	Primer FS_08 and FS_09
	DelG	Primer FS_08 and FS_11_short
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13
	DelO-P	Primer FS_22 and FS_13_short
	DelL-P	Primer FS_13_short and FS_15_short

Re-PCRs
Gene(s)	Fragment	Primer combination	Successful?
DelE DelF DelG	DelE-G	Primer FS_04 and FS_07
	DelF-G	Primer FS_06 and FS_09
	DelF-G	Primer FS_21 and FS_09
	DelG	Primer FS_08 and FS_09
	DelG	Primer FS_08 and FS_11_short
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13

19-07-2013

Amplificaction from FS_02 to FS_03; 5.3 kb

+=with DMSO, -=without DMSO; expected amplicon sizes: LP=6.4kb, 8-9=3.1kb, 21-09 and 20-09=8.1kb, 22-13s=2.6kb, AE=5.3kb; run at 100 V, 0.8 % gel (TAE)

Amplifications of 18.07 and 19.07, cut

Reaction

2x ~50 µL

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	2.5
FS_03: (1/10)	2.5
Phusion flash Master Mix	25
DMSO	2.5
dd H₂O	19

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30
18	98	1
	63	5
	72	2:30
1	72	10min
1	12	inf

Results:

Amplification of DelAE did not work since a different cycler was used

20-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

Amplification of AE, OP, FG (20.07); expected amplicon sizes: 21-09(FG)=8.1kb, 22-13s(OP)=2.6kb, AE=5.3kb; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	2.5
FS_03: (1/10)	2.5
Phusion flash Master Mix	25
DMSO	2,5
dd H₂O	19

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30
18	98	1
	63	5
	72	2:30
1	72	10min
1	12	inf

Results:

Amplification of DelAE worked but a smear occured, therefore bands were cut out carefully and only used for a test restriction digest

15-07-2013

Amplification from FS_04 to FS_07, 11.1 kb

PCR for amplification of DelEG (FS04-FS07, 15.07), concentration AF(FS2 to FS5; 04.07); desired amplicon size Del EG=11kbp; run at 100 V, 0.8 % gel (TAE)

PCR for amplification of DelEG (FS04-FS07, 15.07) after excision; run at 100 V, 0.8 % gel (TAE)

3x 20µl of reaction mix

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	3:00 min
18	98	1
	68	5
	72	3:00 min
1	72	10 min
1	12	inf

Results:

Amplification of DelEG worked as expected
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

21-07-2013

Re-PCR of DelEG (FS_04 to FS_07; 11.1 kb; 05-07-2013)

Gel for testing concentrations of fragment FS04 to FS07 (14.07 and 15.07), FS_21 to FS_09 (19.07); run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07); - without DMSO, + with DMSO; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut1; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut2; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Fragment FS_04 to FS_07 amplified 15-07-2013	1
FS_04: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	3:00 min
18	98	1
	68	5
	72	3:00 min
1	72	10 min
1	12	inf

Results:

Re-PCR of DelEG in order to increase specifity did not work

16-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

Gel for testing concentrations of older fragments; run at 100 V, 0.8 % gel (TAE)

Gel for testing concentrations of fragment DelG (16.07; Conditions II; after gel extraction; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_11_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad C1000 Touch Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:30 min
24	98	1
	63	5
	72	2:30 min
1	72	10 min
1	12	inf

Conditions II

Biorad C1000 Touch Block B
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:30 min
18	98	1
	66	5
	72	2:30 min
1	72	10 min
1	12	inf

Conditions III

Biometra T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	12	inf

Results:

Only a small band with conditions II was visible
There were no bands with the other two

Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

18-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

lane2=Re-PCR DelG, lane3=amplification DelG (18.07), rest see DelH

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_11_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad C1000 Touch
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	64 ↓ 0.5	5
	72	2:10 min
18	98	1
	60	5
	72	2:10 min
1	72	10 min
1	12	inf

Results:

Amplification of DelG did not work, no product was detectable
PCR will be repeated at higher temperature to decrease formation of secondary structures and thereby improve binding of primers to the desired sequence

Re-Amplification from FS_08 to FS_11_short; 6.5 kb; 09-07-2013)

lane2=Re-PCR DelG, lane3=amplification DelG (18.07), rest see DelH

Reaction

what	µl
DelG (09-07-2013)	4
FS_08 (1/10)	2
FS_11_short (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	1

Conditions II

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:30
16	98	1
	63	5
	72	2:30
1	72	10min
1	4	inf

Results:

Amplification of DelG was not sucessful, the Re-PCR did not yield the desired product
forward Primer will be reused but reverse primer changed, in order to obtain a shorter amplicon and another strategy for the Gibson Assembly

19-07-2013

Amplification from FS_08 to FS_09; 3.3 kb

+=with DMSO, -=without DMSO; expected amplicon sizes: LP=6.4kbp, 8-9=3.1kbp, 21-09 and 20-09=8.1kbp, 22-13s=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Amplifications of 18.07 and 19.07, cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	1:00
18	98	1
	66	5
	72	1:00
1	72	6min
1	12	inf

Results:

Amplification of DelG did not lead to the desired product, a small band of the desired size was visible and cut for validation and Re-PCR
Re-PCR will be run

21-07-2013

Re-PCR from FS_08 to FS_09; 3.3 kb; 19-07-2013

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07); - without DMSO, + with DMSO; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut2; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Fragment FS_08 to FS_09 (19-07-2013)	1
FS_08: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	1:00
18	98	1
	66	5
	72	1:00
1	72	6min
1	12	inf

Results:

Re-Amplification of DelG did not work
initial amplification will be repeated at lower annealing temperature

18-07-2013

Amplification from FS_13s to FS_15s; 6.4 kb

+=with DMSO, -=without DMSO; expected amplicon sizes: LP=6.4kbp, 8-9=3.1kbp, 21-09 and 20-09=8.1kbp, 22-13s=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Amplifications of 18.07 and 19.07, cut

Reaction of DelLP

what	µl
D. acidovorans DSM-39	1
FS_13_short: (1/10)	2
FS_15_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions of Del LP

Biorad C1000 Touch Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	2:10
18	98	1
	63	5
	72	2:10
1	72	10min
1	12	inf

Results:

The second try to amplify DelL-P did not work. There were no bands visible on the gel.
It does not make sense to try this again.

17-07-2013

Amplification from FS_22 to FS_13(s); 2.7 kb

lane5=log2 Marker, lane6=68touchdown (FS13_short), lane7=68touchdown (FS13), lane8=72 2-step (FS13_short), lane9=72 2-step (FS13); run at 100 V, 0.8 % gel (TAE)

4 reactions (with long and short primer FS13 and with conditionI and conditionII)

Reaction of DelOP

what	µl
D.acidovorans	1
FS_22: (1/10)	2
FS_13 (long or short): (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I of DelOP

Biorad C1000 Touch Block B
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:00 min
18	98	1
	66	5
	72	1:00 min
1	72	5 min
1	12	inf

Conditions II of DelOP

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	1:00 min
1	72	5:00 min
1	12	inf

Results:

Amplification of DelOP failed again
PCR will be repeated, annealing will be carried out 65°C (touchdown) as primer binding seems not to occure at high temperatues as the ones tested in the last amplification attempts

19-07-2013

Amplification from FS_22 to FS_13s; 2.7 kb

+=with DMSO, -=without DMSO; expected amplicon sizes: LP=6.4kbp, 8-9=3.1kbp, 21-09 and 20-09=8.1kbp, 22-13s=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Amplifications of 18.07 and 19.07, cut

--> reaction mixture with and without DMSO

Reaction

what	µl
D. acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP failed again, unexpected bands as well as a smear occured
Annealing temperature will be further decreased, to investigate if amplification of the intended product occurs at lower temperatures

20-07-2013

Amplification from FS_22 to FS_13s; 2.7 kb

Amplification of AE, OP, FG (20.07); expected amplicon sizes: 21-09(FG)=8.1kbp, 22-13s(OP)=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	4

Conditions

Biorad C1000 Touch Block B
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	62 ↓ 0.5	5
	72	1:00
18	98	1
	60	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP did not work, only unintented products as well as a slight smear occured
Reaction will be carried out again at lower annealing temperature to allow primer binding to the intended sequences

21-07-2013

Amplification from FS_22 to FS_13s; 2.7 kb

Amplification of DelOP and Re-PCR of DelFG (21.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelOP and Re-PCR of DelFG (21.07) cut; run at 100 V, 0.8 % gel (TAE)

4x 20µl (with, without DMSO; 60touchdown, 72 twostep)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/5

Conditions I

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	60 ↓ 0.5	5
	72	1:00
18	98	1
	58	5
	72	1:00
1	72	5min
1	12	inf

Conditions II

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	5
30	98	1
30	72	1:00 min
1	72	5:00 min
1	12	inf

Results:

Amplification of DelOP led to inconclusive results, a very thin band of the intended length as well as several other bands and a smear occured
Band were cut out and DNA purified using QIAquick Gel Extraction Kit to verify amplicon in a re-PCR

Re-PCR of DelOP (FS_22 to FS_13s; 2.7 kb; 19-07-2013)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07); - without DMSO, + with DMSO; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut2; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	-
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP did not work
PCR will be repeated as re-pcr from the previously obtained sample

22-07-2013

Re-PCR of DelOP (FS_22 to FS_13; 2.7 kb; 19-07-2013)

Re-PCR of DelOP (22-13long), Amplification of DelFG (20-9 and 21-9) (22.07); run at 100 V, 0.8 % gel (TAE)

Re-PCR of DelOP (22-13long), Amplification of DelFG (20-9 and 21-9) (22.07) cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Fragment FS_22 to FS_13_short 19-07-2013)	1
FS_22: (1/10)	2
FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Re-PCR did lead ot a band at the expected size but also a smear and several unexpected bands
Re-PCR will be repeated

24-07-2013

Re-PCR of DelOP (FS_22 to FS_13; 2.7 kb; 19-07-2013)

Amplification of DelFG II (FS20 to FS07; 24.07) and DelOP,; run at 100 V, 0.8 % gel (TAE)

Amplification of DelFG II (FS20 to FS07; 24.07) and DelOP; run at 100 V, 0.8 % gel (TAE)

3x20µl

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	2
FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Re-PCR of DelOP did not work, no bands were visible
Re-PCR will be repeated

15-07-2013

Re-PCR for amplification of DelFG (15.07) run at 100 V, 0.8 % gel (TAE)

Re-Amplification from FS_06 to FS_09; 8.5 kb; 13-07-2013)

Reaction

what	µl
DelEG (FS_06-FS_09; 13-07-2013)	1
FS_06: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Cycler incubation room right

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	3:00 min
1	72	10 min
1	12	inf

Results:

Amplification of DelFG did not work
two unecpected bands appeared like in the previous trials

19-07-2013

Amplification from FS_20 to FS_09; 8.5 kb

+=with DMSO, -=without DMSO; expected amplicon sizes: LP=6.4kbp, 8-9=3.1kbp, 21-09 and 20-09=8.1kbp, 22-13s=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Amplifications of 18.07 and 19.07, cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:50
18	98	1
	66	5
	72	2:50
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work with FS_20 to FS_09
as PCR worked with a different set of Primers beeing FS_21 to FS_09, see below, the PCR for this primer combination will be optimized instead of using FS_20 to FS_09

Amplification from FS_21 to FS_09; 8.5 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

-->New cycler (not two block)

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:50
18	98	1
	66	5
	72	2:50
1	72	10min
1	12	inf

Results:

Amplification worked with FS_21 to FS_09 but not with FS_20 to FS_09
band was cut out and DNA purified using QIAquick Gel Extraction Kit
PCR will be repeated to get rid of side product at about 1.5 kb as well as smear, therefore annealing temperature will be increased

20-07-2013

Amplification from FS_21 to FS_09; 8.5 kb

Amplification of AE, OP, FG (20.07); expected amplicon sizes: 21-09(FG)=8.1kbp, 22-13s(OP)=2.6kbp, AE=5.3kbp; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad C1000 Touch Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	2:50
18	98	1
	68	5
	72	2:50
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work only an uneqxpected band a smear occured, but the intended product was not detectable
other primer combinations might be tried or PCR has to be repeated with the previous conditions not leading to an optimal product quality

21-07-2013

Amplification from FS_20 to FS_07; 5.2 kb

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07); - without DMSO, + with DMSO; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut1; run at 100 V, 0.8 % gel (TAE)

Amplification of FS20-FS07 (FG), Re-PCRs FS08-FS09 (G), FS22-13_short (OP) and FS04-FS07 (all 21.07) cut2; run at 100 V, 0.8 % gel (TAE)

2x 20µl (with, without DMSO)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/5

Conditions

Biorad C1000 Block A
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	68 ↓ 0.5	5
	72	2:00
18	98	1
	63	5
	72	2:00
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work perfectly, neither with nor without 5% DMSO, nevertheless band of expected size was cut out carefully to be used for a Re-PCR

Re-PCR from FS_21 to FS_09; 8.1kb; 19-07-2013)

Gel for testing concentrations of fragment FS04 to FS07 (14.07 and 15.07), FS_21 to FS_09 (19.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelOP and Re-PCR of DelFG (21.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelOP and Re-PCR of DelFG (21.07) cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Gel extracted fragments FS_21 to FS_09 (19-07-2013)	2
FS_21: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	3

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:50
18	98	1
	66	5
	72	2:50
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work with primers FS_21 to FS_09
PCR will be repeated with different primers

Amplification and purification of Del Genes from DSM-39

Goals

As our the amplifications of of the sequence region DelF-G did not progress last week, we decided to focus on this region in week 13. All combinations of initial and newly ordered primers will be tried with various PCR protocols. Furthermore, we tried to get higher amounts of the fragments for which protocols have already been established in order to have enough of each product to carry out suitable test restriction digests.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	Primer FS_02 and FS_03
	DelA-E	Primer FS_02 and FS_24
	DelA-F	Primer FS_02 and FS_05
	DelA-G	Primer FS_02 and FS_26
	DelA-G	Primer FS_02 and FS_23
	DelE	Primer FS_04 and FS_24
	DelE-G	Primer FS_04 and FS_09
	DelF-G	Primer FS_06 and FS_07
		Primer FS_20 and FS_07
		Primer FS_20 and FS_23
		Primer FS_20 and FS_11_short
		Primer FS_21 and FS_07
		Primer FS_21 and FS_11_short
		Primer FS_21 and FS_23
		Primer FS_20 and FS_09
		Primer FS_21 and FS_09
	DelG	Primer FS_08 and FS_11_short
	DelG	Primer FS_08 and FS_23
DelO DelP	DelO-P	Primer FS_22 and FS_13
DelO DelP	DelO-P	Primer FS_22 and FS_13_short

Re-PCRs
Gene(s)	Fragment	Primer combination	Successful?
DelG	DelG	Primer FS_10 and FS_23
DelO DelP	DelO-P	Primer FS_22 and FS_13

Test restriction digests of PCR amplified fragments
Fragment	Primer	Digestion enzyme	Expected bands [bp]
DelA-E	Primer FS_02 and FS_03	EcoRI-HF	3054, 2260
DelA-F	Primer FS_02 and FS_05	EcoRI-HF	4624, 4354, 2260
DelE-G	Primer FS_04 and FS_07	PvuI-HF	6187, 4917
DelF-G	Primer FS_20 and FS_07	XmaI	4307, 879
DelF-G	Primer FS_20 and FS_07	ClaI	2420, 1519, 1247
DelG	Primer FS_08 and FS_23	BglII	3291, 1936, 1303
DelO-P	Primer FS_22 and FS_13_short	EcoRI-HF	1883, 960

26-07-2013

Restriction digest of fragment FS_02 to FS_03; 5.3 kb; 08-07-2013 with EcoRI-HF

Restriction digest of DelAE (FS_02 to FS_03 ;08.07), DelAF (FS_02 to FS_05; 04.07) and DelOP (FS_22 to FS_13short ;21.07) with EcoRI-HF and digest of DelG (FS_08 to FS_23 cut1 ;23.07) with BglII; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 1 h 45 min

what	µL
FS_02 to FS_03 (08-07-2013)	15
EcorRI-HF	0.5
Buffer CutSmart	2
dd H₂O	2
Expected fragment lengths [bp]	3054, 2260

Results:

restriction digest of DelAE did not work, since incubation time might have been to short

27-07-2013

Amplificaction from FS_02 to FS_03; 5.3 kb

Amplification of DelAE (FS02 to FS03; 27.07,1), Amplification of DelAF (FS_02 to FS05; 27.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelAE (FS02 to FS03; 27.07,1), Amplification of DelAF (FS_02 to FS05; 27.07), cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	2.5
FS_03: (1/10)	2.5
Phusion flash Master Mix	25
DMSO	2.5
dd H₂O	19

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	2:30
18	98	1
	63	5
	72	2:30
1	72	12 min
1	12	inf

Results:

Amplification of DelAE didnt work out, only smear occured
repeat PCR with better cycler

Amplificaction from FS_02 to FS_03; 5.3 kb

2nd Amplification of DelAE (FS02 to FS03; 27.07,1), first two lanes with 5 µL primer, second two lanes with 2.5 µL primer; run at 100 V, 0.8 % gel (TAE)

gel after excision

Reaction

what	µL
D. acidovorans DSM-39	1.5/1
FS_02: (1/10)	2.5/5
FS_03: (1/10)	2.5/5
Phusion flash Master Mix	25
DMSO	2.5
dd H₂O	19/14

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	2:30
18	98	1
	63	5
	72	2:30
1	72	12 min
1	12	inf

Results:

Amplification of DelAE worked with both 200 and 400 nM of Primers, nevertheless amplification was more specific with the higher primer concentration
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

Amplification I from FS_02 to FS_24; 7.1 kb

Amplifikation of DelFG (FS02-FS24), ; run at 100 V, 0.8 % gel (TAE)

4 reactions, 2 with 200nM Primers and 2 with 400nM Primers (both concentrations for each condition)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	4/2
FS_24: (1/10)	4/2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	3:50
1	72	12 min
1	10	inf

Conditions II

Biometra TProfessional Basic
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3:50 min
18	98	1
	66	5
	72	3:50 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAE worked with 200 nM primer concentration at an annealing temperature of 68°C and 400 nM at an annealing temperature of 65°C, the product obtained at 65°C was more specific
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

Amplification II from FS_02 to FS_24; 7.1 kb

2 x Amplification of FS02 to FS_24 27.07.13 68°C Touchdown 200nM/400nM; 4x Amplification of FS-02 to FS23 27.0713 1 & 2 68°C Touchdown 200nM/400nM; 3. & 4. 65°C const. 200/400 nM, run at 100V

2 reactions, 68°C Touchdown with 200nM Primers and 65°C constant with 400nM Primers

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	2/4
FS_24: (1/10)	2/4
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	5:40
1	72	12 min
1	10	inf

Conditions II

Biometra TProfessional Basic
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	5:40 min
18	98	1
	66	5
	72	5:40 min
1	72	10 min
1	4	inf

Results:

Amplification did not work, neither with 200nM and 68°C touchdown, nor with 400nM and 65°C constant.
Repeat amplfication with different conditions as primers did not bind very effectively

Amplification III from FS_02 to FS_24; 7.1 kb

1kbruler / 4xFS02-FS23 60const @T100 200nM; T100 400nM; old 200nM; old 400nM ; red 200nM; red 400nM / FS02-FS24 66td janusA 200nM / FS02-FS24 T100 60const 200nM; 400nM 1kb FS04-FS24.png ; run at 100 V, 0.8 % gel (TAE)

2 reactions, 66°C Touchdown with 200nM Primers and 60°C constant with 400nM Primers

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	2/4
FS_24: (1/10)	2/4
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	5:40
1	72	12 min
1	10	inf

Conditions II

Biorad C1000 Touch Block A
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	5:40 min
18	98	1
	64	5
	72	5:40 min
1	72	10 min
1	4	inf

Results:

Amplification from DelAE (7.1 kbp) failed again
stick to the old strategy and use previously obtained fragments with different other fragments for gibson assembly.

29-07-2013

Restriction digest of FS_02 to FS_03; 5.3 kb;(27-07-2013; II) with BglII

Test restriction digest (29.07); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 h

what	µL
FS_02 to FS_03 (27-07-2013; II)	15
BglII	1
Buffer 3.1	2
dd H₂O	2

Expected fragment lengths: 2,146 kb; 1,862 kb; 1,306 kb

Results:

Restriction digest shows the expected product sizes
indicator for correct amplicon but to be sure, PCR product will be prepared for single read sequencing by GATC

26-07-2013

Restriction digest of FS_02 to FS_05; 11.2 kb; 04-07-2013 with EcoRI-HF

Restriction digest of DelAE (FS_02 to FS_03 ;08.07), DelAF (FS_02 to FS_05; 04.07) and DelOP (FS_22 to FS_13short ;21.07) with EcoRI-HF and digest of DelG (FS_08 to FS_23 cut1 ;23.07) with BglII; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 1hour 45min

what	µL
FS_02 to FS_05 (04-07-2013)	15
EcoRI-HF	0.5
Buffer CutSmart	2
dd H₂O	2
Expected fragment lengths [bp]	4624, 4354, 2260

Results:

restriction digest did not work as expected
test restriction will be repeat with higher amount of enzyme and longer incubation time

27-07-2013

Amplification of FS_02 to FS_05; 11.2 kb

Amplification of DelAE (FS02 to FS03; 27.07,1), Amplification of DelAF (FS_02 to FS05; 27.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelAE (FS02 to FS03; 27.07,1), Amplification of DelAF (FS_02 to FS05; 27.07), cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	2.5
FS_05: (1/10)	2.5
Phusion flash Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0,5	5
	72	3:00
18	98	1
	66	5
	72	3:00
1	72	10 min
1	4	inf

Results:

Amplification of DelAE worked, but a slight smear as well as several unexpected bands occured
bands were cut out and DNA purified using QIAquick Gel Extraction Kit but PCR has to be further optimized in order to improve product quality

27-07-2013

Amplification from FS_02 to FS_26; 16.7 kb

2 x Amplification of FS02 to FS_23 27.07.13 200nM/400nM, 4x 2 x Amplification of FS02 to FS_26 27.07.13; run at 100V

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	3:50
1	72	12 min
1	10	inf

Results:

Amplification of DelAG did not work, unspecific band at approximately 3.5 kbp occured

Amplification 1 from FS_02 to FS_23; 22.8 kb

2 x Amplification of FS02 to FS_24 27.07.13 68°C Touchdown 200nM/400nM; 4x Amplification of FS-02 to FS23 27.0713 1 & 2 68°C Touchdown 200nM/400nM; 3. & 4. 65°C const. 200/400 nM, run at 100V

4 reactions, 2 with 200nM Primers and 2 with 400nM Primers (both concentrations for each condition)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	4/2
FS_23: (1/10)	4/2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	6:40
1	72	12 min
1	10	inf

Conditions II

Biometra TProfessional Basic
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	6:40 min
18	98	1
	66	5
	72	6:40 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAG did not work, several unspecific bands occured

Amplification 2 from FS_02 to FS_23; 22.8 kb

1kbruler / 4xFS02-FS23 60const @T100 200nM; T100 400nM; old 200nM; old 400nM ; red 200nM; red 400nM / FS02-FS24 66td janusA 200nM / FS02-FS24 T100 60const 200nM; 400nM 1kb FS04-FS24.png ; run at 100 V, 0.8 % gel (TAE)

4 reactions, 2 with 200nM Primers and 2 with 400nM Primers (both concentrations for each condition)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	4/2
FS_23: (1/10)	4/2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad MyCycler, Biometra TProfessional Basic and Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	6:40
1	72	12 min
1	10	inf

Results:

Amplification of DelAG did not work, independent of the cycler only unspecific bands at 4.0 and 5.2 kbp occured

27-07-2013

Amplification from DelE (FS_04 to FS_24; 1.6 kb)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3:00
18	98	1
	66	5
	72	3:00
1	72	10 min
1	4	inf

Results:

Amplification did not work.

24-07-2013

Restriction digest of fragment FS_04 to FS_07; 11.1 kb with PvuI-HF

Test restriction digest of DelEG FS04 to FS07 (24.07); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 45 min

what	µl
FS_04 to FS_07 (14-07-2013 and 15-07-2013)	15
PvuI-HF	0.8
Buffer CutSmart	2
dd H₂O	2.8
Expected fragment lengths [bp]	6187, 4917

Results:

restriction digest did not work
digest will be repeated with newly amplified and purified DelEG

28-07-2013

Amplification from FS_04 to FS_09 ; 14.4 kb

2 reactions with conditions I and II

Reaction

what	µl
D. acidovorans DSM-39	1
FS_04: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	4:40
1	72	13 min
1	10	inf

Conditions II

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	4:40
18	98	1
	66	5
	72	4:40
1	72	13 min
1	10	inf

Amplification from FS_26 to FS_07

2log ladder / FS21-FS24 60const / FS07-FS26 65const / FS07-FS26 68const / FS24-FS26 65const / FS24-FS26 68const; run at 100 V, 0.8 % gel (TAE)

This amplification did not make sense, two reverse Primer were used. We mixed up Primer FS_24 with Primer FS_26.

2 reactions with conditions I and II

Reaction

what	µl
D. acidovorans DSM-39	1
FS_26: (1/10)	2
FS_07: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	3:20
1	72	13 min
1	10	inf

Conditions II

Biorad C1000 Touch Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3:20
18	98	1
	66	5
	72	3:20
1	72	12 min
1	10	inf

Results:

Amplification of DelEG did not work, neither with annealing at a constant temperature of 65°C nor with a touchdown starting from 68°C
later on it was discovered, that primers had been mixed up

Amplification from FS_26 to FS_24

This amplification did not make sense, two reverse Primer were used.

2log ladder / FS21-FS24 60const / FS07-FS26 65const / FS07-FS26 68const / FS24-FS26 65const / FS24-FS26 68const; run at 100 V, 0.8 % gel (TAE)

2 reactions with conditions I and II

Reaction

what	µl
D. acidovorans DSM-39	1
FS_26: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	3:20
1	72	13 min
1	10	inf

Conditions II

Biorad C1000 Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3:20
18	98	1
	66	5
	72	3:20
1	72	12 min
1	10	inf

Results:

Amplification of DelEG did not work, neither with annealing at a constant temperature of 65°C nor with a touchdown starting from 68°C
later on it was discovered, that primers had been mixed up

22-07-2013

Re-PCR from FS_10 to FS_23; 3.3 kb; 13-07-2013

Re-PCR of DelG (10-23), Amplification of DelG (8-23) (22.07); run at 100 V, 0.8 % gel (TAE)

Re-PCR of DelG (10-23), Amplification of DelG (8-23) (22.07) cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
Fragment FS_10 to FS_11_short (13-07-2013)	1
FS_10: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

--> First cycles with wrong program

Biorad C1000 Touch Block A
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:10 min
18	98	1
	66	5
	72	1:10 min
1	72	5 min
1	12	inf

Results:

Re-Amplification of DelG lead to the expected fragment but also to a smear, therefore fragment will not be used for Gibson Assembly but restriction digests to validate the product.

Amplification from FS_08 to FS_23; 6.5 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/-

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG worked, leading to the expected product as well one other unexpected band.
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

Amplification from FS_08 to FS_11s; 6.5 kb

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_11_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
14	98	1
	62 ↓ 0.5	5
	72	3:20
16	98	1
	60	5
	72	3:20
1	72	10min
1	12	inf

23-07-2013

Amplification from FS_08 to FS_23; 6.5 kb

Amplification of DelG (FS_08-FS_23); run at 100 V, 0.8 % gel (TAE)

Amplification of DelG (FS_08-FS_23)after cutting; run at 100 V, 0.8 % gel (TAE)

Measurement of concentration of DelG, DelFG and DelOP (2µl of each); run at 100 V, 0.8 % gel (TAE)

4x 20µl

Reaction

what	µl
D. acidovorans DSM-39	1
FS_08: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
Gel to proof quality of gel extraction was run

26-07-2013

Restriction digest of Fragment FS_08 to FS_23; 6.5 kb; 23-07-2013 with BglII

Restriction digest of DelAE (FS_02 to FS_03 ;08.07), DelAF (FS_02 to FS_05; 04.07) and DelOP (FS_22 to FS_13short ;21.07) with EcoRI-HF and digest of DelG (FS_08 to FS_23 cut1 ;23.07) with BglII; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 1hour 45min

what	µl
FS_08 to FS_23 cut1 (23-07-2013)	15
BglII	0.5
Buffer 3.1	2
dd H₂O	2
Expected fragment lengths [bp]	3291, 1936, 1303

Results:

Restriction digest of DelG (FS_08 to FS_23) was successful though one unexpected band (presumably carry over) appeared
Construct will be further validated by sequencing before potential Gibson Assembly

25-07-2013

Re-PCR I from FS_22 to FS_13; 2.7 kb; 19-07-2013

Re-PCR I of OP (FS_22 to FS_13_long); run at 100 V, 0.8 % gel (TAE)

3x20µl

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	4
FS_13_long: (1/10)	4
Phusion flash Master Mix	10
dd H₂O	1

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP led to a smear and several unexpected bands
Re-PCR will be repeated

Re-PCR I from FS_22 to FS_13; 2.7 kb; 19-07-2013

4 x Amplification of DelFG (FS20 to FS07; 26.07), 4 x Amplification of DelOP (FS_22 to FS13; 25.07); run at 100 V, 0.8 % gel (TAE)

4 x Amplification of DelFG (FS20 to FS07; 26.07), 4 x Amplification of DelOP (FS_22 to FS13; 25.07) after cutting; run at 100 V, 0.8 % gel (TAE)

3x20µl

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	2
FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

a smear as well as a band of the expeceted size occured
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
DNA will be used for restriction digests to validate amplicon

26-07-2013

Restriction digest of fragment FS_22 to FS_13s; 2.7 kb; 21-07-2013 with EcoRI-HF

Restriction digest of DelAE (FS_02 to FS_03 ;08.07), DelAF (FS_02 to FS_05; 04.07) and DelOP (FS_22 to FS_13short ;21.07) with EcoRI-HF and digest of DelG (FS_08 to FS_23 cut1 ;23.07) with BglII; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 1h 45min

what	µl
FS_22 to FS_13short (21-07-2013)	20
EcorRI-HF	0.8
CutSmart	2.5
dd H₂O	2.5
Expected fragment lengths [bp]	1883, 960

Results:

Restriction digest did not work, the amplified fragment was either not cut or the fragments are not visible due to a very small amount of DNA
Re-PCR will be repeated to obtain the higher amounts of DNA required for the restriction digest

30-07-2013

Re-PCR from FS_22 to FS_13; 2.7 kb; 19-07-2013

Re-PCR OP, Restriction digest OP with EcoRI; run at 100 V, 0.8 % gel (TAE)

3x20µl

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	2
FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP did not work
PCR will be repeated with different primer concentrations to estimate whether primer dimes might be the reason for insufficient amplification

Restriction digest from FS_22 to FS_13; 2.7 kb; 25-07-2013 with EcoRI-HF

Incubation at 37°C for

what	µl
FS_22 to FS_13long(25-07-2013)	17
EcoRI	1
Buffer CutSmart	2

Amplification from FS_22 to FS_13s; 2.7 kb

Amplification of Del O-P from FS_22 to FS_13long/FS_13short under different conditions run at 100 V 0.8% agarose gel (TAE

Gel after excision

2x20µl

Reaction

what	µl
D.acidovorans DSM-39	1
FS_22: (1/10)	4
FS_13_short: (1/10)	4
Phusion flash Master Mix	10
dd H₂O	1

20µl

Reaction

what	µl
D.acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP resulted in a small band atthe desired lenght, but also a smear and several unexpected bands
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
amplicon will be used for restriction digest to validate the construct

Amplification from FS_22 to FS_13(s/l); 2.7 kb

Reaction

what	µl
D.acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short/FS_13_long: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/5

Conditions

Biorad C1000 Touch
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	1:00
1	72	5 min
1	12	inf

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	70	5
	72	1:00
1	72	5 min
1	12	inf

22-07-2013

Amplification from FS_20/FS_21 to FS_09; 8.5 kb

Re-PCR of DelOP (22-13long), Amplification of DelFG (20-9 and 21-9) (22.07); run at 100 V, 0.8 % gel (TAE)

Re-PCR of DelOP (22-13long), Amplification of DelFG (20-9 and 21-9) (22.07) cut; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20/FS_21: (1/10)	2
FS_09: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	2:20
18	98	1
	63	5
	72	2:20
1	72	10 min
1	12	inf

Results:

Amplification of DelFG did not work
other primers/combinations of primers will be used
somehow getting annoyed by this part of D. Acidovorans

Amplification from FS_20/FS_21 to FS_11_short; 11.6 kb

Amplification of DelFG (22.07); run at 100 V, 0.8 % gel (TAE)

4x 20µl (70 touchdown, 65 touchdown)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20 or FS_21: (1/10)	2
FS_11_short: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	70 ↓ 0.5	5
	72	3:40
18	98	1
	68	5
	72	3:40
1	72	13min
1	12	inf

Conditions II of Del FG

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	65 ↓ 0.5	5
	72	3:40
18	98	1
	63	5
	72	3:40
1	72	13min
1	12	inf

Results:

Amplification of DelFG did not work neither with a touchdown PCR starting at an annealing temperature of 65°C nor 70°C

Amplification from FS_20/FS_21 to FS_23; 11.6 kb

Amplification of DelFG (22.07); run at 100 V, 0.8 % gel (TAE)

4x 20µl (70 touchdown, 65 touchdown)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20 or FS_21: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	70 ↓ 0.5	5
	72	3:40
18	98	1
	68	5
	72	3:40
1	72	13min
1	12	inf

Conditions II

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	5
12	98	1
	65 ↓ 0.5	5
	72	3:40
18	98	1
	63	5
	72	3:40
1	72	13min
1	12	inf

Results:

Neither the amplification with the primers FS_20 to FS_23 or FS_21 to FS_23 did work. Another primer combination has to be tried.

24-07-2013

Amplification of DelFG (FS_06 to FS_07; 5.2 kb)

PCR of FG (FS_06 to FS_07) or (FS_20 to FS_07) or (FS_21 to FS_07) as indicated; run at 100 V, 0.8 % gel (TAE)

Reaction I

what	µl
D. acidovorans DSM-39	1
FS_06: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Amplification from FS_20 to FS_07; 5.2 kb

PCR of FG (FS_06 to FS_07) or (FS_20 to FS_07) or (FS_21 to FS_07) as indicated; run at 100 V, 0.8 % gel (TAE)

Reaction II

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Amplification from FS_21 to FS_07; 5.2kb

PCR of FG (FS_06 to FS_07) or (FS_20 to FS_07) or (FS_21 to FS_07) as indicated; run at 100 V, 0.8 % gel (TAE)

Reaction III

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Conditions for reactions I - III

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:10
18	98	1
	64	5
	72	2:10
1	72	10min
1	12	inf

Results:

The amplification of FS_06 to FS_07 did not work. No bands were visible
The amplification of FS_21 to FS_07 led to several bands, but none of these was the intended product
The amplfication of FS_20 to FS_07 also led to several bands, one band at the right height was observed. Consequently the specificity of the PCR will be increased by a higher annealing temperature

Amplification from FS_20 to FS_07; 5.2 kb

2x20µl (one with conditions I, other one with conditions II)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Conditions I

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	2:10
18	98	1
	68	5
	72	2:10
1	72	10min
1	12	inf

Conditions II

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	2:10
18	98	1
	66	5
	72	2:10
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work, several bands occured, one of these had the size of the intended product but purity of the PCR was not sufficient for Gibson Assembly
nethertheless bands were cut out and DNA purified using QIAquick Gel Extraction Kit for restriction digest

Amplification from FS_20 to FS_07; 5.2 kb

Amplification of DelFG II (FS20 to FS07; 24.07),; run at 100 V, 0.8 % gel (TAE)

Amplification of DelFG II (FS20 to FS07; 24.07), ; run at 100 V, 0.8 % gel (TAE)

4x20µl

Reaction

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	70 ↓ 0.5	5
	72	2:10
18	98	1
	68	5
	72	2:10
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work, several bands occured, one of these had the size of the intended product but purity of the PCR was not sufficient for Gibson Assembly
nethertheless bands were cut out and DNA purified using QIAquick Gel Extraction Kit for restriction digest

25-07-2013

Restriction digest of fragment from FS_20 to FS_07; 5.2 kb; 23-07-2013 and 24-07-2013 with XmaI

Restriction digest of Fragment FS_20 to FS_07 (23.07 and 24.07) with XmaI ; Expected size of digested fragments: 0.9kbp and 4.3kbp; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 45 min

what	µl
FS_20 to FS_07 (23-07-2013 and 24-07-2013)	15
XmaI	0.8
Buffer CutSmart	2
dd H₂O	2.2
Expected fragment lengths [bp]	4307, 879

Results:

restriction digest of DelFG did not work, only very slight bands were visible
digest will be repeated with higher amount of DNA and enzyme to improve analysis on the gel

26-07-2013

Amplification from FS_20 to FS_07; 5.2 kb

Reaction I

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	70	5
	72	2:10
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work, several bands occured, one of these had the size of the intended product but purity of the PCR was not sufficient for Gibson Assembly
Annealing temperature will be increased further, to optimize primer specifity

Restriction digest of fragment from FS_20 to FS_07; 5.2 kb; 23-07-2013 and 23-07-2013) with ClaI

restriction digest of FS_20 to FS_07 (26.07.13) with ClaI and concentration measurement of DelOP (25.07.13); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for 45 min

what	µl
FS_20 to FS_07 (23-07-2013 and 23-07-2013)	25
ClaI	1
Buffer CutSmart	3
dd H₂O	1
Expected fragment lengths [bp]	2743, 1519, 1208

Results:

restriction digest of Del FG did not lead to the expected results
as no DNA was visible in the restriction digest, experiment will be repeated with a higher amount of DNA

Amplification from FS_06 to FS_07; 5.2 kb

4 x Amplification of DelFG (FS20 to FS07; 26.07), 4 x Amplification of DelOP (FS_22 to FS13; 25.07); run at 100 V, 0.8 % gel (TAE)

4 x Amplification of DelFG (FS20 to FS07; 26.07), 4 x Amplification of DelOP (FS_22 to FS13; 25.07) after cutting; run at 100 V, 0.8 % gel (TAE)

4 x 20µL

Reaction I

what	µl
D. acidovorans DSM-39	1
FS_20: (1/10)	4
FS_07: (1/10)	4
Phusion flash Master Mix	10
DMSO	1

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	72 ↓ 0.5	5
	72	2:10
18	98	1
	70	5
	72	2:10
1	72	10min
1	12	inf

Results:

Amplification of DelFG did not work, several bands occured, one of these had the size of the intended product but purity of the PCR was not sufficient for Gibson Assembly
nethertheless bands were cut out and DNA purified using QIAquick Gel Extraction Kit for restriction digest
Does anyone know, why we are constantly repeating this totally deficient PCR?

Amplification from FS_6/FS_20/FS_21 to FS_24 (PRIMER FS_24 MIXED UP!)

run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06/FS_20/FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	1:20
1	72	7 min
1	10	inf

Results:

no PCR product occured since the wrong primers were used

28-07-2013

Amplification from FS_21 to FS_24; (PRIMER 24 was MIXED UP!)

2log ladder / FS21-FS24 60const / FS07-FS26 65const / FS07-FS26 68const / FS24-FS26 65const / FS24-FS26 68const; run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	2:30
1	72	8 min
1	12	inf

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:30
1	72	8 min
1	12	inf

Results:

no PCR product occured since the wrong primers were used

Amplification and purification of Del Genes from D. acidovorans DSM-39 genome

Goals

Our goal still remains to amplifiy the missing fragments from the Delftibactin cluster of D. Acidovorans. However, since we want to validate all fragments before we use them in a Gibson Assembly, and since last weeks restriction digests were either negative or inconclusive, these digests will be repeated. By the end of this week we will dicuss the further procedure and decide whether we again need to change our cloning strategy or not. Additionally a nested PCR of the sequence region surrounding DelOP might still be an option to provide specific template suitable for a PCR with our intended Gibson primers.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-F	Primer FS_02 and FS_05
	DelA-G	Primer FS_02 and FS_26
	DelF-G	Primer FS_06 and FS_26
		Primer FS_20 and FS_26
		Primer FS_21 and FS_26
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13_short

Test restriction digests of PCR amplified fragments
Fragment	Primer	Digestion enzyme	Expected bands [bp]
DelA-E	Primer FS_02 and FS_03	BglII	2146, 1862, 1306
DelA-F	Primer FS_02 and FS_05	BglII	7229, 2146, 1862
DelF-G	Primer FS_21 and FS_26	XmaI	4268, 1202
DelG	Primer FS_08 and FS_23	ClaI	3291, 1936, 1303
DelO-P	Primer FS_22 and FS_13	EcoRI-HF	1883, 960

29-07-2013

Restriction digest of fragment FS_02 to FS_03 (5.3 kb; 27-07-2013; II) with BglII

Test restriction digest (29.07); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 h

what	µL
FS_02 to FS_03 (27-07-2013; II)	15
BglII	1
Buffer 3.1	2
dd H₂O	2
Expected fragment lengths [bp]	2146, 1862, 1306

Results:

Restriction digest shows the expected product sizes
indicator for correct amplicon but to be sure, PCR product will be prepared for single read sequencing by GATC

29-07-2013

Restriction digest of fragment FS_02 to FS_05; 11.2 kb; 27-07-2013 with BglII

Test restriction digest (29.07); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 hours

what	µL
FS_02 to FS_05 (27-07-2013)	15
BglII	1
Buffer 3.1	2
dd H₂O	2
Expected fragment lengths [bp]	7229, 2146, 1862

Results:

Test restriction digest worked out as predicted

30-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of Del A-G under different conditions and DelAF; run at 100 V 0.8% agarose gel (TAE)

2 reactions 200nM/400nM Primers

Reaction

what	µL 2nd PCR
D. acidovorans DSM-39	1
FS_02 (1/10)	5/2.5
FS_05 (1/10)	5/2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	11.5/16.5

Conditions

Biorad MyCycler*
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification did not work properly, as there were several unspecific bands. However we still had product.

30-07-2013

Amplification from FS_02 to FS_26; 16.7 kb

Amplification of Del A-G under different conditions and DelAF; run at 100 V 0.8% agarose gel (TAE)

4 reactions, 68°C Touchdown and 65°C constant with 200nM and 400nM Primers

Reaction

what	µl
D. acidovorans DSM-39	1
FS_02: (1/10)	2/4
FS_26: (1/10)	2/4
Phusion flash Master Mix	10
DMSO	1
dd H₂O	0/4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	5:40
1	72	12 min
1	10	inf

Conditions II

Biometra TProfessional Basic
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	5:40 min
18	98	1
	66	5
	72	5:40 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAG did not work, neither annealing at 65°C constant nor a touchdown starting from 68°C led to the desired product

29-07-2013

Restriction digest of fragment FS_08 to FS_23; 6.5 kb; 23-07-2013 with ClaI

Test restriction digest (29-07); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 hours

what	µl
FS_08 to FS_23 (2) (23-07-2013)	15
ClaI	1
Buffer CutSmart	2
dd H₂O	2
Expected fragment lengths [bp]	3291, 1936, 1303

Results:

Restriction digest of DelG (FS_08 to FS_23) was successful all predicted bands are clearly visible

30-07-2013

Re-PCR of DelOP FS_22 to FS_13; 2.7 kb; 19-07-2013

Re-PCR OP, Restriction digest OP with EcoRI; run at 100 V, 0.8 % gel (TAE)

3x20µl

Reaction

what	µl
Fragment FS_22 to FS_13_short (19-07-2013)	1
FS_22: (1/10)	2
FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP did not work
PCR will be repeated with different primer concentrations to estimate whether primer dimes might be the reason for insufficient amplification

Restriction digest of fragment FS_22 to FS_13; 2.7 kb; 25-07-2013 with EcoRI-HF

Re-PCR OP, Restriction digest OP with EcoRI; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for

what	µl
FS_22 to FS_13long(25-07-2013)	17
EcoRI	1
Buffer CutSmart	2
Expected fragment lengths [bp]	1883, 960

Amplification from FS_22 to FS_13s; 2.7 kb

Amplification of Del O-P from FS_22 to FS_13long/FS_13short under different conditions run at 100 V 0.8% agarose gel (TAE

Gel after excision

2x20µl

Reaction

what	µl
D.acidovorans	1
FS_22: (1/10)	4
FS_13_short: (1/10)	4
Phusion flash Master Mix	10
dd H₂O	1

20µl

Reaction

what	µl
D.acidovorans	1
FS_22: (1/10)	2
FS_13_short: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP resulted in a small band atthe desired lenght, but also a smear and several unexpected bands
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
amplicon will be used for restriction digest to validate the construct

Amplification from FS_22 to FS_13(s/l); 2.7 kb

Reaction

what	µl
D.acidovorans	1
FS_22: (1/10)	2
FS_13_short/FS_13_long: (1/10)	2
Phusion flash Master Mix	10
DMSO	1/-
dd H₂O	4/5

Conditions

Biorad C1000 Touch
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	1:00
1	72	5 min
1	12	inf

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	70	5
	72	1:00
1	72	5 min
1	12	inf

01-08-2013

Amplification from FS_22 to FS_13(s); 2.7 kb

Amplification of DelOP(FS22 to FS13short/long; 02.08); run at 100 V, 0.8 % gel (TAE)

Reaction

what	µl
D.acidovorans DSM-39	1
FS_22: (1/10)	2
FS_13_short/FS_13_long: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	92	5
	91	5
	90	5
	89	5
	88	5
	87	5
	86	5
	85	5
	84	5
	82	5
	80	5
	78	5
	76	5
	74	5
	72	5
	70	5
	68	5
	66	5
	64	5
	62	5
	60	5
	72	1:00
1	72	5 min
1	8	inf

Results:

Amplification of DelOP did not work with stepwise cooling to the intended annealing temperature of 60°C

07-08-2013

Amplification from FS_22 to FS_13; 2.7 kb

Amplifcation of DelOP and DelL (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelOP and DelL (07.08), cut

Reaction

what	µl
D. acidovorans SPH-1	1
FS_22: (1/10)	2
FS_13: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65 ↓ 0.5	5
	72	1:00
18	98	1
	63	5
	72	1:00
1	72	5min
1	12	inf

Amplification from FS_22 to FS_13; 2.7 kb

Amplifcation of DelOP (55°C) (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelOP (55°C) (07.08)

Reaction

what	µl
D. acidovorans SPH-1	1
FS_22: (1/10)	2
FS_13: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	5

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	1:00
1	72	5min
1	12	inf

Results:

Amplification of DelOP led to a band of the desired size as well as a smear and several different sideproducts
Band was cut out and DNA purified using QIAquick Gel Extraction Kit to be restriction digested for validation of the PCR product
Amplification will be repeated at lower temperature to obtain more product

29-07-2013

Amplification from FS_21 to FS_24 ; (WRONG PRIMER!)

Amplifications of DelFG (29.07); run at 100 V, 0.8 % gel (TAE)

Amplifications of DelFG (29.07) cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	2:30
1	72	8 min
1	12	inf

Results:

PCR product occured, though wrong primers were used, unspecific binding of primers in the genome of D. Acidovorans is the putative reason for this event

Amplification from FS_21 to FS_24; (WRONG PRIMER!)

Amplification of DelFG (FS21 to FS26; 29.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelFG (FS21 to FS26; 29.07) cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	2:30
1	72	8 min
1	12	inf

Results:

PCR product occured, though wrong primers were used, unspecific binding of primers in the genome of D. Acidovorans is the putative reason for this event

Amplification from FS_21 to FS_24; (WRONG PRIMER!)

Amplification of DelFG (FS21 to FS26; 29.07); run at 100 V, 0.8 % gel (TAE)

Amplification of DelFG (FS21 to FS26; 29.07) cut

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_24: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
35	98	1
	60	5
	72	2:30
1	72	8 min
1	12	inf

Results:

PCR product occured, though wrong primers were used, unspecific binding of primers in the genome of D. Acidovorans is the putative reason for this event

Amplification from FS_06/FS_20/FS_21 to FS_26 ; 5.5 kb

Amplifications of DelFG (29.07); run at 100 V, 0.8 % gel (TAE)

Amplifications of DelFG (29.07) cut

3x20µl

Reaction

what	µl
D. acidovorans DSM-39	1
FS_06 or FS_20 or FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	64	5
	72	2:15
1	72	10 min
1	10	inf

Results:

PCR product occured, though wrong primers were used, unspecific binding of primers in the genome of D. Acidovorans is the putative reason for this event
Furthermore, amplification with FS_21 to FS_26 led to the intended product and satisfying specifity
Amplification will be repeated at the same annealing temperature to obtain the amount of PCR product required for Gibson Assembly
Amplfication will be repeated at lower annealing temperature to increase the yield
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

30-07-2013

Amplification from FS_21 to FS_26 ; 5.5 kb

Amplification of DelFG (FS21 to FS26; 30.07) at 60°C and 64°C; run at 100 V, 0.8 % gel (TAE)

Amplification of DelFG (FS21 to FS26; 30.07) cut

3x20µl with conditions I, 2x20µl with conditions II

Reaction

what	µl
D. acidovorans DSM-39	1
FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	64	5
	72	2:15
1	72	10 min
1	10	inf

Conditions II

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:15
1	72	10 min
1	10	inf

Results:

Amplification of DelFG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
restriction digest with XmaI will be conducted to validate the PCR product

31-07-2013

Restriction digest of fragment FS_21 to FS_26 (5.5 kb; 29-07-2013) with XmaI

Restriction digest of FS21 to FS26 (29.7) with XmaI; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 hours

what	µl
FS_21 to FS_26 (29-07-2013)	17
XmaI	1
Buffer CutSmart	2
Expected fragment lengths [bp]	4268, 1202

Results:

Restriction digest of DelFG with XmaI did not lead to the expected result
digest will be carried out with a different enzyme, as the used one was outdated and digest might therefore not be very reliable

02-08-2013

Restriction digest of fragment FS_21 to FS_26 (5.5 kb; 30-07-2013) with ClaI

Restriction digest of FS21 to FS26 (30.7) with ClaI; run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 3 hours

what	µl
FS_21 to FS_26 (30-07-2013)	~15
ClaI	1
Buffer CutSmart	2
Expected fragment lengths [bp]	2743, 1519, 1208

Results:

Restriction digest of DelFG did not display any product
digest will be repeated with higher amount of DNA after new amplification from the genome of D. Acidovorans

07-08-2013

Amplification from FS_21 to FS_26 ; 5.5 kb

Amplifcation of DelAF(I), DelFG, DelG (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelAF(I), DelFG, DelG (07.08), cut

Reaction

what	µl
D. acidovorans SPH-1	1
FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:15
1	72	10 min
1	10	inf

Results:

Amplification of DelFG was successful, gel displays highly specific product of convincing yield
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
restriction digest with ClaI will be conducted to validate PCR product

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_35/SR_01 used for assembly of the desired genes from the D. acidovorans genome and the partsregistry backbone pSB4K5 .

Primers designed for a nested PCRs of the fragment DelO-P. The primers are shown on the Del-cluster as they are no more situated in DelO or DelP.

As already indicated last week, we decided to order another primer for the sequence region of DelF-G, beeing the primer FS_35_SR_01. This primer shows significantly better secondary structures and therefore annealing should be better. Furthermore we ordered various primers suitable for a nested PCR of DelOP.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_35: DelG_fw	2013-08-05	Amplification of DelG from Delftia acidovorans Gibson Primer	CATGCAGATCATCGTGGATGAATTC

Cultivation of D. acidovorans substrain SPH-1

Single read sequencing of several PCR products obtained so far was carried out by GATC. We aligned the so obtained sequences to the SPH-1 reference genome. (6.8 Mbp, [http://www.ncbi.nlm.nih.gov/genome/659 NCBI Genome]). Our alignments revealed significant differences between the two D. acidovorans strains: DSM-39 which we used as PCR template and SPH-1 based on which we have designed all PCR primers. As result of this sequence analysis, the strain D. acidovorans SPH-1 was ordered in order to have a suitable template for the primers we already designed and ordered so far. We hoped, that haveing the right strain at hand now, our PCRs should work better and we could hopefully proceed with the Gibson assembly soon. Lyohilized D. Acidovorans SPH-1 cells obtained from DSMZ were reactivated with Reactivation_medium and cultivated in Acidovorax complex medium according to the recoomondations by the DSMZ. Subsequently, liquid culture were inocculated (for glycerol stocks) and bacteria were also spread onto ACM-agar plates. Then we repeated our PCRs either by doing colony-PCR from colonies on the ACM-agar plates or by using 1µL of glycerol stock as template.

Amplification of Del Genes from D. acidovorans SPH-1 genome

Goals

Since we wanted to ensure that our amplicons fit the intended sequence and avoid any mutations resulting from primer missmatches all PCRs were repeated (even the previously successful ones), now using D. Acidovorans SPH-1 as template. Established PCR protocols will be repeated with the new strain as template and adopted if necessary. For the DelF-G fragment with which we have had problems before, we will try whether PCRs work better with the new template or the recently ordered primer FS_35/SR_01. The amplification of DelO-P will be repeated with the intially ordered Primers FS_22 and FS_13 to test whether the changed template also improves these PCRs. If it turns out, that primers are still not able to bind to the intended template, the abovementioned nested PCR strategy will be conducted as primers FS_27 to FS_33 also arrived this week.

Results

PCRs from D.acidovorans SPH-1
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	Primer FS_02 and FS_03
	DelA-F	Primer FS_02 and FS_05
	DelA-G	Primer FS_02 and FS_23
		Primer FS_02 and FS_11
		Primer FS_02 and FS_26
	DelF-G	Primer FS_21 and FS_26
	DelG	Primer FS_08 and FS_23
	DelG	Primer SR_01 and FS_23
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13
		Primer FS_22 and FS_13_short
		Primer FS_22 and FS_27
		Primer FS_33 and FS_13_short
		Primer FS_33 and FS_27
		Primer FS_31 and FS_29
		Primer FS_31 and FS_30
		Primer FS_32 and FS_29
		Primer FS_32 and FS_30
		Primer FS_22 and FS_28
		Primer FS_22 and FS_29
	DelL	Primer FS_14 and FS_15
pSB4K5	pSB4K5	Primer FS_01 and FS_16

Test restriction digests of PCR amplified fragments
Fragment	Primer	Digestion enzyme	Expected bands
DelF-G	Primer FS_21 and FS_26	ClaI	2743, 1519, 1208
DelF-G	Primer FS_21 and FS_26	BglII	5500
DelG	Primer FS_08 and FS_23	ClaI	3415, 3115
DelO-P	Primer FS_22 and FS_13	EcoRI-HF	1883, 960

07-08-2013

Sequencing Results

We send the following samples (amplified fragments of D. acidovorans DSM-39 and backbone pSB4K5 from the partsregistry) to GATC for sequencing:

AE (FS_02-FS_03) with Primer FS_02
AE (FS_02-FS_03) with Primer FS_03

Alignment of DelAE(FS_02 to FS_03) with Primer FS_02

Alignment of DelAE(FS_02 to FS_03) with Primer FS_03

08-08-2013

Amplification from FS_02 to FS_03; 5.3kb

Amplifcation of DelAE and DelEF and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µL
D. acidovorans SPH-1	1
FS_02: (1/10)	4
FS_03: (1/10)	4
Phusion flash Master Mix	10

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	1:30
1	72	7min
1	12	inf

Results:

Amplification of DelAE was repeated successfully with the new strain SPH-1
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
if fragment is used in Gibson assembly the amplification has to be repeated to increase the amount of product

07-08-2013

Amplification I from FS_02 to FS_05; 11.2 kb

Amplifcation of DelAF(I), DelFG, DelG (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelAF(I), DelFG, DelG (07.08), cut

Reaction

what	µL
D. acidovorans SPH-1	1
FS_02 (1/10)	2.5
FS_05 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biometra TProfessional Basic
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAF did not work
Repeat amplification in case any errors were made

Amplification II from FS_02 to FS_05; 11.2 kb

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII; run at 100 V, 0.8 % gel (TAE)(07.08)

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII cut; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µL
D. acidovorans SPH-1	1
FS_02 (1/10)	2.5
FS_05 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler*
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAF did not work as no product appeared, therefore conditions of PCR have to be optimized
as extremely long amplicons in the past were usually easier to amplify from agar plate (colony PCR) the same conditions will be tried on the colony as template

08-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplifcation of DelAF and DelG; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µL
D. acidovorans SPH-1 (from agarplate)	1
FS_02 (1/10)	2.5
FS_05 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler*
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	4	inf

Results:

Amplification of DelAF did not work as no product appeared, therefore conditions of PCR have to be optimized
PCR will be repeated with glycerol stock as template

09-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplifcation of DelOP (I), DelFG and DelL ; run at 100 V, 0.8 % gel (TAE)(09.08)

Reaction

what	µL 2nd PCR
D. acidovorans SPH-1 (glycerol stock)	1
FS_02 (1/10)	2.5
FS_05 (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	3 min
18	98	1
	66	5
	72	3 min
1	72	10 min
1	10	inf

Results:

Amplification of DelAF did not work as no product appeared, therefore conditions of PCR have to be optimized
PCR will be repeated with a higher annealing temperature as primers might not have bound due to secondary structes
PCR will be repeated with lower annealing temperatue as primers might not have bound due to high temperatures

10-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplifcation of DelOP and DelAF ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation of DelOP and DelAF after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	2 µL FS_02	4 µL FS_02
Primer rev	2 µL FS_05	4 µL FS_05
Phusion flash Ready Mix	10 µL
dd H₂O	1 µL	-

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	3:15
1	72	10 min
1	10	inf

Results:

Amplification of DelAF did not work at a temperature of 58°C constant
as primers might not have been bound at this low temperatue but neither bound at a temperature of 68°C (touchdown or constant), PCR will be repeated at a temperature of 65°C as touchdown and at constant annealing

Amplification II + III from FS_02 to FS_05; 11.2 kb

Amplifcation of DelAF (02-05) and DelAG (2-26), (2-13), (2-11s) ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation of DelAF (02-05) and DelAG (2-26), (2-13), (2-11s) after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAF II + III
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µL FS_02
Primer rev	4.5 µL FS_05
DMSO	1 µL
Phusion Ready Mix	10 µL

Conditions

Biorad MyCycler
Cycles	temperature [°C] DelAF II	Time	Cycles	temperature [°C] DelAF III	Time
1	98	10 s	1	98	10 s
30	98	1 s	12	98	1 s
	98	1 s		65 ↓ 0.5	5 s
	65	5 s		72	3:15 min
	65	5 s	18	98	1 s
	72	3:15 min		66	5 s
	72	3:15 min		72	3:15 min
1	72	10 min	1	72	10 min
1	10	inf	1	10	inf

Results:

Amplification of DelAF from the new strain finally worked, both conditions (65°C constant and 65°C touchdown) led to specific product but the touchdown PCR resulted in a smear
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
PCR will be repeated with a slightly lower temperature with constant annealing to increase yield but avoid the smear which appeared due to the low annealing temperatures used in the last cycles of the touchdown PCR.

11-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelAF @62°C const., Re-PCR of DelAG with 1:10 and 1:20 deluted Template from 10.08; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplification of DelAF @62°C const., Re-PCR of DelAG with 1:10 and 1:20 deluted Template from 10.08 after cutting; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µL FS_02
Primer rev	4.5 µL FS_05
Phusion Ready Mix	10 µL

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	62	5
	72	3:15
1	72	10 min
1	10	inf

Results:

Amplification of DelAF worked out though again a smear and several other bands appeared
bands were cut out very precise to avoid carry over of any unwanted amplicon and DNA purified using QIAquick Gel Extraction Kit
gradient PCR will be carried out to determine optimal annealing temperature of primers and thereby obtain product of higher specificity suitable for gibson assembly

07-08-2013

Amplification from FS_02 to FS_26; 16.7 kb

Amplifcation of DelAG (FS02-FS26), (FS02-FS11), (FS02-FS23); run at 100 V, 0.8 % gel (TAE)(07.08)

Amplifcation of DelAG; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µl
D. acidovorans SPH-1	1
FS_02: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	3:50
1	72	12 min
1	10	inf

Results:

Amplification did not work as expected, nethertheless band was cut out for further amplification with a Re-PCR or test restriction digest.

08-08-2013

Amplification from FS_02 to FS_23; 22.8 kb

Reaction I

what	µl
D. acidovorans SPH-1	1
FS_02: (1/10)	4
FS_23: (1/10)	4
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Reaction II

what	µl
D. acidovorans SPH-1	1
FS_02: (1/10)	4
FS_13short: (1/10)	4
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	6:40
1	72	12 min
1	10	inf

10-08-2013

Amplification from FS_02 to FS_26; 16.7 kb

Amplifcation of DelAF (02-05) and DelAG (2-26), (2-13), (2-11s) ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation of DelAF (02-05) and DelAG (2-26), (2-13), (2-11s) after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAG
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µl FS_02
Primer rev	4.5 µl FS_26
DMSO	1 µl
Phusion Ready Mix	10 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	5:20
18	98	1
	65	5
	72	5:20
1	72	10min
1	10	inf

Results:

Amplification of DelAG did not work no product was detectable
PCR will be repeated with different Primers

Amplification from FS_02 to FS_11_short; 22.8 kb and from FS_02 to FS_23; 22.8 kb

Amplifcation of DelAF (02-05) and DelAG (02-26), (02-13), (02-11s) ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation of DelAF (02-05) and DelAG (2-26), (2-13), (2-11s) after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAG
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µl FS_02	4.5 µl FS_02
Primer rev	4.5 µl FS_11_short	4.5 µl FS_23
DMSO	1 µl
Phusion Ready Mix	10 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	7:20
18	98	1
	65	5
	72	7:20
1	72	10min
1	10	inf

Results:

Amplification of DelAG did not work no product was detectable, therefore a Re-PCR using the amplification of DelAG from 10-08-13 will be conducted

11-08-2013

Re-PCR from FS_02 to FS_11; 22.8 kb; 10-08-2013

Amplification of DelAF @62°C const., Re-PCR of DelAG with 1:10 and 1:20 deluted Template from 10.08; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplification of DelAF @62°C const., Re-PCR of DelAG with 1:10 and 1:20 deluted Template from 10.08 after cutting; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelAG
Template	PCR-Product FS02-FS11s from 10-08-2013
Primer fw	4.5 µl FS_02
Primer rev	4.5 µl FS_11
Phusion Ready Mix	10 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	7:20
18	98	1
	65	5
	72	7:20
1	72	10min
1	10	inf

Results:

Amplification of DelAG did not work, therefore the template used for the Re-PCR presumably was not the desired amplicon

08-08-2013

Amplification from FS_04 to FS_05; 6 kb

Amplifcation of DelAE and DelEF and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µl
D. acidovorans SPH-1	1
FS_04: (1/10)	4
FS_05: (1/10)	4
Phusion flash Master Mix	10

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	58	5
	72	1:30
1	72	7min
1	12	inf

Results:

Amplification of DelEF worked, though several side products and a smear occured
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

07-08-2013

Amplification from FS_08 to FS_23; 6.5 kb

Amplifcation of DelAF(I), DelFG, DelG (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelAF(I), DelFG, DelG (07.08), cut

Reaction

what	µl
D. acidovorans SPH-1	1
FS_08: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
dd H₂O	4
DMSO	1

Conditions

Biorad MyCycler
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

Amplification from SR_01 to FS_23; 6.2 kb

Amplifcation of DelAF and DelG; run at 100 V, 0.8 % gel (TAE)(07.08)

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII; run at 100 V, 0.8 % gel (TAE)(07.08)

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII cut; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

what	µl
D. acidovorans SPH-1	1
SR_01: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

08-08-2013

Restriction digest of fragment SR_01 to FS_23; 6.2 kb; 07-08-2013 with BglII

Restriction digest of DelG (SR01-FS23), DelG (FS21-FS26) and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Incubation at room temperature for about 4h and at 37°C for 1 hours

what	µl
SR_01 to FS_23 (07-08-2013)	20
BglII	1
Buffer 3.1	3
dd H₂O	6
Expected fragment lengths [bp]	3415, 3115

Results:

Restriction digest of DelG (SR_01 to FS_23) worked out as predicted, PCR-fragment will be sequenced before potential Gibson Assembly

Concentration measurement

Fragment	Primer	Date PCR	Concentration
DelG	SR01-FS23	07-08-2013	34.9 ng/µl
DelG	FS08-FS23	07-08-2013	25.6 ng/µl

09-08-2013

Amplification from SR_01 to FS_23; 6.2 kb

Amplifcation of DelAF and DelG; run at 100 V, 0.8 % gel (TAE)(09.08)

Reaction

what	µl
D. acidovorans SPH-1	1
SR_01: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG did not work
Amplification will be repeated as the protocol was established and carried out successfully several times before, so a pipetting error might be the reason of the failure

08-08-2013

Amplification from FS_22 to FS_13, 2.7 kb

Amplifcation of DelAE and DelEF and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaktion

what	µl
D. acidovorans SPH-1 (colony-pcr)	1
FS_22: (1/10)	4
FS_13long: (1/10)	4
Phusion flash Master Mix	10

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	50	5
	72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP did not work
PCR will be repeated at a higher annealing temperature of 65°C to increase primer binding

Restriction digest of fragment FS_22 to FS_13; 2.7 kb; 07-08-2013) with EcoRI-HF

Restriction digest of DelG (SR01-FS23), DelG (FS21-FS26) and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Incubation at Room temperature for about 4h and at 37°C for 1 hours

what	µl
SR_22 to FS_13 (07-08-2013)	20
EcoRI-HF	1
Buffer CutSmart	3
dd H₂O	6
Expected fragment lengths [bp]	1883, 960

Results:

Restriction digest did not work, amplicon was not cut and total amount of DNA was probably too low
Restriction digest will be repeated as soon as PCR of DelOP works reliable and reproducable with higher amounts of DNA

Concentration measurement OP (07-08-2013)

Fragment	Primer	Date PCR	Concentration
DelOP	FS22-FS13	07-08-2013	6.1 ng/µl

09-08-2013

Amplification I from FS_22 to FS_13, 2.7 kb

Amplifcation of DelOP (I), DelFG and DelL ; run at 100 V, 0.8 % gel (TAE)(09.08)

Reaktion

what	µl
D. acidovorans SPH-1 (colony-pcr)	1
FS_22: (1/10)	4
FS_13long: (1/10)	4
Phusion flash Master Mix	10

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	65	5
	72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP did not work
PCR will be repeated at a lower annealing temperature of 55°C in case primers were not able to bind at high temperatures

Amplification II from FS_22 to FS_13; 2.7 kb

Amplifcation of DelOP (II), from glycerol stocks at 55°C const. ; run at 100 V, 0.8 % gel (TAE)(09.08)

wrong Primers were used

Reaktion

what	µl
D. acidovorans SPH-1 (colony-pcr)	1
FS_22: (1/10)	4
FS_13long: (1/10)	4
Phusion flash Master Mix	10

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP did not work as the wrong primers were used
Amplification will be repeated with different amounts of DMSO

Amplification III from FS_22 to FS_13; 2.7 kb

Amplifcation of DelOP (III), from agar plate at 55°C const. ; run at 100 V, 0.8 % gel (TAE)(09.08)

3 samples, one with, two without DMSO (one with much template, one with less template)

Reaktion

what	µl
D. acidovorans SPH-1 colony	1
FS_22: (1/10)	4
FS_13long: (1/10)	4
Phusion flash Master Mix	10
DMSO	0/1

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP did not work, neither with lower amount of template, nor with higher, furthermore the DMSO concentration did not influence the PCR for the given annealing temperature
PCR will be repeated with recently ordered new Primers which bind outside the intended template in the Del-Cluster of D. acidovorans SPH-1 in order to obtain a specific template suited for a nested PCR of DelOP with Primers FS_22 and FS_14l

10-08-2013

Amplification I, nested PCR different Primers; 2.7 kb

Amplifcation I of DelOP ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	4 µl FS_32	4 µl FS_32	4 µl FS_32	4 µl FS_32	4 µl FS_32
Primer rev	4 µl FS_13l	4 µl FS_27	4 µl FS_28	4 µl FS_29	4 µl FS_30
Phusion Ready Mix	10 µl
dd H₂O	1 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP did not work
PCR will be repeated as touchdown PCR with annealing starting at 68°C and different primer combinations to the template needed for the nested PCR of DelOP with primers FS_22 to FS_13l

Amplification II, nested PCR with different primers; 2.7 kb

Amplifcation II of DelOP ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation II of DelOP after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	4 µl FS_22	4 µl FS_22	4 µl FS_33	4 µl FS_33	4 µl FS_31	4 µl FS_31	4 µl FS_32	4 µl FS_32	4 µl FS_22	4 µl FS_22
Primer rev	4 µl FS_13s	4 µl FS_27	4 µl FS_13s	4 µl FS_27	4 µl FS_29	4 µl FS_30	4 µl FS_29	4 µl FS_30	4 µl FS_28	4 µl FS_29
DMSO	1 µl
Phusion Ready Mix	10 µl
dd H₂O	1 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:00
18	98	1
	65	5
	72	1:00
1	72	10min
1	12	inf

Results:

Amplification of DelOP worked with the Primer combinations FS22-FS13short, FS_22-FS_27, FS_33-FS_13short, FS_33-FS_27, FS_32-FS_30 and FS_22-FS28
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
all the obtained PCR products will be used as specific templates for a nested PCR using primers FS_22-FS_13long

Amplification III from FS_22 to FS_13; 2.7 kb

Amplifcation of DelOP and DelAF ; run at 135 V, 0.8 % gel (TAE)(10.08)

Amplifcation of DelOP and DelAF after cutting ; run at 135 V, 0.8 % gel (TAE)(10.08)

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	4 µl FS_22
Primer rev	4 µl FS_13l
DMSO	1 µl
Phusion Ready Mix	10 µl
dd H₂O	1 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	68 ↓ 0.5	5
	72	1:00
18	98	1
	65	5
	72	1:00
1	72	10min
1	10	inf

Results:

Amplification of DelOP did not work
hope and wait for the nested PCR

11-08-2013

Nested PCR of DelOP-Fragments from 10-08-2013

quantification of DelOP PCR-products from 10.08 after gel extraction to determine templates for followed nested PCR; run at 135 V, 0.8 % gel (TAE)(11.08)

Nested PCR of DelOP using specific PCR-products from 10.08; run at 135 V, 0.8 % gel (TAE)(11.08)

Reaction

Reagent	DelOP
Template	FS22-13s	FS31-30	FS33-27	FS22-28	FS22-13s	FS31-30	FS33-29
Primer fw	4.5 µl FS_22
Primer rev	4.5 µl FS_13l
DMSO	1 µl
Phusion Ready Mix	10 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C] Template FS22-13s, FS31-30, FS33-27, FS22-28	Time	Cycles	temperature [°C] Template FS22-13s, FS31-30, FS33-29, Time
1	98	10 s	1	98	10 s
30	98	1 s	12	98	1 s
	98	1 s		68 ↓ 0.5	5 s
	58	5 s		72	1:00 min
	58	5 s	18	98	1 s
	72	1:00 min		66	5 s
	72	1:00 min		72	1:00 min
1	72	5 min	1	72	5 min
1	10	inf	1	10	inf

Results:

Nested PCR of DelOP did not work, though concentrations of the used template were fine as checked previously
PCR will be with an annealing temperature of 55°C with the template obtained from the primer combination of FS_22-FS_13short as nested PCR

07-08-2013

Results Sequencing

Send the following samples (amplified fragments of D. acidovorans DSM-39 and backbone pSB4K5 from the partsregistry) to GATC for sequencing:

DelL (FS_14 to FS_15) with Primer FS_14
DelL (FS_14 to FS_15) with Primer FS_15

Alignment of DelL(FS_14 to FS_15) with Primer FS_14

Alignment of DelL(FS_14 to FS_15) with Primer FS_15

Amplification of DelL (FS_14 to FS_15; 1.4 kb)

Amplifcation of DelOP and DelL (07.08); run at 100 V, 0.8 % gel (TAE)

Amplifcation of DelOP and DelL (07.08), cut

Reaction

what	µl
D. acidovorans SPH-1	1
FS_14: (1/10)	2.5
FS_15: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	42
18	98	1
	63	5
	72	42
1	72	12 min
1	4	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

08-08-2013

Concentration measurement of DelL

Fragment	Primer	Date PCR	Concentration
DelL	FS14-FS15	07-08-2013	51 ng/µl

09-08-2013

Amplification of DelL (FS_14 to FS_15; 1.4 kb)

Amplifcation of DelOP (I), DelFG and DelL ; run at 100 V, 0.8 % gel (TAE)(09.08)

Reaction

what	µl
D. acidovorans	1
FS_14: (1/10)	2.5
FS_15: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler*
Cycles-PCR	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	42
18	98	1
	63	5
	72	42
1	72	12 min
1	10	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

07-08-2013

Results Sequencing

Send the backbone pSB4K5 from the partsregistry to GATC for sequencing:

pSB4K5 with Primer FS_01
pSB4K5 with Primer FS_16

Alignment of pSB4K5(FS_01 to FS_16) with Primer FS_01

Alignment of pSB4K5(FS_01 to FS_16) with Primer FS_16

Results:

The sequence is the same as expected and indicated in the partsregistry.

Amplification from FS_01 to FS_16; 4.2 kb

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII; run at 100 V, 0.8 % gel (TAE)(07.08)

Amplifcation of DelG (SR01-FS23), pSB4K5 and DelAFII cut; run at 100 V, 0.8 % gel (TAE)(07.08)

Reaction

(2x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad T100
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	62 ↓ 0.5	5
	72	1:30 min
18	98	1
	60	5
	72	1:30 min
1	72	5 min
1	8	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

08-08-2013

Concentration measurement

The concentration of the gel purified fragment was measured using a NanoDrop Instrument.

Fragment	Primer	Date PCR	Concentration
pSB4K5	FS16-FS01	07-08-2013	55.9 ng/µl

08-08-2013

Restriction digest of fragment from FS_21 to FS_26; 5.5 kb; 29-07-2013) with ClaI

Restriction digest of DelG (SR01-FS23), DelG (FS21-FS26) and DelOP; run at 100 V, 0.8 % gel (TAE)(07.08)

Incubation at Room temperature for about 4h and at 37°C for 1 hours

what	µl
FS_21 to FS_26 (29-07-2013)	10
ClaI	1
Buffer CutSmart	1.5
dd H₂O	2.5
Expected fragment lengths [bp]	2743, 1519, 1208

Results:

restriction digest of DelFG led to the expected fragment sizes, therefore restriction digest, implies amplification of the correct fragment
PCR product will be further validated by single read sequencing before Gibson Assembly

Concentration measurement DelFG

Fragment	Primer	Date PCR	Concentration
DelFG	FS21-FS26	07-08-2013	24.3 ng/µl

09-08-2013

Amplification from FS_21 to FS_26; 5.5 kb

Amplifcation of DelOP (I), DelFG and DelL ; run at 100 V, 0.8 % gel (TAE)(09.08)

Reaction

what	µl
D. acidovorans SPH-1 (colony-pcr)	1
FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions I

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:15
1	72	10 min
1	10	inf

Results:

Amplification of DelFG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

Strategy

Vector map of including Primers FS_01 to FS_16 used for assembly of the desired genes from D. acidovorans and the partsregistry backbone pSB4K5 .

Most PCRs have worked!! Yeah- finally!!! Thus, all the fragments needed for Gibson assembly are now available, however yields are still suboptimal for some of the fragments amplified. Furthermore, we designed screening primers for our final construct pFSN. These primers will be used to analyze our transformed bacteria for presence of the complete DelRest construct pFSN by colony-PCR.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_47_screening_BB_AF_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	GTTGGCCGATTCATTAATGC
FS_48_screening_BB_AF_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	TAACGGTATCGGTATCGCTTTG
FS_49_screening_AFI_AFII_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	GTTTCTCTGGAAGATGGATAC
FS_50_screening_AFI_AFII_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	GTTGACGAAAAAGCCGACCAC
FS_51_screening_AF_FG(21-26)_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	TGGATATCGACTGGACTGCCTG
FS_52_screening_AF_FG(21-26)_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	TGCACCACATCGACGAAACGG
FS_53_screening_FG(21-26)_G_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	GTACGGCCTATCACATCAGCG
FS_54_screening_FG(21-26)_G_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	GAACCTGGGTGTTCACGAAAAAGCC
FS_55_screening_G_OP_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	GTATCTCTACATGCATCGCTAC
FS_56_screening_G_OP_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	AGGACATTTTCCGCACCCCG
FS_57_screening_G_OP_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	GCTGGCGTTTTCCATAAG
FS_58_screening_OP_L_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	GAACAACTTCCAGCACAGCCTGTTC
FS_59_screening_OP_L_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	CGTTGAAGATTTCGTTGACG
FS_60_screening_L_BB_fw	2013-08-02	Primer for screening/sequencing of pFSN construct	CATCTTCAAGGTGTTCTATGAAC
FS_61_screening_L_BB(with_mRFP)_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	CAGTTTAACTTTGTAGATGAAC
NK_01_FS_62_screening_L_BB(without_mRFP)_rv	2013-08-02	Primer for screening/sequencing of pFSN construct	GTTCACCGACAAACAACAGATAAAACG

Amplification and purification of Del Genes from SPH-1

Goals

As we were able to establish amplification protocols for most of our desired amplicons by the end of last week, we will repeat these PCRs to obtain the required amounts and concentrations. Furthermore we will optimize the PCR conditions of DelO-P by using higher annealing temperatures, hopefully inhibiting secondary structe formation of the primers. Afterwards we will assemble our construct, transform it into E.Coli DH10B and screen for (hopefully many) positive clones using the recently ordered screening primers.

Results

PCRs from D.acidovorans SPH-1
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-F	Primer FS_02 and FS_05
	DelA-G	Primer FS_02 and FS_11
	DelA-G	Primer FS_02 and FS_11_short
	DelF-G	Primer FS_21 and FS_07
	DelF-G	Primer FS_21 and FS_26
	DelG	Primer SR_01 and FS_23
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13_short
DelO DelP DelL	DelO-P	Primer FS_22 and FS_13

Test restriction digests of PCR amplified fragments
Fragment	Primer	Digestion enzyme	Expected bands
DelO-P	Primer FS_22 and FS_13	EcoRI-HF	1883, 960

12-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelAF using gradient PCR, Amplification of DelOP 72°C 2-step; run at 135 V, 0.8 % gel (TAE)(11.08)

Amplification of DelAF using gradient PCR, Amplification of DelOP 72°C 2-step after cutting; run at 135 V, 0.8 % gel (TAE)(11.08)

Reaction

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µL FS_02
Primer rev	4.5 µL FS_05
DMSO	1 µL
Phusion Ready Mix	10 µL

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	67.5 - 65.0 (ΔT = 0.5) ↓ 0.5	5
	72	3:20
18	98	1
	65.5 - 63.0 (ΔT = 0.5)	5
	72	3:20
1	72	10min
1	10	inf

Results:

Amplification of DelAF worked well, gradient displays an optimal annealing temperature of 65.5°C, which will be used for further amplifications
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

13-08-2013

Restriction digest of fragment FS_02 to FS_05; 11.2 kb; 12-08-2013 with EcoRI-HF

Incubation at 37°C for 2 hours

what	µL
FS_02 to FS_05 (12-08-2013)	20
EcoRI-HF	1
CutSmart Buffer	2.5
dd H₂O	1.5

Expected fragment sizes: 2.26kbp; 4.62kbp; 4.32kbp

Results:

Weak bands of about 4.6kbp visible, as well as on of about 2.6kbp
digest will be repeated using higher concentrations of DNA to clearify results of restriction digest

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelAF (FS_02-FS_05); run at 100 V, 0.8 % gel (TAE)(13.08)

Amplification of DelAF (FS_02-FS_05), cut; run at 100 V, 0.8 % gel (TAE)(13.08)

Reaction

1 sample contains 2µL of DMSO

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µL FS_02
Primer rev	4.5 µL FS_05
DMSO	1 µL
Phusion Ready Mix	10 µL

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65.5 ↓ 0.5	5
	72	3:20
18	98	1
	63.5	5
	72	3:20
1	72	10min
1	10	inf

Results:

Amplification of DelAF worked though a slight smear occured, therefore PCR will be repeated on the more precise Biometra TProfessional Basic cylcer again
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

14-08-2013

Concentration measurement (FS_02 to FS_05; 11.2 kb)

Fragment	Primer	Date PCR	Concentration
DelAF	FS02-FS05	11-08-2013	~10 ng/µL
DelAF	FS02-FS05	12-08-2013	0 ng/µL
DelAF	FS02-FS05	12-08-2013	0 ng/µL

Results:

concentrations are not sufficient for gibson assembly
PCR will be repeated and gel slices of different reactions will be pooled for one gel extraction using QIAquick Gel Extraction Kit to obtain the concentrations needed for gibson assembly

Restriction digest of fragment FS_02 to FS_05; 11.2 kb; 11-08-2013 with EcoRI-HF

Test restriction digest of fragment FS_02-FS_05 (12-08) with EcoRI; run at 100 V, 0.8 % gel (TAE)(13.08)

Incubation at 37°C for 2 hours 45min

what	µL
FS_02 to FS_05 (11-08-2013)	18
EcoRI-HF	1
CutSmart Buffer	2.5
dd H₂O	3.5

Expected fragment sizes: 2.26kbp; 4.62kbp; 4.32kbp

Results:

One band of about 5kbp and one of 2.5kbp
no clear result, digest will be repeated with another enzyme (ClaI), as the enzyme used was beyond expiration date

Restriction digest of fragment FS_02 to FS_05; 11.2 kb; 10-08-2013 with ClaI

Test restriction digest of fragment FS_02-FS_05 (12-08) with ClaI; run at 100 V, 0.8 % gel (TAE)(14.08)

Incubation at 37°C for 2 hours

what	µL
FS_02 to FS_05 (10-08-2013)	20
ClaI	1
CutSmart Buffer	2.5
dd H₂O	1.5

Expected fragment sizes: 6.9kbp, 4.3kbp

Results:

restriction digest displays the expected fragments, therefore amplification of the desired fragment can be assumed
PCR product will be prepared for sequencing by GATC to proof amplification of the desired DNA sequence before Gibson Assembly

17-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelAF (17-08); run at 100 V, 0.8 % gel (TAE)

Amplification of DelAF, cut (17-08); run at 100 V, 0.8 % gel (TAE)

Reaction of DelAF

6x20 µL

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	2.5 µL FS_02
Primer rev	2.5 µL FS_05
Phusion Ready Mix	10 µL
DMSO	1 µL
dd H₂O	4 µL

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65.5 ↓ 0.5	5
	72	3:20
18	98	1
	63.5	5
	72	3:20
1	72	10min
1	10	inf

Results:

Amplification of DelAF worked
bands were cut out, pooled and DNA purified using QIAquick Gel Extraction Kit to obtain concentrations needed for gibson assembly

18-08-2013

Amplification from FS_02 to FS_05; 11.2 kb

Amplification of DelAF (18-08); run at 100 V, 0.8 % gel (TAE)

Amplification of DelAF, cut (18-08); run at 100 V, 0.8 % gel (TAE)

Reaction of DelAF

6x20 µL

Reagent	DelAF
Template	D.acidovorans SPH-1 colony
Primer fw	2.5 µL FS_02
Primer rev	2.5 µL FS_05
DMSO	1 µL
Phusion Ready Mix	10 µL
dd H₂O	4 µL

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	65.5 ↓ 0.5	5
	72	3:20
18	98	1
	63.5	5
	72	3:20
1	72	10min
1	10	inf

Results:

Amplification of DelAF worked
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

12-08-2013

Amplification from FS_02 to FS_11; 22.8 kb

Amplification of DelAG (12-08-13); run at 100 V, 0.8 % gel (TAE)

Reaction

Reagent	DelAG
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µl FS_02
Primer rev	4.5 µl FS_11
DMSO	1 µl
Phusion Ready Mix	10 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	72.0 - 67.0 (ΔT = 0.5) ↓ 0.5	5
	72	7:20
18	98	1
	70.0 - 65.0 (ΔT = 0.5)	5
	72	7:20
1	72	10min
1	10	inf

Results:

none of the amplifications led to yields of DNA sufficient for Gibson Assembly, therefore the used combination of primers seems not to be sufficient for amplification of 22.0 kbp

13-08-2013

Amplification from FS_02 to FS_11_short; 22.8 kb

Reaction

Reagent	DelAG
Template	D.acidovorans SPH-1 colony
Primer fw	4.0 µl FS_02
Primer rev	4.0 µl FS_11_short
DMSO	2 µl
Phusion Ready Mix	10 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	72.0 - 67.0 (ΔT = 0.5) ↓ 0.5	5
	72	7:20
18	98	1
	70.0 - 65.0 (ΔT = 0.5)	5
	72	7:20
1	72	10min
1	10	inf

15-08-2013

Amplification from SR_01 to FS_23; 6.2 kb

Amplification of DelG; run at 100 V, 0.8 % gel (TAE)(14.08)

Reaction (5x20 µl)

what	µl
D. acidovorans SPH-1 colony	1
SR_01: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG was successful
Bands were cut out and DNA purified using QIAquick Gel Extraction Kit
Amplification will be repeated to increase the concentration for the Gibson Assembly

16-08-2013

Concentration measurement

the fragment was gel purified

Fragment	Primer	Date PCR	Concentration
DelG	SR01-FS23	15-08-2013	52.6 ng/µl
DelG after nucleotide removal	SR01-FS23	15-08-2013	30 ng/µl

Amplification from SR_01 to FS_23; 6.2 kb

Amplification of DelG ; run at 100 V, 0.8 % gel (TAE)(14.08)

Reaction (5x20 µl)

what	µl
D. acidovorans SPH-1 colony	1
SR_01: (1/10)	2
FS_23: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
12	98	1
	66 ↓ 0.5	5
	72	3:20
18	98	1
	64	5
	72	3:20
1	72	10min
1	12	inf

Results:

Amplification of DelG was successful
Bands were cut out and DNA purified using QIAquick Gel Extraction Kit

12-08-2013

Amplification I from FS_22 to FS_13; 2.7 kb

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony	1µl FS_22-FS_13_short 10-08
Primer fw	2 µl FS_22
Primer rev	2 µl FS_13
Phusion Ready Mix	10 µl
dd H₂O	5 µl

Conditions

Biorad MyCycler*
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	55	5
	72	1:00
1	72	5min
1	10	inf

Results:

Amplification of DelOP did not work
PCR will be repeated at very high annealing temperatures to ensure that primers with very complex secondary structure such as the Gibson-Primer FS_13long are able to bind

Amplification II and III from FS_22 to FS_13; 2.7 kb

Amplification of DelOP III .; run at 100 V, 0.8 % gel (TAE)(12.08)

Amplification of DelOP 72°C const.; run at 135 V, 0.8 % gel (TAE)(11.08)

Amplification of DelOP 72°C const. after cutting; run at 135 V, 0.8 % gel (TAE)(11.08)

Reaction

Reagent	DelOP
Template	1µl FS_22-FS_13_short 10.08
Primer fw	4 µl FS_22
Primer rev	4 µl FS_13
Phusion Ready Mix	10 µl
DMSO	1 µl

Conditions

Biorad MyCycler
Cycles	temperature [°C] DelOP II	Time	Cycles	temperature [°C] DelOP III	Time
1	98	10 s	1	98	10 s
30	98	1 s	12	98	1 s
	98	1 s		74.0 - 70.0 (ΔT = 2.0) ↓ 0.5	5 s
	72	1:00 min		72	3:15 min
			18	98	1 s
				66	5 s
				68 / 70 / 72	1:00 min
1	72	10 min	1	72	10 min
1	10	inf	1	10	inf

Results:

Amplification of DelOP was successful, 2-step PCR with FS_22-FS_13s as template led to expected bands as well as a slight smear and an unintended product
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
PCR will be repeated to obtain more sample

Re-PCR from FS_22 to FS_13; 2.7 kb; 10-08-2013)

Amplification of DelAF using gradient PCR, Amplification of DelOP 72°C 2-step; run at 135 V, 0.8 % gel (TAE)(11.08)

Amplification of DelAF using gradient PCR, Amplification of DelOP 72°C 2-step after cutting; run at 135 V, 0.8 % gel (TAE)(11.08)

3x 20µl

Reaction

Reagent	DelOP
Template	1µl FS_22-FS_13_short 10-08-2013
Primer fw	4 µl FS_22
Primer rev	4 µl FS_13
Phusion Ready Mix	10 µl
DMSO	1 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	1:05
1	72	5 min
1	10	inf

Results:

Amplification of DelOP was successfull
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
gradient PCR with annealing at 74°C, 72°C and 70°C will be carried out to increase yield

Amplification V from FS_22 to FS_13; 2.7 kb

Amplification of DelOP V (12-08-13); run at 100 V, 0.8 % gel (TAE)

Amplification of DelOP V (12-08-13) cut

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	4.5 µl FS_22
Primer rev	4.5 µl FS_13
Phusion Ready Mix	10 µl
DMSO	1 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	75.0 - 72.0 (ΔT = 0.5)	1:05
1	72	5 min
1	10	inf

Results:

Amplification of DelOP was successfull
The gradient PCR shows that amplification worked best with an annealing temperature of 72.3°C, interestingly this annealing temperature was used for the remaining mastermix of the gradient PCR which included more DMSO than the other samples as mixing of DMSO often is not perfect and therefore the very last sample is of higher DMSO concentration
Therefore PCR will be repeated with an annealing temperature of 72.3°C and 10% DMSO

13-08-2013

Restriction digest of fragment FS_22 to FS_13; 2.7 kb; 12-08-2013) with EcoRI-HF

Incubation at 37°C for 2 hours

what	µl
FS_22 to FS_13 (12-08-2013)	20
EcoRI-HF	1
CutSmart Buffer	2.5
dd H₂O	1.5
Expected fragment lengths [bp]	1883, 960

Results:

restriction digest shows the expected bands, therefore validation if PCR amplicon is sufficient for Gibson Assembly

Amplification from FS_22 to FS_13; 2.7 kb

Amplification of DelAF (FS_02-FS_05); run at 100 V, 0.8 % gel (TAE)(13.08)

Amplification of DelAF (FS_02-FS_05), cut; run at 100 V, 0.8 % gel (TAE)(13.08)

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	4 µl FS_22
Primer rev	4 µl FS_13
Phusion Ready Mix	10 µl
DMSO	1/2 µl
dd H₂O	1/- µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	1:05
1	72	5 min
1	10	inf

Results:

Amplification of DelOP was successfull with 10% DMSO leading to one specific band of intended size
PCR will be repeated with 10% DMSO to obtain the amount of product which is necessary for Gibson Assembly and test restriction digest

14-08-2013

Concentration measurement DelOP

Fragment	Primer	Date PCR	Concentration
DelOP	FS22-FS13	12-08-2013	11 ng/µl

17-08-2013

Amplification from FS_22 to FS_13; 2.7 kb

6x20 µl

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	2.5 µl FS_22
Primer rev	2.5 µl FS_13
Phusion Ready Mix	10 µl
DMSO	2 µl
dd H₂O	3 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	72.3	5
	72	1:00
1	72	5 min
1	10	inf

18-08-2013

Amplification from FS_22 to FS_13; 2.7 kb

Restriction digest of pSB4K5 (17-08) with DpnI (17-08) and amplification of DelOP (18-08); run at 100 V, 0.8 % gel (TAE)

Restriction digest of pSB4K5 (17-08) with DpnI (17-08) and amplification of DelOP, cut (18-08); run at 100 V, 0.8 % gel (TAE)

6x20 µl

Reaction

Reagent	DelOP
Template	D.acidovorans SPH-1 colony
Primer fw	2.5 µl FS_22
Primer rev	2.5 µl FS_13
Phusion Ready Mix	10 µl
DMSO	2 µl
dd H₂O	3 µl

Conditions

Biorad T100
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	72.3	5
72	1:00
1	72	5 min
1	10	inf

Results:

Amplification of DelOP was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit

15-08-2013

Amplification from FS_01 to FS_16; 4.2 kb

Amplification of DelFG and Backbone pSB4K5; run at 100 V, 0.8 % gel (TAE)(14.08)

Reaction

(2x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad T100
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	62	5
	72	1:30 min
1	72	5 min
1	8	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

Restriction digest of pSB4K5 (FS_01 to FS_16; 4.2 kb; 15-08-2013) with DpnI

Incubation at 37°C for about 6 hours

what	µl
FS_16 to FS_01 (15-08-2013)	30
DpnI	2
CutSmart Buffer	4
dd H₂O	4

Results:

Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

16-08-2013

Concentration measurement

The concentration of the gel purified, and DpnI digested fragment was measured using a NanoDrop Instrument.

Fragment	Primer	Date PCR	Concentration
pSB4K5 DpnI digested	FS01-FS16	15-08-2013	30 ng/µl

Amplification from FS_01 to FS_16; 4.2 kb

Amplification of pSB4K5 (16-08); run at 100 V, 0.8 % gel (TAE)

Amplification of pSB4K5; cut (16-08); run at 100 V, 0.8 % gel (TAE)

Reaction

(3x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad T100
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	62	5
	72	1:30 min
1	72	5 min
1	8	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

17-08-2013

Amplification from FS_01 to FS_16; 4.2 kb

Reaction

(3x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	62	5
	72	1:30 min
1	72	5 min
1	8	inf

Results:

Amplification worked very well, we had bright bands on the right height.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

Restriction digest of pSB4K5 (FS_01 to FS_16; 4.2 kb; 17-08-2013) with DpnI

Restriction digest of pSB4K5 (17-08) with DpnI (17-08) and amplification of DelOP (18-08); run at 100 V, 0.8 % gel (TAE)

Restriction digest of pSB4K5 (17-08) with DpnI (17-08) and amplification of DelOP, cut (18-08); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 6 hours

what	µl
FS_16 to FS_01 (17-08-2013)	30
DpnI	2
CutSmart Buffer	4
dd H₂O	4

Results:

Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

18-08-2013

Amplification from FS_01 to FS_16; 4.2 kb

Reaction

(3x50µl)

what	µl
Template pSB4K5	1
FS_01: (1/10)	2.5
FS_16: (1/10)	2.5
Phusion Master Mix	25
DMSO	2.5
dd H₂O	16.5

Conditions

Biorad MyCycler*
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	62	5
	72	1:30 min
1	72	5 min
1	8	inf

Restriction digest of pSB4K5 (FS_01 to FS_16; 4.2 kb; 18-08-2013) with DpnI

Incubation at 37°C for about 6 hours

what	µl
FS_16 to FS_01 (18-08-2013)	30
DpnI	2
CutSmart Buffer	4
dd H₂O	4

Results:

Digested fragment was run on a gel.
Bands were cut out and DNA purified using QIAquick Gel Extration Kit.

13-08-2013

Amplification from FS_21 to FS_07; 5.2 kb

Amplifcation of DelFG (13-08); run at 100 V, 0.8 % gel (TAE)

Reaction

Reagent	µl
Template	D.acidovorans SPH-1 colony
Primer fw	4 µl FS_21
Primer rev	4 µl FS_07
Phusion Ready Mix	10 µl
DMSO	1 µl
dd H₂O	1 µl

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
30	55	2:00
1	72	10 min
1	10	inf

Results:

Amplification of DelFG worked, but amount of DNA was insufficient
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
PCR will be carried out with another cylcer which by experience of the last amplifications led to higher product yields.

15-08-2013

Amplification from FS_21 to FS_26 ; 5.5 kb

Amplification of DelFG and Backbone pSB4K5; run at 100 V, 0.8 % gel (TAE)(14.08)

Reaction

(5x20 µl)

what	µl
D. acidovorans SPH-1 colony	1
FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:15
1	72	10 min
1	10	inf

Results:

Amplification of DelFG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
obtained DNA will consequently be used for Gibson Assembly
PCR will be repeated to get higher amounts of DNA and increase concentration by purifying several gel slices using the same QIAquick spin column

16-08-2013

Concentration measurement DelFG

all fragments were gel purified, FG were additionally purified with the nucleotide removal kit

Fragment	Primer	Date PCR	Concentration
DelFG	FS21-FS26	29-07-2013	61.4 ng/µl
DelFG after nucleotide removal	FS21-FS26	29-07-2013	30 ng/µl

Amplification from FS_21 to FS_26 ; 5.5 kb

Amplification of DelFG ; run at 100 V, 0.8 % gel (TAE)(14.08)

Reaction

(5x20 µl)

what	µl
D. acidovorans SPH-1 colony	1
FS_21: (1/10)	2
FS_26: (1/10)	2
Phusion flash Master Mix	10
DMSO	1
dd H₂O	4

Conditions

Biometra TProfessional Basic
Cycles	temperature [°C]	Time [s]
1	98	10
30	98	1
	60	5
	72	2:15
1	72	10 min
1	10	inf

Results:

Amplification of DelFG was successful
bands were cut out and DNA purified using QIAquick Gel Extraction Kit
obtained DNA will consequently be used for Gibson Assembly

15-08-2013

Gibson Assembly and electroporation

Assembly of our fragments

Those gel-purified fragments were added for the Gibson assembly of our construct pFSN.

Fragment	Primer	Date	Concentration (ng/µl)	Volume (µl)
pSB4K5	FS_01 - FS_16	14-08-13	13	1.35
AF	FS_02 - FS_05	13-08-13	49.75	2.65
FG	FS_21 - FS_26	07-08-13	24.5	2.69
G	FS_35_SR_01 - FS_23	08-08-13	34.9	2.1
OP	FS_22 - FS_13	13-08-13	36.3	0.89
L	FS_14 - FS_15	07-08-13	51	0.31
Gibson MasterMix NEB			2x	10

Gibson Assembly according to protocols of NEB, 1h at 50°C

Gibson backbone (pSB4K5)

The backbone pSB4K5 was also incubated with the Gibson mastermix. We will use this as one negative control in the electroporation to test the efficiency.

Fragment	Date	Concentration (ng/µl)	Volume (µl)
pSB4K5	14-08-13	13	1.35
H2O			8.65
Gibson MasterMix NEB		2x	10

Gibson Assembly according to protocols of NEB, 1h at 50°C

Electroporation

The following samples were electroporated

mixture		volume used	cells
5 µl Gibson Assembly of pFSN construct	10 µl H2O	1 µl	50 µl DH10β old
5 µl Gibson Assembly of pFSN construct	10 µl H2O	14 µl	50 µl DH10β old
5 µl Gibson Assembly of Backbone (control)	10 µl H2O	1 µl	50 µl DH10β old
pSB4K5 14-08-13		1.35 µl	50 µl DH10β old
pSB6A1 Hanna [69.57 ng/µl] 1:10		1 µl	50 µl DH10β Fanny new

Cells were transdered into 400 µl SOC-medium (NEB) after electroporation
incubation and growth of cells for 1 hour at 37°C
cells were centrifuged for 3 min at 6000rpm, supernatant discarded and cells resuspended in remaining SOC-medium
cells were plated on agar plates containing kanamycine, 10µl on one plate, remaining µl on another plate for electroporation of the construct pFSN and on agar plates containing ampicillin for electroporation of the control backbone pSB6A1

20130816ElectroporationA.JPG 1 µl of diluted Gibson electroporated; 10 µl of E.coli plated	20130816ElectroporationB.jpg 1 µl of diluted Gibson electroporated; Rest of E.coli plated	20130816ElectroporationC.jpg 14 µl of diluted Gibson electroporated; 10 µl of E.coli plated	20130816ElectroporationD.jpg 14 µl of diluted Gibson electroporated; Rest of E.coli plated
P1010689.JPG 1 µl of diluted Gibson (backbone control) electroporated; 10 µl of E.coli plated	P1010690.JPG 1 µl of diluted Gibson (backbone control) electroporated; Rest of E.coli plated	P1010692.JPG 1 µl of backbone control electroporated; 10 µl of E.coli plated	P1010693.JPG 1 µl of backbone control electroporated; Rest of E.coli plated
P1010704.JPG Test of electrocompetence DH10β with 1 µl pSB6A1; 10 µl of E.coli plated	P1010705.JPG Test of electrocompetence DH10β with 1 µl pSB6A1; Rest of E.coli plated

16-08-2013

Colony PCRs

As a lot of colonies grew we screened if DelL and pSB4K5 are present.

File:20130816 2log screeningsophieDelRESTbesch.png

Colony PCRs of red colonies after gibson assembly and electroporation (16-08); run at 100 V, 0.8 % gel (TAE)

Different probes:

A: 1 µl of diluted Gibson electroporated; 10 µl of E.coli plated
B: 1 µl of diluted Gibson electroporated; Rest of E.coli plated
C: 14 µl of diluted Gibson electroporated; 10 µl of E.coli plated
D: 14 µl of diluted Gibson electroporated; Rest of E.coli plated

Only red colonies were chosen for screening
The expected amplicon size is 1.5 kb

Reaction mixture

Reagent	A1, A2	B1-B5	C1-C3	D1-D40
VR-Primer: (1/10)	2 µl	2 µl	2 µl	2 µl
FS_14: (1/10)	2 µl	2 µl	2 µl	2 µl
Colonies	2 red colonies A (A1, A2)	5 red colonies B (B1-B5)	3 red colonies C (C1-C3)	40 red colonies D (D1-D40)
DreamTaq	10 µl	10 µl	10 µl	10 µl
dd H₂O	5 µl	5 µl	5 µl	5 µl

PCR Conditions

--> T100

Cycles-PCR	temperature [°C]	Time [s]
1	95	2:00
12	95	1:00
	66 ↓ 0.5	5
	72	1:30 min
18	95	1:00
	63	5
	72	1:30 min
1	12	inf

Result:

None of the screened colonies led to the correct amplicon, therefore the correct assembly has not worked in any of the white colonies
screening will be repeated, with white colonies as template, as bacteria including the correct 32 kbp backbone might not be capable of expressing mRFP anymore due to the large insert between lac promotor and mRFP

17-08-2013

Colony PCRs

File:20130817 2log DelRestwhiteColonyPCRsbesch.png

Colony PCRs of white colonies after gibson assembly and electroporation (17-08); run at 100 V, 0.8 % gel (TAE)

Different probes:

A 1 µl of diluted Gibson Assembly electroporated; 10 µl of E.coli plated
B 1 µl of diluted Gibson Assembly electroporated; remaining E.coli plated
C 14 µl of diluted Gibson Assembly electroporated; 10 µl of E.coli plated
D 14 µl of diluted Gibson Assembly electroporated; remaining E.coli plated

Only white colonies where chosen for screening
The expected amplicon size is 1.5 kb

Reaction mixture

Reagent	B1w	C1w	D1w-D10w
VR-Primer: (1/10)	2 µl	2 µl	2 µl
FS_14: (1/10)	2 µl	2 µl	2 µl
Colonies	1 white colony B (B1w)	1 white colony C (C1w)	10 white colonies D (D1w-D10w)
DreamTaq	10 µl	10 µl	10 µl
dd H₂O	5 µl	5 µl	5 µl

PCR Conditions

--> T100

Cycles-PCR	temperature [°C]	Time [s]
1	95	2:00
12	95	1:00
	66 ↓ 0.5	5
	72	1:30 min
18	95	1:00
	63	5
	72	1:30 min
1	12	inf

Result:

Colony D8w shows expected amplicon of 1.5kbp
The other colonies were screened negative.
D8w will be transfered to liquid culture to repeat screening PCR as well as for further validation beeing screening for the other insert fragments as well as test restriction digest
Furthermore another electorporation will be carried out to yield more clones positive for screening with the Primers VR and FS_14, therefore the remaining 10µl of the Gibson assembly will be purified using isopropanol precipitation

Electroporation

We electroporated the Gibson assembly (15-08) again to increase the chance of a positive clone. We purified it by isopropanol purification.

mixture		volume used	Cells
Assembled fragments (15-08) isopropanol precipitated		15 µl	50 µl DH10β

Cells were transdered into 400 µl SOC-medium (NEB) after electroporation
incubation and growth of cells for 1 hour at 37°C
cells were centrifuged for 3 min at 6000rpm, supernatant discarded and cells resuspended in remaining SOC-medium
cells were plated on agar plates containing kanamycine, 10µl on one plate, remaining µl on another plate for electroporation of the construct pFSN

P1010701.JPG

15 µl of Gibson 15-08 (isopropanol precipitated) electroporated; 10 µl of E.coli plated

P1010702.JPG

15 µl of Gibson 15-08 (isopropanol precipitated) electroporated; Rest of E.coli plated

18-08-2013

Colony PCRs

File:20130818 log2 D8w D11w-D23w E1w-E19w E1r-E10r F1w-F28w F1r-F133 F19r F16r.png

Colony PCRs to test if pSB4K5 and DelL are ligated; run at 100 V, 0.8 % gel (TAE)(14.08)

Different probes:

D: 14 µl of diluted Gibson Assembly electroporated; remaining E.coli plated
E: 1 µl isopropanol precipitated Gibson Assembly (15-08) ; 10 µl of E.coli plated
F: 1 µl isopropanol precipitated Gibson Assembly (15-08); remaining E.coli plated

The expected amplicon size is 1.5 kb
3 colonies were sceened in one PCR

Reaction mixture

Reagent	D8w	D11w-D24w	E1w-E19w	F1w-F20w	E1r-E10	F1r-F20r
VR-Primer: (1/10)	2 µl	2 µl	2 µl	2 µl	2 µl	2 µl
FS_14: (1/10)	2 µl	2 µl	2 µl	2 µl	2 µl	2 µl
Colonies	Colony D8w liquid culture	24 white colonies D (D1w-D24w)	19 white colonies E (E1w-E19w)	30 white colonies F (F1w-F20w)	10 red colonies E (E1r-E10r)	20 red colonies F (F1r-F20r)
DreamTaq	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
dd H₂O	5 µl	5 µl	5 µl	5 µl	5 µl	5 µl

PCR Conditions

--> T100

Cycles-PCR	temperature [°C]	Time [s]
1	95	2:00
12	95	1:00
	66 ↓ 0.5	5
	72	1:30 min
18	95	1:00
	63	5
	72	1:30 min
1	12	inf

Result:

colony D8w again showed the expected amplicon in the colony PCR and will therefore be further analyzed for the other fragments as well as restriction digested and partially sequenced as soon as screening primers arive
Furthermore colonies E16w and F25w are screened positive for the fragment DelL

Validation of pFSN

We screened for more colonies with pFSN but we didn't find any more positive clones.

Furthermore we did some tests for the validation of pFSN in colony D8w.

Results

Validation of pFSN in clone D8w
Method	Details method	Result
Screening for inserted fragments	Fragments pSB4K5 and DelA-F
Screening for inserted fragments	Fragments DelA-F and DelF-G
Restriction Digest	EcoRI
	BamHI
	BglII
Sequencing gibson overlaps	Primer FS_13_short
	Primer FS_22
	Primer VFII
	Primer VR

There is a mutation at the beginning of the mRFP cassette. This explains why the colonies do not get red. All other tests for valiation were positive. Consequently colony D8w includes the right plasmid. Because we cannot use mRFP as expression control we will do SDS-PAGE instead to prove that the proteins are expressed.

19-08-2013

Concentration measurement

The concentration of the gel purified, and DpnI digested fragments was measured using a NanoDrop Instrument.

Fragment	Primer	Date PCR	Concentration
pSB4K5 DpnI digested	FS_01-FS_16	17-08-2013	101.2 ng/µl
pSB4K5 DpnI digested	FS_01-FS_16	18-08-2013	159.2 ng/µl

19-08-2013

Colony PCRs for testing ligation of pSB4K5 and DelL

Reaction mixture

Reagent	E13w	E14w	E15w	F25w	F26w	F27w
VR-Primer: (1/10)	2 µl	2 µl	2 µl	2 µl	2 µl	2 µl
FS_14: (1/10)	2 µl	2 µl	2 µl	2 µl	2 µl	2 µl
Colonies	Colony E13w liquid culture	Colony E14w liquid culture	Colony E15w liquid culture	Colony F25w liquid culture	Colony F26w liquid culture	Colony F27w liquid culture
DreamTaq	10 µl	10 µl	10 µl	10 µl	10 µl	10 µl
dd H₂O	5 µl	5 µl	5 µl	5 µl	5 µl	5 µl

Result:

Colony F26w was screened positive, as it shows the expected band at 1.4kbp, the others were screened negative

8 ml of colony D8w and colony D26w (pFSN-1) were midi-preped according to protocol 'Preparation of large plasmids'.

Colony PCRs for testing ligation of pSB4K5 and DelAF, as well as DelAF and DelFG

Sceening of colonies D8w and D26w for fragments pSB4K5, DelAF, and DelFG.

Reaction mixture

Reagent	D8w	D8w	F26w	F26w
Primer_fw (1/10)	2 µl FS_47	2 µl FS_51	2 µl FS_47	2 µl FS_51
Primer_rv (1/10)	2 µl FS_48	2 µl FS_52	2 µl FS_48	2 µl FS_52
Colonies	Colony D8w liquid culture	Colony D8w liquid culture	Colony F26w liquid culture	Colony F26w liquid culture
DreamTaq	10 µl	10 µl	10 µl	10 µl
dd H₂O	5 µl	5 µl	5 µl	5 µl
Expected band	547 bp	724 bp	547 bp	724 bp

Results:

The screening was positive for clone D8w with both primer combinations.
Thus this clone contains the backbone pSB4K5, the genes DelA, DelB, DelC, DelD, DelE, DelF, DelL and at least a part of the gene DelG.
For colony F26w the screenings were negativ.

Restriction digest of pFSN (31.435 kbp)

Restriction digest of pFSN (19-08) with l2:EcoRI, l3:BamHI, l4:BglII (17-08); run at 100 V, 0.8 % gel (TAE)

Incubation at 37°C for about 6 hours

Reagent			µl
pFSN			1
EcoRI	BamH1	BglII	2
CutSmart Buffer			0.5
dd H₂O			1.5
Expected fragment lengths [bp] EcoRI		9798, 7856, 5276, 4624, 2529, 1212
Expected fragment lengths [bp] BamHI		23860, 7435
Expected fragment lengths [bp] BglII		14223, 11919, 3291, 1892

Results:

All digests displayed the expected bands and thus were positive.
Therefore the pFSN plasmid is very likely our desired construct.

20-08-2013

Sequencing

The construct pFSN was isolated from overnight culture using the 'Preparation of large plasmids' protocol.
Single read sequencing was carried out by GATC Biotech
obtained .abi files were analyzed with UniPro Ugene, part of sequence showing convenient chromatogram was chosen for alignment using ClustalOmega

Sequence-Files from GATC Biotech

Sequencing of pFSN-1 with Primer FS_13_short

Sequencing of pFSN-1 with Primer FS_22

Sequencing of pFSN-1 with Primer VFII

Sequencing of pFSN-1 with Primer VR

Alignments

Alignment for sequencing of pFSN with primer FS_13s_rv against the expected construct to validate sequence of DelOP	Alignement for sequencing of pFSN with primer FS_57_rv against the expected construct to validate the sequence for the overlap of DelOP to DelG	Alignement for sequencing of pFSN with primer FS_58_fw against the expected construct to validate the sequence for the overlap of DelOP to DelL	Alignement for sequencing of pFSN with primer FS_63_rv against the expected construct to validate the sequence for the overlap of DelL to mRFP
Alignement for sequencing of pFSN with primer VF2 against the expected construct to validate the sequence for the overlap of pSB4K5 to DelAF

Results:

Sequencing of the final construct pFSN for all internal Gibson sites validated the intended sequence
Sequence of mRFP shows mutations within the primer site, therefore it can be concluded that mRFP is not functional
Colonies of D8w will be further analyzed by FACs to investigate whether mRFP is functional or not
Additionaly, SDS-page of clone D8w will be conducted to check for expression of the inserted Del genes
Concluding the results of colony PCRs, restriction digests and sequencing it can be concluded, that we successfully amplified 28 kbp of genomic DNA from our donator organism Delftia acidovorans SPH-1 distributed from the DSMZ, ligated the thereby obtained 6 fragments including the standard biobrick backbone pSB4K5 sucessfully in the intended order and consequently transformed a plasmid of 32 kbp in total into E. Coli using electroporation

21-08-2013

Another 8 ml of colony D8w (pFSN-1) were midi-preped according to protocol 'Preparation of large plasmids'.

Overview
Gibson assembly and validation

Validation of pFSN

This week we will analyze our positive D8w clone for expression of our pFSN plasmid. Therefore a SDS page will be carried out

Results

This week we carried out an SDS-PAGE with our clone D8w containing the pFSN plasmid. We used E.coli DH10ß as control. For our transformed E.coli a clear band at about 190 kDa was visible. This corresponds to the molecular weight of DelE (192,473 kDa). Consequently we showed that DelE is recombinantly expressed. Futhermore one could sense a very weak band at the height of about360 kDa. However this band could not be captured on an image. Consequently the samples have to be applied on a gel in a higher about again.

30-08-2013

SDS-PAGE

Lysis of cells

1 ml over night cultures in LB of electrocompetent DH10ß, DH10ß with pSB4K5 and DH10ß with pFSN
meausured ODs (DH10ß= 1,32; DH10ß+pSB4K5= 1,28; DH10ß+pFSN= 1,12)
centrifugation at 13000 rpm for 10 min
discarded supernatant
resuspended in 66 µl(DH10ß), 64 µl(DH10ß+pSB4K5) and DH10ß+pFSN= 56 µl 1x loading buffer (40% ddH₂O, 12.5% TrisHCl pH=7.5, 20% Glycerol (50%), 20% SDS (10%), 5% β-Mercaptoethanol, 2.5% Bromophenol blue)
boiled samples for 10 min at 98°C

Electrophoresis

Applied 2.5 µl and 10 µl of each sample on SDS-polyacrylamide gel
Let it run for 1 h at 180 V

Staining and destaining procedure

Gel was stained in Coomassie Brilliant Blue for 1 h on shaker
Destaining with destaining buffer (50% ddH₂O, 40% Methanol, 10% Acetic acid) until bands were visible

Results:

SDS-PAGE of the samples DH10β, DH10β+pSB4K5 and DH10β+pFSN; arrow indicates band of DelE

One band at a height of about 190 kDa was visible in DH10ß+pFSN, but not in the controls. As the protein DelE has a molecular weight of 192.52 kDa this band is probably DelE.
A very weak band could be detected well above the 260 kDa band of the ladder. We suspect that this might be DelG, as it has a molecular weight of 357.33 kDa, however the band was too weak to capture it in a picture. Thus a bigger amount of the samples have to be applied on a SDS-PAGE again.

Overview
Gibson assembly and validation

Validation of pFSN

SDS-PAGE will be repeated to analyze expression of Del genes from our plasmid pFSN

Results

This week we appiled the samples of week 18 on an SDS-PAGE again, as last time we were able to detect DelE, but only saw a band at the height of DelG which was so weak that it could not be captured on a photograph. Therefore we applied more of the samples. The results were positiv. A band could be detected at about 360 kDa was visible. The band of DelE was present again as well. Therefore we were able to prove that DelG is also expressed. As the genes DelA, DelB, DelC, DelD and DelF are regulated by the same promotor as DelE and DelG we assume that these proteins are expressed likewise.

02-09-2013

SDS-PAGE of Samples 30-08-2013

Electrophoresis

Applied 15 µl and 25 µl of the sample DH10ß+pSB4K5 and DH10ß+pFSN 30-08-2013 on a SDS-polyacrylamide gel again.
Let it run for 1 h at 180 V

Staining and destaining procedure

Gel was stained in Coomassie Brilliant Blue for 1 h on shaker
Destaining with destaining buffer (50% ddH₂O, 40% Methanol, 10% Acetic acid) until bands were visible

Results:

SDS-PAGE of the samples DH10β+pSB4K5 and DH10β+pFSN; arrows indicate bands of DelE and DelG

Bands of about 190 kDa and 350 kDa were visible in the sample DH10ß+pFSN but not DH10ß+pSB4K5. These bands correlate to the proteins DelE (192.52 kDa) and DelG (357.33 kDa). The other proteins which should be expressed by our plasmid could not be detected as there is much background of the proteins of the cells at these heights.
Still, as the genes DelA, DelB, DelC, DelD and DelF are closer to the promotor as DelG, we suspect that these genes are expressed as well.

Thanks to

Team:Heidelberg/Delftibactin/DelRest

From 2013.igem.org

Team

Project

Notebook

Parts

Software

Human Practice

Safety

Modeling

Del Rest. Creating a 32 kb plasmid.

Week 10

Week 11

Week 12

Week 13

Week 14

Week 15

Week 16

Week 17

Week 18

Week 19

Methods:

Strategy

Plasmid backbone part from the partsregistry

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

06-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

03-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

04-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

05-08-2013

Amplification from FS_02 to FS_07; 16.4 kb

06-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

03-07-2013

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_11; 11.6 kb

05-07-2013

Amplification from FS_06 to FS_07; 5.2 kb

05-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

07-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

04-07-2013

Amplification from FS_12 to FS_13; 2.7 kb

04-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

06-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

05-07-2013

Amplification from FS_01 to FS_16; 4.2 kb

Strategy

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

08-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

12-07-2013

Amplification from FS_02 to FS_07; 16.4 kb

09-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

11-07-2013

Amplification from FS_04 to FS_11s; 17.5 kb

Amplification from FS_04 to FS_11; 17.5 kb; Phusion II

14-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

09-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

13-07-2013

Amplification from FS_10 to FS_11s; 3.3 kb

Amplification from FS_10 to FS_11(s); 3.3 kb

11-07-2013

Amplification from FS_13s to FS_15s; 6.4 kb

12-07-2013